==== Front PLoS One PLoS One plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0237759 PONE-D-20-23466 Research Article Biology and life sciences Genetics DNA DNA repair Biology and life sciences Biochemistry Nucleic acids DNA DNA repair Biology and life sciences Genetics DNA DNA damage Biology and life sciences Biochemistry Nucleic acids DNA DNA damage Biology and life sciences Genetics DNA DNA repair Non-Homologous End Joining Biology and life sciences Biochemistry Nucleic acids DNA DNA repair Non-Homologous End Joining Biology and Life Sciences Cell Biology Chromosome Biology Chromatin Biology and Life Sciences Genetics Epigenetics Chromatin Biology and Life Sciences Genetics Gene Expression Chromatin Biology and life sciences Biochemistry Nucleic acids RNA Guide RNA Biology and Life Sciences Molecular Biology Molecular Biology Techniques Transfection Research and Analysis Methods Molecular Biology Techniques Transfection Research and analysis methods Biological cultures Cell lines 293T cells Biology and life sciences Biochemistry Proteins DNA-binding proteins Nucleases Biology and Life Sciences Biochemistry Enzymology Enzymes Hydrolases Nucleases Biology and Life Sciences Biochemistry Proteins Enzymes Hydrolases Nucleases Site-specific targeting of a light activated dCas9-KillerRed fusion protein generates transient, localized regions of oxidative DNA damage Creating targeted regions of DNA damagehttps://orcid.org/0000-0003-1264-7699House Nealia C. M. ConceptualizationInvestigationMethodologyWriting – original draftWriting – review & editing1 Parasuram Ramya Formal analysisInvestigation1 Layer Jacob V. Formal analysis2¤ https://orcid.org/0000-0001-7075-4906Price Brendan D. ConceptualizationFunding acquisitionSupervisionWriting – review & editing1* 1 Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, United States of America 2 Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA, United States of America Sobol Robert W. Editor University of South Alabama Mitchell Cancer Institute, UNITED STATES Competing Interests: The authors declare that no competing interests exist. Although JVL is currently employed by eGenesis, all studies reported in this submission were completed while JVL was an employee of the Dana-Farber Cancer Institute. eGenesis did not provide JVL with any financial support for salary or materials, and had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. This does not alter our adherence to PLOS ONE policies on sharing data and materials. ¤ Current address: eGenesis, Cambridge, MA, United States of America * E-mail: Brendan_price@dfci.harvard.edu 17 12 2020 2020 15 12 e023775928 7 2020 30 11 2020 © 2020 House et al2020House et alThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.DNA repair requires reorganization of the local chromatin structure to facilitate access to and repair of the DNA. Studying DNA double-strand break (DSB) repair in specific chromatin domains has been aided by the use of sequence-specific endonucleases to generate targeted breaks. Here, we describe a new approach that combines KillerRed, a photosensitizer that generates reactive oxygen species (ROS) when exposed to light, and the genome-targeting properties of the CRISPR/Cas9 system. Fusing KillerRed to catalytically inactive Cas9 (dCas9) generates dCas9-KR, which can then be targeted to any desired genomic region with an appropriate guide RNA. Activation of dCas9-KR with green light generates a local increase in reactive oxygen species, resulting in “clustered” oxidative damage, including both DNA breaks and base damage. Activation of dCas9-KR rapidly (within minutes) increases both γH2AX and recruitment of the KU70/80 complex. Importantly, this damage is repaired within 10 minutes of termination of light exposure, indicating that the DNA damage generated by dCas9-KR is both rapid and transient. Further, repair is carried out exclusively through NHEJ, with no detectable contribution from HR-based mechanisms. Surprisingly, sequencing of repaired DNA damage regions did not reveal any increase in either mutations or INDELs in the targeted region, implying that NHEJ has high fidelity under the conditions of low level, limited damage. The dCas9-KR approach for creating targeted damage has significant advantages over the use of endonucleases, since the duration and intensity of DNA damage can be controlled in “real time” by controlling light exposure. In addition, unlike endonucleases that carry out multiple cut-repair cycles, dCas9-KR produces a single burst of damage, more closely resembling the type of damage experienced during acute exposure to reactive oxygen species or environmental toxins. dCas9-KR is a promising system to induce DNA damage and measure site-specific repair kinetics at clustered DNA lesions. http://dx.doi.org/10.13039/100000054National Cancer InstituteCA93602https://orcid.org/0000-0001-7075-4906Price Brendan D. http://dx.doi.org/10.13039/100000054National Cancer InstituteCA177884https://orcid.org/0000-0001-7075-4906Price Brendan D. This work was supported by NIH grants CA177804 (BDP) and CA93602 (BDP). One of us (JVL) is currently employed by eGenesis, Cambridge, MA. However, JVL’s contribution to the current work was solely carried out while he was an employee of the Dana-Farber Cancer Institute and was completed prior to JVL’s departure from the DFCI. “eGenesis did not provide support in the form of salaries to either JVL or other workers, and did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section. Data AvailabilityAll relevant data are within the manuscript and its Supporting Information files.Data Availability All relevant data are within the manuscript and its Supporting Information files. ==== Body Introduction DNA repair is a dynamic process that requires coordination between chromatin remodelers and DNA repair enzymes to detect and access DNA lesions within the complex 3D structure of chromatin [1–3]. DNA double-strand breaks (DSB) are complex lesions whose repair requires reorganization of the local chromatin structure. This process requires exchange of histone variants H2A.Z and H3.3, chromatin reorganization by remodeling complexes, including NuA4-TIP60, INO80 and CHD3/CHD4 [4–11], as well as histone modification through e.g. acetylation [12, 13]. In addition, compact chromatin structures such as heterochromatin have reduced DSB repair efficiency and require dedicated remodeling events, such as phosphorylation of KAP1 [14], to promote access to and repair of damage in these regions [15]. These processes function together to modulate chromatin accessibility at damage sites [16, 17], so that chromatin conformation does not impede the access of the DNA repair machinery to the damaged chromatin [18–22]. This chromatin reorganization in response to DNA damage then controls the recruitment of DNA repair proteins, such as 53BP1 [23], and directs repair into either homologous recombination or non-homologous end-joining DNA repair pathways [24]. Studying repair in defined chromatin domains has relied on the use of endonucleases to create multiple DSBs, such as AsiSI [25, 26], or targeted DSBs created with I-SceI, Zinc Finger Nucleases or Cas9/gRNAs [4, 27]. AsiSI generates hundreds of unique DSBs and, when coupled with chromatin immunoprecipitation and sequencing (ChIP-seq), has been used to demonstrate that transcriptionally active regions are preferentially repaired by HR [26] and to map γH2AX spreading from DSBs [25]. Targeted DSBs have been used to identify histone modifications and patterns of histone exchange following DNA damage [4, 5, 28], while Cas9/gRNA has been used widely to monitor repair mechanism pathways and the fidelity of DNA repair [27, 29]. These approaches have provided invaluable insights into how the DNA repair machinery works in concert with the chromatin. However, these systems require inducible expression of AsiSI or Cas9/gRNA [26], transfection of the expression vector [5], or the use of protein stabilizers or nuclear exclusion (reviewed in [27]), which can lead to a time delay between expression of the enzyme and robust cutting of the target site. Further, endonucleases and Cas9/gRNA induce multiple rounds of DSB production and repair, which continues until errors accumulate at the target site and eliminates the recognition sequence. As a consequence, these approaches tend to measure bulk repair products, lack the time resolution to monitor events occurring immediately after DNA damage, and may represent responses to persistent damage, rather than acute damage-repair. Further, while endonucleases induce clean, enzymatic DSBs which can be readily resected, they lack the complexity of clustered DNA damage generated by ROS or radiation [30]. Repair of endonuclease-generated breaks may therefore differ from repair of endogenous DNA damage. Here, we have developed a system to induce rapid, transient, site-specific DNA damage that mimics complex, oxidative lesions generated in vivo. For this, we used the KillerRed (KR) chromophore, a GFP-related protein isolated and modified from the hydrozoan anm2CP, which generates superoxide when activated by green light [31, 32]. This superoxide is converted to a variety of reactive oxygen species, including H2O2 and hydroxyl radicals, that can cause direct base damage and DNA strand breaks [31–33]. ROS have short half-lives and limited diffusion, and therefore react very close to their site of formation [34]. Tethering of KR to transcription activators and repressors [12, 35] or histone H2B [33] has previously been demonstrated to induce localized DNA damage, including single and double DNA strand breaks, following light activation in whole cells. Here, we created a fusion protein linking KR to the C-terminus of nuclease inactive Cas9 (dCas9), generating dCas9-KR. dCas9-KR can be targeted to any desired genomic region with an appropriate guide RNA. Targeting dCas9-KR to a unique genomic site, followed by transient exposure to activating green light, generates local damage that is preferentially and rapidly repaired by NHEJ. Further, ChIP analysis confirms rapid and reversible changes in both γH2AX and H4 acetylation, histone modifications associated with DSB repair. Surprisingly, next-generation sequence analysis indicates that dCas9-KR-induced lesions are repaired with few detectable errors. dCas9-KR is therefore a useful model for monitoring DNA repair kinetics and endogenous DNA damage following transient production of DNA damage. Results dCas9-KR is recruited to a defined chromatin site and induces site-specific DNA damage dCas9-KR was generated by gene synthesis (DNA2.0, CA), which fused the KillerRed chromophore to the C-terminus of Cas9m4, a nuclease-dead Cas9 that retains gRNA-mediated DNA binding [36] (See S1 File for sequence information). dCas9-KR was then targeted to the AAVS1 locus by a specific gRNA, since this locus has been previously used by us to study DSB repair [5]. dCas9-KR was transfected in absence or presence of the AAVS1 gRNA, followed by ChIP using an antibody against the KR moiety (Fig 1A). Although dCas9-KR was efficiently expressed in cells (Fig 1B), no significant enrichment of dCas9-KR protein was detected using ChIP at the AAVS1 site in the absence of gRNA (Fig 1A). However, co-expression of dCas9-KR and the AAVS1 gRNA led to robust recruitment and localization of dCas9-KR to the AAVS1 locus, where it was retained for up to 72hrs post-transfection. dCas9-KR is therefore efficiently targeted to the AAVS1 locus. 10.1371/journal.pone.0237759.g001Fig 1 dCas9-KR is recruited to the AAVS1 locus. (A) 293T cells were transiently transfected with dCas9-KR and AAVS1 sgRNA as indicated, followed by ChIP with the KR antibody at the indicated times. Results are calculated as IP/Input signal, expressed as a percentage (n ≥ 2). (B) dCas9-KR expression levels in 293T cells at the indicated times following transient transfection. (C) 293T cells were transiently transfected with either vector (-), dCas9-KR or AAVS1 gRNA as indicated. 24 hrs later, cells were exposed to 20K Lux for the indicated times and γH2AX and H4 monitored by Western blot. γH2AX signal was quantitated using an Odyssey Imager, with 3 independent biological replicates. Statistical analysis revealed no significant increase in γH2AX under these conditions. (D) 293T cells expressing dCas9-KR and the AAVS1 gRNA were exposed to 20K or 38K lux for the indicated times. 24 hrs later, viable cells were measured using Trypan Blue. Percent survival relative to a paired, untreated control is plotted (n ≥ 2). dCas9-KR was activated by exposing cells to green light (523 nm) produced by a SugarCube LED, with light intensity measured using a standard luxometer to control for consistent light delivery (S1 Fig). Initially, we determined if light activation of dCas9-KR in the nucleus leads to widespread production of DNA damage due to ROS production. For this, cells were transfected with dCas9-KR with or without sgRNA (S1C Fig), followed by exposure to 20K lux for 10 min or 1 hr. Under these conditions, there was no significant increase in global γH2AX (Fig 1C), or reduction in cell viability (Fig 1D). Activation of dCas9-KR by light does not therefore generate either widespread DNA damage or alter cell viability by these conditions. Next, we examined if targeting of dCas9-KR to the chromatin can induce DNA damage at the targeted site. For this, γH2AX was measured by ChIP after different intensities of green LED light exposure. In the absence of the AAVS1 gRNA, dCas9-KR did not alter γH2AX after exposure to 5K or 20K lux for 1 hr (Fig 2A). Further, addition of the sgRNA to target dCas9-KR to the chromatin (Fig 1A) did not alter γH2AX in the absence of light, indicating that targeting of dCas9-KR to the AAVS1 site does not alter local γH2AX (Fig 2A, grey bars). However, subsequent exposure to 5K or 20K lux led to a rapid, dose dependent increase in γH2AX at the dCas9-KR/sgRNA binding site (Fig 2A). To verify that the increased γH2AX after light activation of dCas9-KR depends on ROS production, cells were incubated with the H2O2 scavenger N-acetylcysteine (NAC). NAC pre-treatment inhibited γH2AX formation after either 10 min or 60min illumination with 20K lux (Fig 2B), consistent with DNA damage being induced by ROS. To determine if oxidative base damage was occurring at the dCas9-KR target site after activation, recruitment of the base excision repair (BER) endonuclease APE1 was measured. After 1 hr of 20K lux treatment, a modest enrichment of APE1 was detected (S2A Fig), coincident with γH2AX (Fig 2A). Surprisingly, the scaffolding protein XRCC1, which is involved in stabilizing repair factors at sites of BER and single stranded breaks (SSBs), is not detectable by ChIP after dCas9-KR activation (S2B Fig). We conclude that ROS produced by dCas9-KR after green light activation generates DNA damage and increases γH2AX. 10.1371/journal.pone.0237759.g002Fig 2 ROS produced by dCas9-KR induces DNA damage. (A) 293T cells were co-transfected with dCas9-KR in the absence or presence of the AAVS1 gRNA. 24 hrs later, cells were illuminated with green LED light at the indicated lux for 1 hr and allowed to recover at 37°C for 15 mins, followed by ChIP for γH2AX with qPCR primers +3.5 kb from the AAVS1 gRNA site. p values less than 0.05 indicated as *. (B) 293T cells were transfected with dCas9-KR plus AAVS1 gRNA and 24 hrs later were incubated for 1 hr with N-acetylcysteine (NAC), followed by illumination with 20K lux for 10 minutes or 60 minutes. ChIP for γH2AX was carried out as in (A). (C) 293T cells were transfected with dCas9-KR or dCas9-KR + AAVS1 gRNA, and 24 hrs later were either not illuminated or illuminated with 5K or 20K lux for 1 hr. γH2AX ChIP was performed as in (A), using primer pairs at the indicated distance from AAVS1 sgRNA target site (0 kb). p < 0.01 for dCas9-KR + sgAAVS1 plus 5K or 20K Lux (green lines) at all positions except -1.5kb. (D) Cells transiently transfected with dCas9-KR and sgAAVS1 were illuminated at 20K lux for 10 minutes and then allowed to recover for the indicated times. ChIP for γH2AX was then carried out at the indicated chromatin locations. Each experiment was paired with an unilluminated control. Enrichment of γH2AX at the indicated distances from the sgAAVS1 target site is expressed as a fold increase over NT (IP/Input illuminated divided by IP/Input not illuminated). p values less than 0.05 indicated as *. (E) As in (D), but with ChIP for H4ac. All ChIP experiments represent the average of at least three biological replicates with the technical SEM. γH2AX can spread 0.5-1Mb from DSBs [25]. ROS production by dCas9-KR could generate clusters of DNA lesions that spread from the dCas9-KR binding site and could potentially be converted to DSBs. We therefore measured γH2AX spreading by ChIP after DNA damage as a marker for DSB production. Exposure to 5K or 20K lux for 1 hr led to γH2AX spreading at least 10 kb from the dCas9-KR binding site (Fig 2C). Importantly, this increase in signal was dependent on the presence of the AAVS1 sgRNA (Fig 2C, green lines). The small increase in γH2AX at -1.5kb from the dCas9-KR site (Fig 2E) is due to the low levels of H2AX occupancy at this site (S2C Fig). Given that γH2AX was detectable after as little as 10 minutes of 20K lux exposure (Fig 2B), we next asked how rapidly repair proceeds after damage delivery. To survey repair dynamics, γH2AX was monitored during the recovery from a brief (10 minutes) exposure to 20K lux. At 1 min post-illumination, γH2AX is enriched 1.5 to 2-fold at several chromatin locations (Fig 2D). However, this increase in γH2AX signal quickly recovers and by 5 minutes post-illumination returns to baseline levels. We also examined a second epigenetic modification, the acetylation of histone H4 (H4Ac), which, like γH2AX, is rapidly increased at DSBs [5, 37]. At all loci tested, light activation of dCas9-KR immediately (within 1 min) increased H4Ac (Fig 2E). Interestingly, H4Ac was then reversed, with H4Ac dropping to levels approximately 50% below basal values by 5 mins, coupled with re-establishment of H4Ac basal levels over the next 20 minutes (Fig 2E). Rapid increases in H4Ac followed by removal is consistent with dynamic modulation of the chromatin structure, including altered chromatin accessibility, occurring during repair [28]. We conclude that transient DNA damage generated by dCas9-KR leads to rapid chromatin modification, followed by re-establishment of the pre-existing epigenetic landscape. Further, the repair of dCas9-KR damage is rapid and essentially complete within 5 minutes of removal of the light source. dCas9-KR damage recruits KU70/80 The appearance of γH2AX following dCas9-KR activation (Fig 2) suggests the presence of DNA double-strand breaks (DSBs). We therefore examined if DSB repair factors were recruited to these lesions. However, neither RPA (Fig 3A) nor BRCA1 (Fig 3B) were detectable after dCas9-KR activation. To determine if persistent, unrepaired damage might be repaired by HR at later time points, dCas9-KR was activated for 10 mins, and BRCA1 monitored by ChIP during a 30 minute recovery period (Fig 3C). However, no BRCA1 was detected in this recovery/repair period. As a control, we detected robust BRCA1 accumulation when a persistent DSB was created at the dCas9-KR binding site using the p84-ZFN (Fig 3C). DNA damage created by dCas9-KR is therefore not substantially repaired by HR. We next tested recruitment of the KU70/80 complex, a key regulator of NHEJ. Exposure to either 5K or 20K lux illumination induced accumulation of KU70/80 which spread at least 10 kb from the dCas9-KR binding site (Fig 3D). Previous work indicated that KU70/80 was restricted to within 1.5 kb of the DSB [38]. The presence of KU70/80 far from the dCas9-KR site could be due to ROS diffusion from the dCas9-KR site, or reflect the 3D chromatin conformation bringing distal loci into close contact with the dCas9-KR target site, leading to widespread damage (and potentially DSBs) across the entire chromatin region. The absence of HR proteins but accumulation of the NHEJ protein KU70/80 implies that DNA damage generated by dCas9-KR is predominantly repaired via NHEJ. 10.1371/journal.pone.0237759.g003Fig 3 The NHEJ factor Ku70/80 is recruited to dCas9-KR damage. 293T cells were transfected with dCas9-KR and the AAVS1 gRNA, followed by exposure to 0, 5K or 20K lux for 1hr, followed by ChIP for (A) RPA or (B) BRCA1, at the indicated chromatin locations. (C) Left image: 293T cells transfected with dCas9-KR and the AAVS1 gRNA were either untreated (NT) or exposed to 20K lux for 10 min, and then either processed immediately for ChIP (t = 0 min) or allowed to recover for 10 min or 30 mins, followed by ChIP for BRCA1. Right image: ChIP for BRCA1 at the AAVS1 site 18hr after transfection of vector (Uncut) or p84-ZFN to generate a DSB. (D) 293T cells were transfected with dCas9-KR and the AAVS1 gRNA, exposed to 0, 5K or 20K lux for 1hr, followed by ChIP using an antibody specific to the KU70/80 heterodimer. All ChIP experiments represent the average of at least two biological replicates with the technical SEM, with * = p< 0.05 and ** = p< 0.01. dCas9-KR damage is repaired with high fidelity To determine if repair of dCas9-KR DNA damage led to the accumulation of mutations or insertion/deletions (INDELs), template integrity was measured by qPCR immediately after light activation, using light exposure conditions that led to accumulation of KU70/80 at the dCas9-KR site (Fig 3E). Genomic DNA remained intact after 10 minutes of 20K lux exposure, consistent with few lesions that interfere with PCR amplification (Fig 4A). Extended exposure for 1hr at 20K Lux led to variable decreases in template integrity across multiple replicates, but these did not reach statistical significance (Fig 4A). Next, we examined if this level of damage was mutagenic by sequencing DNA at the dCas9-KR binding site. Because both γH2AX (Fig 2D) and KU70/80 (Fig 3D) are highly enriched 0.5 kb on either side of the dCas9-KR binding site, we chose to amplify a 2kb product that spanned this region. DNA was isolated 24hr after exposure to either 5K or 20K lux (to allow time for repair and cell division), followed by Sanger sequencing to identify mutations. However, Sanger sequencing did not identify major sequence differences between control and light exposed DNA sequences (Fig 4B). Further, the chromatographs did not indicate a substantial increase in background peaks after damage (Fig 4B), indicating that any potential INDELs or mutations occur at very low frequency. To capture what might be a low percentage of cells exhibiting mutations after dCas9-KR activation, next-generation sequencing was used to further analyze potential mutations/INDELs. dCas9-KR was activated at 20K lux for 10 min or 1 hr, allowed to recover for 48 hr, and a 241 bp genomic fragment spanning -80 bp to +161 bp at the dCas9-KR target site was amplified. Surprisingly, the mutational frequency was not increased compared to either non-transfected or dCas9-KR only (no gRNA) controls (Fig 4C; S3A–S3C Fig), even in the absence of DNA Ligase IV, a ligase essential to NHEJ (S3A–S3C Fig). There is no significant decrease in cell viability under these conditions (Fig 1), indicating that damaged cells are not lost during analysis. For comparison, cutting with either nuclease active Cas9 and the AAVS1 gRNA or p84-ZFN, which target the same sequence as the dCas9-KR/gRNA construct, significantly increased mutations at this site (Fig 4C). A Southern blot was used to attempt to capture chromosome fragility after dCas9-KR activation, but no chromosome breakage was detectable after illumination (S3D Fig). Thus, although both γH2AX and KU70/80 are detectable immediately after dCas9-KR induced DNA damage (Figs 2 and 3), this does not lead to a detectable increase in mutations or INDELs on the repaired DNA. 10.1371/journal.pone.0237759.g004Fig 4 dCas9-KR induced DNA damage does not increase INDELs or mutations. (A) dCas9-KR cells were illuminated at 20K lux for 10 min or 1 hr and DNA isolated 15 minutes post-illumination. qPCR was then used to estimate the percent of intact template after dCas9-KR activation. Template integrity after illumination is expressed as a percent decrease in the quantified qPCR signal from paired, unilluminated cells. (B) 293T cells transiently transfected with dCas9-KR + sgAAVS1 were illuminated for 10min or 60min at 20K lux; an unilluminated control and a non-transfected control were used as a reference. DNA was isolated at 24 hr post-illumination. Representative Sanger sequencing traces are presented. (C) Cells transiently transfected with dCas9-KR with or without sgAAVS1 were illuminated with 0, 5K, or 20K lux for 10 minutes or 1 hr. DNA was isolated 48 hr post-illumination and a 241 bp amplicon surrounding the AAVS1 site was used for NGS. The percent of total reads that were mutated from the untreated control is plotted. Nuclease proficient Cas9 + AAVS1 gRNA and p84-ZFN included as positive controls. (D) Conversion from GFP+ to GFP−to measure NHEJ after dCas9-KR ROS-induced DSB repair in untreated (0 lux) or illuminated (30K lux, 1 hr) cells. The percent of GFP−cells that underwent NHEJ is plotted. (E) As in (D) but with addition of BFP template to monitor conversion of GFP to BFP+ by HR frequency after dCas9-KR ROS-induced DSB repair. (F) Conversion from GFP+ to GFP−to measure NHEJ after transfection of nuclease proficient Cas9 plus GFP sgRNA to generate a DSB. The percent of GFP−cells that underwent NHEJ is plotted. (G) As in (F) but with addition of BFP template to monitor GFP-to-BFP conversion by HR. Nuclease proficient Cas9 plus GFP sgRNA was used to generate a DSB. For (D-G), the mean and error for at least three biological replicates are plotted. * p < 0.05 and ** p< 0.005; ns = no significant change. dCas9-KR DNA damage does not induce gene conversion events To assess mutational frequency using a genetic assay, we took advantage of the GFP to BFP conversion assay in which repair of Cas9/sgRNA induced DSBs by HR and NHEJ can be measured in a single assay [39]. In this assay, DSBs generated by Cas9 in GFP which are repaired by error-prone NHEJ results in loss of GFP signal. However, when given a template for homology-mediated repair containing a missense mutation to BFP, repair by HR leads to GFP to BFP gene conversion. Because dCas9-KR produces complex damage, including base damage and strand breaks, any mutagenic repair (e.g. via NHEJ or BER) which inactivates GFP will be detected. In addition, because this assay measures GFP+ and BFP+ cells by flow cytometry, events that occur in less than 0.1% of cells are detectable. We used the GFP-targeting gRNA with either dCas9-KR and light (Fig 4D and 4E) or nuclease proficient Cas9 (Fig 4F and 4G). Light activation of dCas9-KR did not increase error-prone repair by either NHEJ (Fig 4D) or HR (Fig 4E), even when BER was transiently inhibited by olaparib treatment to prevent repair and promote DSB formation [40, 41] (S4 Fig). In contrast, use of nuclease active Cas9 plus gRNA increased repair by both NHEJ (Fig 4F) and HR (Fig 4G). However, the GFP/BFP assay only reads out error prone repair that leads to INDELs or mutations that inactivate the GFP gene [39]. The failure to detect activity with dCas9-KR indicates that DNA damage is repaired with high efficiency/fidelity, consistent with the sequencing analysis (Fig 4C). Further, in this assay Cas9 plus the sgRNA can generate multiple cut-repair cycles over the time-course of the experiment (48 hrs), increasing the probability of repair errors, whereas transient light exposure provides a limited, temporally restricted period of damage (minutes) which is repaired with higher fidelity (Fig 4C). Discussion We have developed a system which generates clustered DNA damage at a single locus to study the site-specific DNA damage response. For this, we created a fusion protein between the nuclease-inactive Cas9 and the chromophore KillerRed, dCas9-KR, allowing us to target the protein to a specified locus using specific gRNAs. Exposure to green light activates the KR moiety of dCas9-KR, generating ROS, which, in turn, cause DNA damage that is restricted to the surrounding DNA. Further, pairing this with ChIP reveals the spatio-temporal repair dynamics on the chromatin in response to DNA damage. A major advantage of this system is that generation of DNA damage can be precisely regulated by exposure to green light, allowing for transient and coordinated generation of DNA damage in all exposed cells. This provides the flexibility to monitor the early (10–20 min) events which occur during DNA repair. A second advantage of the dCas9-KR system is that, because ROS have a short (nanoseconds) half-life in cells [42, 43], termination of light exposure quickly removes the source of DNA damage, providing the ability to monitor repair in the absence of ongoing damage. Other approaches to generating DSBs with targeted nucleases, including Cas9 [27], have limitations due to the time taken for induction or expression of the enzyme, which can be 1–5 hr [44]. Further, because these approaches usually lead to constitutive expression of the nuclease, cells engage in multiple cut-repair cycles, until errors accumulate that eliminate the target site [29, 45]. Approaches that use rapid induction or degrons [46, 47] to control nuclease levels, or chemical caging of the guide RNA for CRISPR/Cas9 (vfCRISPR) [48] have provided more controlled alternatives, but still generate multiple cut-repair cycles which resemble persistent, unrepaired DSBs. Therefore, the major advantage to using the KillerRed chromophore compared to endonucleases is that ROS production is strictly limited to the duration of activation by light, allowing temporal control of DNA damage by controlling light exposure. KillerRed has previously been used to monitor repair of oxidative damage. For example, KR was fused to the Tet repressor, allowing KR targeting to a repetitive TetR binding module which was inserted into the cells [35]. This demonstrated that BER factor recruitment is influenced by chromatin structure at the initiating lesion [35]. A similar experimental approach was taken by tethering KR to LacR to visualize CHD6 recruitment after oxidative damage [49] and tethering KR to TRF1 to localize oxidative damage to the telomeres [50]. These approaches require either expression of engineered, exogenous repeats in the cell [35, 49] or loading of the KR-TRF1 fusion onto telomeric repeats [50]. This leads to loading of hundreds of copies of the KR construct, generating large regions of oxidative damage. However, these approaches have two key limitations which our approach overcomes. First, the need to introduce repeat cassettes limits the ability to target DNA damage to specific regions, or to survey repair in multiple cell lineages. Second, the repetitive structure of the target sites severely limits the use of e.g. sequencing to identify potential mutations or indels arising during repair. Therefore, our system allows interrogation of the repair fidelity of site-specific, clustered oxidative DNA lesions that are repaired with few errors. Viewed as a model of site-specific, clustered oxidative DNA damage, the dCas9-KR system may be used to elucidate the contribution of specific repair factors to repair outcome and probe the effect of chromatin context or DNA sequence features to repair outcome. Previous studies have established that KR generates reactive oxidative species that directly damage the DNA [35, 49, 50]. KR-induced damage shows overlap with endogenous DNA damage arising from reactive oxygen species (ROS) that naturally occur during cellular metabolism or from exposure to oxidative agents, including oxidized bases, abasic sites, oxypyrimidines, oxypurines, and single strand breaks [12, 33, 35, 49–56]. Activation of dCas9-KR produced ROS that locally damaged the DNA, resulting in γH2AX and KU70/80 spreading at the dCas9 target sequence (Figs 2D and 3D), suggesting that DSBs result after clustered ROS delivery. Recruitment of the BER glycosylase APE1 is also detectable, though modestly. Typically, oxidized base lesions are repaired via base excision repair (BER) in which a single damaged base is excised and replaced. However, if multiple lesions occur within a ~20 bp region, this oxidative clustered DNA lesion is repaired via long-patch BER in which 2–15 bases are removed and replaced [57, 58]. If BER is inefficient or long-patch BER occurs on opposing DNA strands, DSBs can arise [59–61], though this is limited by the local chromatin structure [62]. Clustered DNA lesions induced by oxidative stress can be repaired via NHEJ, suggesting the appearance of DSBs [63]. Indeed, clustered oxidative lesions are challenging to repair, engage multiple repair pathways, and are mutagenic [30, 51, 63–68]. The coincident recruitment of APE1 and KU70/80 supports that both BER and NHEJ are occurring at sites of ROS-induced DNA damage, consistent with repair of clustered oxidative lesions requiring coordination between DSB repair and BER [63, 69, 70]. Interestingly, though DSBs do appear to be induced, mutational analysis by next generation sequencing revealed few errors at the dCas9-KR target site (Fig 4C). dCas9-KR ROS induced clustered oxidative damage is therefore repaired both efficiently and with high-fidelity. Since DSBs are arising in such low numbers, even if the initial repair via NHEJ is mutagenic, the frequency may be too low to capture by sequencing analysis. Further, if NHEJ of the DSBs is followed by BER, a high-fidelity repair event mediated by Polβ gap fill-in [71, 72], this could additionally explain the low mutational frequency captured by our analysis. Given estimates that cells experience 50,000–200,000 oxidized bases per day [73, 74], but rarely accumulate mutations, repair of low level, transient oxidative damage via BER and/or NHEJ is likely to proceed with high fidelity under limiting, “physiological” DNA damage loads delivered by dCas9-KR. Since dCas9-KR induced damage appears to activate both NHEJ and BER, sites of dCas9-KR-induced DNA damage may represent a good model for types of DNA damage that invoke multiple repair pathways, with the ability to study repair dynamics in a site-specific manner. One caveat to the dCas9-KR system is that it does not induce as robust a DNA repair response as the systems that use e.g. targeted nucleases and therefore subtle DNA repair effects may be lost. However, we consider this to be an advantage in that it allows us to measure the DNA repair response to modest amounts of DNA damage. While IR-induced lesions take on the order of hours to resolve [59, 75–77], dCas9-KR induces rapid repair and low levels of damage are repaired within 5 minutes after light delivery is removed (Figs 2D and 3F). This suggests that the dCas9-KR induced ROS are producing lesions that are more easily repaired than IR-induced lesions, and may be more comparable to endogenous sources of DNA damage, such as metabolites and stalled replication forks caused by DNA secondary structures. Utilizing the dCas9-KR induced ROS can add to our understanding of how these lesions are repaired with high fidelity, and therefore our understanding of how when repair goes awry it can lead to mutations. Conclusions We conclude that the dCas9-KR activation described here results in targeted, clustered oxidative lesions that induce dynamic chromatin modifications and are repaired with few mutations. Pairing this technique with repair enzyme inhibitors is a promising means to elucidate site-specific and temporal responses to DNA damage. Further, dCas9-KR could be used to study repair within the context of various genomic loci–for example, to determine if the repair response is altered by transcriptional status or functional activity. dCas9-KR can also be used to explore how fragile DNA secondary structures, including repeats and G4 quadruplexes, affect repair pathway choice. A key advantage of dCas9-KR is the ability to evaluate the timing of repair factor recruitment and identify repair proteins which act on clustered DNA lesions to prevent mutagenesis. The low level of baseline mutations induced by dCas9-KR activation also make this an ideal system for further genetic perturbation, as even modest effects on repair fidelity will be detectable. Materials & methods Transfections 293T cells (purchased from the ATCC, VA) were transiently transfected with 2.5 μg pJ609-dCas-KR-puro (synthesized by DNA2.0; see S1 File for DNA and protein sequence) and/or sgAAVS1 ([78]; Addgene 41818) with Lipofectamine 2000 according to the manufacturer’s instructions (Life Technologies). dCas9-KR is available from Addgene (158478). Light exposure Cells in Dulbecco’s Modified Eagles Media (DMEM) containing Fetal Bovine Serum (10%) and penicillin-streptomycin (1%), but without either phenol red or L-glutamine were exposed to LED light from a SugarCUBE LED Illuminator with a green bulb (Nathaniel Group/Ushio, CA) attached to a liquid light guide affixed 27cm above the plates (S1 Fig). Light intensity was measured with a luxometer placed under the plate. After exposure, cells were either placed back at 37°C for a recovery period or immediately processed. Chromatin immunoprecipitation 293T cells transiently transfected with dCas9-KR in the presence or absence of sgAAVS1 were exposed to green LED light for 10 minutes or 1 hr and recovered at 37°C for the indicated times. ChIP was performed in a minimum of three biological replicates using the following antibodies: anti-γH2AX (Abcam ab81299), anti-KU70/80 (Neomarkers MS-286-P1), anti-BRCA1 (Abcam ab16781), anti-APE1 (Abcam ab194), anti-XRCC1 (Abcam ab1838), anti-RPA (Millipore NA19L/Abcam ab2175), anti-KillerRed (Evrogen AB961). All ChIP was performed using the SimpleChIP Enzymatic Chromatin IP kit with magnetic beads according to the manufacturer’s instructions (Cell Signaling Technologies). DNA levels were quantified by qPCR amplification using Power SYBR Green Mastermix (Applied Biosystems) and primers along the PPP1R12C gene (previously described in [38]; S1 File). The average IP/IN, expressed as a percent, of the biological replicates is graphed using PCR technical replicate error. N-Acetylcysteine treatment DMEM lacking both phenol red or L-glutamine was supplemented with N-acetylcysteine (4mM, or 10mM) and added to 293T cells transiently transfected with dCas9-KR and sgAAVS1 and incubated at 37°C for 1 hour prior to LED light treatment. Cells were exposed to green LED at 20K lux for 10 minutes or 1 hour and then placed at 37°C for 15 minutes before formaldehyde fixation and collection for ChIP. The mean of four biological replicates is graphed with PCR technical replicate error bars. Western blot analysis 293T cells with or without the dCas9-KR and sgAAVS1 constructs were lysed in RIPA buffer (50mM Tris-HCl, pH 8.0; 150mM sodium chloride; 1.0% NP-40; 0.5% sodium deoxycholate; 0.1% sodium dodecyl sulfate) with 1X protease inhibitor cocktail (Roche, IN) and sonicated in a bioruptor for 2.5 mins in 30 second pulses at 4°C. Debris was pelleted at 10,000 rpm and lysates (20 μg) separated in SDS-PAGE gels and semi-dry transferred onto nitrocellulose using standard methods. Primary antibodies (diluted in 5% milk) used were: anti-γH2AX (Abcam ab11174; 1:5000), anti-KillerRed (Evrogen AB961; 1:5000), and anti-β-actin (Cell Signaling Technologies 4967; 1:2000). Bands were detected with anti-rabbit secondary antibody (LI-COR; 1:10,000) and scanned on an Odyssey imager to quantify band intensity. Next generation sequencing 293T cells transiently transfected with dCas9-KR +/- sgAAVS1 were treated with green LED light at indicated intensities and times, 24 post-transfection. After treatment, the medium was changed to DMEM with 1 ug/ml puromycin to enrich for cells that maintained the dCas9-KR vector. At 48 hours post-treatment, cells were harvested and DNA purified using the Blood and Tissue DNA kit (Qiagen, MD). A 241 base pair amplicon spanning the AAVS1 target site was amplified in 25 cycles using NEB One Taq (AAVS1 -80bp Forward 5’ GACCACCTTATATTCCCAGG; AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina) at the CCIB DNA Core Facility at Massachusetts General Hospital (Cambridge, MA) using a MiSeq v2 chemistry 300 cycle kit. High-throughput analysis of amplicon deep sequencing was performed as in [79]. Briefly, paired end sequencing raw reads were trimmed to primer sequences and merged into single reads using Geneious v10.1.3. Only sequences with >20 bp of reference sequence adjacent to the primer sequence were analyzed. SAM files of sequences trimmed to common start and end sequences were exported using Geneious v10.1.3. HiFiBR [80] was used to classify sequences as exact, deletion, insertion, or complex (contains both insertion and deletion), with a threshold set at ≥10 reads. Each class of “repair” was expressed as a percent of events divided by total sequence reads. The average of two biological replicates is plotted. GFP to BFP conversion assay 293T cells were engineered to contain the GFP array as described in [39] and stable, GFP positive cells (<0.01% BFP positive) were used in subsequent experiments. In 6-well plates, 1 x 105 GFP+ 293T cells were seeded in DMEM complete medium 24 hr prior to transfection. dCas9-KR (1μg), AAVS1 sgRNA (1μg), and/or BFP template (50ng) were transfected with lipofectamine 2000 according to the manufacturer’s instructions. The Cas9/AAVS1 sgRNA single vector (1μg) (Genecopoiea, MD) was used as a positive control. The BFP template is a 290 bp PCR fragment created by amplification of a custom G-block (Integrated DNA Technologies, IA). G-block and primer sequences in S1 File). At 24 hr post-transfection, media was changed to DMEM lacking phenol red, 25μM olaparib added as required, and incubated for a further 2 hr at 37°C. Cells were then exposed to 30K lux green LED for 1 hr. After treatment, cells were allowed to recover for 1 hr at 37°C and then the media was replaced with fresh DMEM. Cells were grown for five days post-treatment, split 1:2, and grown for an additional two days. A Cytoflex flow cytometer was used to score percent of GFP+ and BFP+ cells. Southern blotting DNA was isolated using the Qiagen Blood and Tissue DNA kit (Qiagen, MD) and digested with EcoRI-HF and Mfe1-HF (New England Biolabs, MA) to release a 3594 bp fragment surrounding the Cas9/p84 target site in AAVS1. Phenol:chloroform:isoamyl alcohol (25:24:1) extracted and ethanol precipitated DNA (20 μg) was run in 1% agarose and Southern transferred (standard procedures) onto Biodyne B nylon membranes (Thermo Scientific, MO). Blots were probed with a 753 bp PCR fragment spanning the AAVS1 site, from -80 bp to +673 bp (AAVS1 -80bp Forward 5’ CTTGCTTTCTTTGCCTGGAC; AAVS1 +0.5kb Reverse 5’ CGGAGGAATATGTCCCAGATAGCA), amplified with biotin-16-dUTP (Roche, IN). The biotin-labeled probe was detected with IRDye 800CW Streptavidin (LI-COR) and scanned on an Odyssey imager. Supporting information S1 Fig Experimental set-up for illumination and KillerRed activation in cells expressing dCas9-KR. (A) Photograph of actual apparatus for light delivery. The SugarCUBE LED with a green bulb is attached via a liquid light guide to an aluminum foil protected Styrofoam box. Adherent cells in plates were placed inside the box with the lid closed and the LED was turned on for the times indicated in individual experiments. Light intensity was measured using a luxometer placed underneath the plate of cells. Intensity was measured in lux, the SI unit of illuminance which is a measure of the amount of light emitted per second per square meter. (B) Typical experimental schematic. 293T cells were transiently transfected with the dCas9-KR and/or the AAVS1 sgRNA. At 24hr post-transfection, cells were illuminated by exposure to the SugarCUBE LED and then placed back in the incubator at 37°C for recovery before cell collection. Illumination and recovery times varied by experiment. (C) 293T cells were transiently transfected with either vector (-), dCas9-KR or AAVS1 gRNA as indicated. 24 hrs later, cells were exposed to 20K Lux for the indicated times, followed by western blot analysis to detect dCas9-KR and b-actin (loading control). (TIF) Click here for additional data file. S2 Fig ChIP for APE1, XRCC1 and H2AX at the dCas9-KR binding site. (A) ChIP for APE1 following transfection of dCas9-KR plus the indicated sgRNA. ChIP was carried out using APE1 antibody and primer pairs at the indicated distance from the dCas9-KR site (located at 0 base pairs). * = p < 0.05; ns = non-specific. (B) As in (A), but using XRCC1 antibody. (C) as in (A), but using H2AX antibody to monitor relative H2AX occupancy at the indicated positions. All methods described in materials and methods section. (TIF) Click here for additional data file. S3 Fig Next generation sequence analysis. Wild type or Ligase IV-/- 293T cells were transfected with vector, nuclease proficient Cas9 plus gRNA or dCas9-KR. dCas9-KR cells were illuminated at 1hr at 20K lux. DNA was isolated 48 hr post-illumination and a 241 bp fragment surrounding the dCas9-KR was amplified and sequenced by NGS. (A) Total misalignments compared to the reference sequence (non-transfected cells); (B) deletions; (C) insertions; (D) DNA was isolated at the indicated time points post-illumination (0–120 minutes at 20K lux), followed by Southern blot to measure chromosome breakage at the AAVS1 site (left panel). The p84-ZFN nuclease was used as a positive control for DSB-induction (right panel, arrows). NT = not treated. The AAVS1 site was detected using a biotin-16-dUTP labeled amplicon spanning the AAVS1 site. (TIF) Click here for additional data file. S4 Fig GFP to BFP repair assay to detect DNA damage induced by dCas9-KR. In this assay, cells contain a GFP array that can be targeted by the dCas-KR construct. Frameshift mutations after repair convert GFP+ to GFP−and this is used as a measure of NHEJ efficiency after DNA damage at a GFP array. When a BFP template is provided, repair can proceed via homologous recombination, resulting in gene conversion from GFP+ to BFP+. Inefficient DNA damage induction or infrequent mutational repair can result in GFP+BFP+ cells due to several copies of GFP being present in the target array. We have therefore scored any BFP+ cell as having undergone gene conversion/HR. The mean and error for at least three biological replicates are plotted. (A) Conversion from GFP+ to GFP−to measure NHEJ after dCas9-KR ROS-induced DSB repair in untreated (0 lux) or illuminated (30K lux, 1 hr) cells. The percent of GFP−cells are plotted to represent cells that underwent NHEJ. (B) Nuclease proficient Cas9 constructs were used as positive controls. Cas9 and the guide RNA were either in the same vector (Cas9-gRNA) or co-transfected as separate vectors (Cas9, GFP sgRNA). (C) Conversion to BFP+ to measure HR frequency after dCas9-KR ROS-induced DSB repair, performed as in (A). (D) Nuclease proficient Cas9 used as positive controls as in (B). (E-H) GFP to BFP conversion assay in the presence of Olaparib. Given that the dCas9-KR-induced DNA damage appeared to be quickly repaired (Figs 2E, 2F and 3E), we attempted to increase the frequency of DSBs by using olaparib, which traps PARP on the DNA, potentially limiting BER repair and causing DSBs (40, 41). Cells containing the dCas9-KR and GFP-targeted sgRNA were pre-treated in 25 uM Olaparib for two hours prior to illumination, and Olaparib was removed one hour post-illumination. For comparison, nuclease proficient Cas9 plus gRNA were also used. (E) dCas9-KR activation in Olaparib treated cells did not increase NHEJ (GFP–) rates, and therefore NHEJ is relatively unaffected or occurring at levels that are too low to be detected by this assay. (F) Nuclease proficient Cas9 increased NHEJ, but was not altered by olaparib. (G) dCas9-KR activation appeared to increase HR (BFP+) frequency in Olaparib treated cells; however, the rates were variable and did not reach statistical significance even after several trials. (H) Nuclease proficient Cas9 control demonstrating increased HR mediated repair. Conclusion: We conclude that Olaparib treatment reveals that DNA damage is occurring at the dCas9-KR target site, and in a subset of cells these lesions are converted to DSBs (or lesions that initiate mutagenesis leading to GFP–or BFP+ in this assay) after PARP inhibition. However, dCas9-KR activation is inducing only a modest amount of DNA damage overall. Taken with our sequencing analysis (Fig 4B, 4C), this suggests that targeted dCas9-KR induced damage is easily repaired, even with transient BER inhibition. (TIF) Click here for additional data file. S5 Fig Original western blot images from Fig 1. (TIF) Click here for additional data file. S1 File (DOCX) Click here for additional data file. S1 Data (XLSX) Click here for additional data file. S2 Data (XLSX) Click here for additional data file. S3 Data (XLSX) Click here for additional data file. S4 Data (XLSX) Click here for additional data file. We thank Dany Spencer Adams for discussions regarding light delivery apparatus and intensity measurements, and members of the Price lab and Day lab for valuable discussions. 10.1371/journal.pone.0237759.r001 Decision Letter 0 Sobol Robert W Academic Editor © 2020 Robert W Sobol2020Robert W SobolThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Submission Version0 26 Aug 2020 PONE-D-20-23466 Site-specific targeting of a light activated dCas9-KIllerRed fusion protein generates transient, localized regions of oxidative DNA damage. PLOS ONE Dear Dr. Price, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. As noted in the reviewer comments, there are numerous small and important concerns raised that should be addressed.  Please submit your revised manuscript by Oct 10 2020 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript: A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols We look forward to receiving your revised manuscript. Kind regards, Robert W Sobol, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Thank you for stating the following in the Competing Interests section: "The authors have declared that no competing interests exist" We note that one or more of the authors are employed by a commercial company: eGenesis. 2.1. Please provide an amended Funding Statement declaring this commercial affiliation, as well as a statement regarding the Role of Funders in your study. If the funding organization did not play a role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript and only provided financial support in the form of authors' salaries and/or research materials, please review your statements relating to the author contributions, and ensure you have specifically and accurately indicated the role(s) that these authors had in your study. You can update author roles in the Author Contributions section of the online submission form. Please also include the following statement within your amended Funding Statement. “The funder provided support in the form of salaries for authors [insert relevant initials], but did not have any additional role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section.” If your commercial affiliation did play a role in your study, please state and explain this role within your updated Funding Statement. 2.2. Please also provide an updated Competing Interests Statement declaring this commercial affiliation along with any other relevant declarations relating to employment, consultancy, patents, products in development, or marketed products, etc.   Within your Competing Interests Statement, please confirm that this commercial affiliation does not alter your adherence to all PLOS ONE policies on sharing data and materials by including the following statement: "This does not alter our adherence to  PLOS ONE policies on sharing data and materials.” (as detailed online in our guide for authors http://journals.plos.org/plosone/s/competing-interests) . If this adherence statement is not accurate and  there are restrictions on sharing of data and/or materials, please state these. Please note that we cannot proceed with consideration of your article until this information has been declared. Please include both an updated Funding Statement and Competing Interests Statement in your cover letter. We will change the online submission form on your behalf. Please know it is PLOS ONE policy for corresponding authors to declare, on behalf of all authors, all potential competing interests for the purposes of transparency. PLOS defines a competing interest as anything that interferes with, or could reasonably be perceived as interfering with, the full and objective presentation, peer review, editorial decision-making, or publication of research or non-research articles submitted to one of the journals. Competing interests can be financial or non-financial, professional, or personal. Competing interests can arise in relationship to an organization or another person. Please follow this link to our website for more details on competing interests: http://journals.plos.org/plosone/s/competing-interests 3. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 4. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: No ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: House et al. utilize a dCas9-KillerRed expression construct to investigate double-strand break repair generated at the AAVS1 locus within cells. Using a 532nm LED source to generate ROS using KR, the authors investigate the repair mechanism for the ROS-generated DNA damage using ChIP, sequencing, and viability assays. While the ability to generate site-specific, transient DNA damage to identify error-rates of NHEJ is of interest, there are a number of issues with the manuscript. The main issue is the use of the term ‘site-specific’. The novelty presented in this manuscript is the fusion of dCas9 to KR to introduce site-specific damage to the AAVS1 locus using the site-specific gRNA. However, not all dCas9-KR in the nucleus can enrich onto genomic DNA due to limited Cas9 loading onto specific genomic loci, thereby leading to non-specific oxidative DNA damage of unbound dCas9-KR. When the 532nm light is used, it will stimulate KR independent of dCas9 binding, resulting in ROS generation throughout the nucleus, similar to genotoxins such as H2O2. To show site-specific DNA damage, you will need to perform immunocytochemistry using �H2AX labeling to show focal �H2AX around the AAVS1 site. Additionally, Figure 1C hints at possible increases in global �H2AX, even when the sgRNA is not present, but no quantitation is provided. This should be repeated to include at least 3 replicates and semi-quantitative analysis of band intensity to bolster the author’s statement that there are no detectable global increases and the system is inducing site specific DNA damage. Otherwise, the system cannot be characterized as site-specific ROS generation but rather genomic locus-enriched ROS generation. Other issues: 1) Figure 2C should include APE1 data for dCas9-KR without AAVS1 gRNA at 20K instead of the 5K provided. 2) Is the difference in template integrity statistically different in Figure 4A? If not, it should be addressed. 3) Figure 2B legend and text says that �H2AX was determined after 10 and 60 minutes, but the x-axis is labeled for 0, 10, and 30 minutes. 4) On page 11, line 219- authors state that “Light activation of dCas9-KR did not increase repair by either NHEJ…” when it should read “Light activation of dCas9-KR did not increase error-prone repair by NHEJ or…” 5) Figure 4 E and F are labeled as dCas9-KR when they should be Cas9. Reviewer #2: The authors have presented a very clear and well written study characterizing their newly developed dCas9 fused to killer red. This allows the authors to generate targeted bursts of reactive oxygen species when excited with green light. This clustered oxidative damage is quickly and efficiently repaired and offers a more temporally controlled option for creating oxidative DNA damage when compared to other techniques that require induction or expression. Interestingly, this damage recruits both NHEJ and BER proteins, but does not seem to involve HR proteins. Furthermore, repair is very high fidelity as demonstrated by NGS and GFP to BFP gene conversion assays. This is uncharacteristic of normal NHEJ, indicating perhaps there is a coordinated repair effort between both pathways in the case of clustered oxidative lesions. Overall, this seems to be an exciting and useful tool for further investigating DNA repair of oxidative lesions and is a valuable contribution to the field. The characterization experiments in this study are well designed and well carried out with appropriate controls throughout. The clarity and quality of writing was excellent. My overall recommendation is to accept with the following minor revisions. Minor Revisions: While most of the data presented has very clear differences that leave no question about the effect, the manuscript could be improved with the addition of statistical analysis in a few figure panels and a methods section describing that analysis. Specifically: Figure 2 Panel A and C Figure 3 Panel E Figure 4 Panels D and E Figure 4 Panels F and G appear to have statistics represented but there is no discussion of p value represented by the * in the legend or indication of how statistical analysis was carried out. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10.1371/journal.pone.0237759.r002 Author response to Decision Letter 0 Submission Version1 16 Nov 2020 Response to reviewers. Reviewer 1. Reviewer 1 requested additional clarification of the conclusion that dCas9-KR generates site-specific DNA damage, rather than general (locus specific) DNA damage due to ROS production throughout the nucleus. To address this, as requested, we repeated the gH2AX experiments in figure 1, using 3 biological replicates, with image quantification. This data is now included in figure 1, with the replicate blots used to generate the data presented in supplementary figure 5. This clearly shows that dCas9-KR activation does not lead to detectable increases in global gH2AX. Further, the ChIP data (figure 1) shows that gH2AX is only increased at the AAVS1 locus when both the targeting gRNA and light exposure are used, indicating that this damage requires docking of the dCas9-KR onto the chromatin to produce detectable damage. Although looking for specific gH2AX foci at the AAVS1 site would be a useful approach, in our initial characterization of the dCas9-KR system, we were unable to reproducibly detect gH2AX foci directly at the AAVS1 site. We believe this is due to the low gH2AX signal generated by dCas9-KR and the limited spreading of gH2AX from the site. However, ChIP, which is a more sensitive approach (figure 1), clearly shows the presence of increased gH2AX at the dCas9-KR locus. Taken together, we believe that this supports our original conclusion that dCas9-KR creates site-specific rather than global DNA damage. (i) The original figure 2C was, in fact, incorrectly labelled. Since the changes in APE1 are small and were shown in more detail in the original supplementary figure 2, we have removed figure 2C and limit our discussion of this to the APE1 data set originally presented (supplementary figure 2A). (ii) The difference in template integrity in figure 4A is not statistically significant. This was not made clear in the original submission, and we have provided statistical analysis in figure 4A and the figure 4 legend, as well as altered the text (lines 192-194) to reflect this. (iii) The legend and figure 2B have been corrected to reflect that the exposure was 0, 10 and 60mins. (iv) We have corrected line 219 (line 240 in the corrected version) and added “error-prone”. (v) We have checked the labeling of figure 4E and figure 4F and these are now correctly annotated. Reviewer 2. We appreciate reviewer 2’s enthusiasm for the paper and thank them for their strong endorsement. We have made the following changes to the statistical analysis, as requested: • We have added statistical analysis to Figure 2, Figure 3E (now figure 3D in revised version) and Figures 4D and 4E, as requested. In figure 2C, for clarity, statistical significance is noted in the figure legend rather than on the figure. • Figure 2C in the original submission has now been removed, as noted above (point (i)), with the data now presented in supplementary figure 2. • A description of the statistics in Figure 4D, 4E, 4F and 4G has been added to the figure legend. Attachment Submitted filename: Response to reviewers.docx Click here for additional data file. 10.1371/journal.pone.0237759.r003 Decision Letter 1 Sobol Robert W Academic Editor © 2020 Robert W Sobol2020Robert W SobolThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Submission Version1 1 Dec 2020 Site-specific targeting of a light activated dCas9-KillerRed fusion protein generates transient, localized regions of oxidative DNA damage. PONE-D-20-23466R1 Dear Dr. Price, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Robert W Sobol, PhD Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No 10.1371/journal.pone.0237759.r004 Acceptance letter Sobol Robert W Academic Editor © 2020 Robert W Sobol2020Robert W SobolThis is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 9 Dec 2020 PONE-D-20-23466R1 Site-specific targeting of a light activated dCas9-KillerRed fusion protein generates transient, localized regions of oxidative DNA damage. Dear Dr. Price: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Robert W Sobol Academic Editor PLOS ONE ==== Refs References 1 Price BD , D'Andrea AD . Chromatin remodeling at DNA double-strand breaks . Cell . 2013 ;152 (6 ):1344 –54 . 10.1016/j.cell.2013.02.011 23498941 2 Hauer MH , Gasser SM . Chromatin and nucleosome dynamics in DNA damage and repair . Genes & development . 2017 ;31 (22 ):2204 –21 . 10.1101/gad.307702.117 29284710 3 Clouaire T , Legube G . A Snapshot on the Cis Chromatin Response to DNA Double-Strand Breaks . Trends Genet . 2019 ;35 (5 ):330 –45 . 10.1016/j.tig.2019.02.003 30898334 4 Gursoy-Yuzugullu O , Ayrapetov MK , Price BD . Histone chaperone Anp32e removes H2A.Z from DNA double-strand breaks and promotes nucleosome reorganization and DNA repair . Proc Natl Acad Sci U S A . 2015 ;112 (24 ):7507 –12 . 10.1073/pnas.1504868112 26034280 5 Xu Y , Ayrapetov MK , Xu C , Gursoy-Yuzugullu O , Hu Y , Price BD . Histone H2A.Z Controls a Critical Chromatin Remodeling Step Required for DNA Double-Strand Break Repair . Molecular cell . 2012 ;48 (5 ):723 –33 . 10.1016/j.molcel.2012.09.026 23122415 6 Alatwi HE , Downs JA . Removal of H2A.Z by INO80 promotes homologous recombination . EMBO reports . 2015 10.15252/embr.201540330 26142279 7 Nishibuchi I , Suzuki H , Kinomura A , Sun J , Liu NA , Horikoshi Y , et al Reorganization of damaged chromatin by the exchange of histone variant H2A.Z-2. International journal of radiation oncology, biology , physics . 2014 ;89 (4 ):736 –44 . 8 Morillo-Huesca M , Clemente-Ruiz M , Andujar E , Prado F . The SWR1 histone replacement complex causes genetic instability and genome-wide transcription misregulation in the absence of H2A.Z. PLoS One . 2010 ;5 (8 ):e12143 10.1371/journal.pone.0012143 20711347 9 Kalocsay M , Hiller NJ , Jentsch S . Chromosome-wide Rad51 spreading and SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand break . Mol Cell . 2009 ;33 (3 ):335 –43 . 10.1016/j.molcel.2009.01.016 19217407 10 Luijsterburg MS , de Krijger I , Wiegant WW , Shah RG , Smeenk G , de Groot AJ , et al PARP1 Links CHD2-Mediated Chromatin Expansion and H3.3 Deposition to DNA Repair by Non-homologous End-Joining . Mol Cell . 2016 ;61 (4 ):547 –62 . 10.1016/j.molcel.2016.01.019 26895424 11 Yang X , Li L , Liang J , Shi L , Yang J , Yi X , et al Histone acetyltransferase 1 promotes homologous recombination in DNA repair by facilitating histone turnover . The Journal of biological chemistry . 2013 ;288 (25 ):18271 –82 . 10.1074/jbc.M113.473199 23653357 12 Wei L , Nakajima S , Bohm S , Bernstein KA , Shen Z , Tsang M , et al DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination . Proc Natl Acad Sci U S A . 2015 ;112 (27 ):E3495 –504 . 10.1073/pnas.1507105112 26100862 13 House NC , Koch MR , Freudenreich CH . Chromatin modifications and DNA repair: beyond double-strand breaks . Front Genet . 2014 ;5 :296 10.3389/fgene.2014.00296 25250043 14 Goodarzi AA , Noon AT , Deckbar D , Ziv Y , Shiloh Y , Lobrich M , et al ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin . Mol Cell . 2008 ;31 (2 ):167 –77 . 10.1016/j.molcel.2008.05.017 18657500 15 Watts FZ . Repair of DNA Double-Strand Breaks in Heterochromatin . Biomolecules . 2016 ;6 (4 ). 10.3390/biom6040047 27999260 16 Mitrentsi I , Yilmaz D , Soutoglou E . How to maintain the genome in nuclear space . Curr Opin Cell Biol . 2020 ;64 :58 –66 . 10.1016/j.ceb.2020.02.014 32220808 17 Ochs F , Karemore G , Miron E , Brown J , Sedlackova H , Rask MB , et al Stabilization of chromatin topology safeguards genome integrity . Nature . 2019 ;574 (7779 ):571 –4 . 10.1038/s41586-019-1659-4 31645724 18 Murga M , Jaco I , Fan Y , Soria R , Martinez-Pastor B , Cuadrado M , et al Global chromatin compaction limits the strength of the DNA damage response . J Cell Biol . 2007 ;178 (7 ):1101 –8 . 10.1083/jcb.200704140 17893239 19 Chiolo I , Minoda A , Colmenares SU , Polyzos A , Costes SV , Karpen GH . Double-strand breaks in heterochromatin move outside of a dynamic HP1a domain to complete recombinational repair . Cell . 2011 ;144 (5 ):732 –44 . 10.1016/j.cell.2011.02.012 21353298 20 Peng JC , Karpen GH . Heterochromatic genome stability requires regulators of histone H3 K9 methylation . PLoS Genet . 2009 ;5 (3 ):e1000435 10.1371/journal.pgen.1000435 19325889 21 Tsouroula K , Furst A , Rogier M , Heyer V , Maglott-Roth A , Ferrand A , et al Temporal and Spatial Uncoupling of DNA Double Strand Break Repair Pathways within Mammalian Heterochromatin . Mol Cell . 2016 ;63 (2 ):293 –305 . 10.1016/j.molcel.2016.06.002 27397684 22 Lemaitre C , Grabarz A , Tsouroula K , Andronov L , Furst A , Pankotai T , et al Nuclear position dictates DNA repair pathway choice . Genes & development . 2014 10.1101/gad.248369.114 25366693 23 Wilson MD , Benlekbir S , Fradet-Turcotte A , Sherker A , Julien JP , McEwan A , et al The structural basis of modified nucleosome recognition by 53BP1 . Nature . 2016 ;536 (7614 ):100 –3 . 10.1038/nature18951 27462807 24 Ceccaldi R , Rondinelli B , D'Andrea AD . Repair Pathway Choices and Consequences at the Double-Strand Break . Trends Cell Biol . 2016 ;26 (1 ):52 –64 . 10.1016/j.tcb.2015.07.009 26437586 25 Iacovoni JS , Caron P , Lassadi I , Nicolas E , Massip L , Trouche D , et al High-resolution profiling of gammaH2AX around DNA double strand breaks in the mammalian genome . EMBO J . 2010 ;29 (8 ):1446 –57 . 10.1038/emboj.2010.38 20360682 26 Aymard F , Bugler B , Schmidt CK , Guillou E , Caron P , Briois S , et al Transcriptionally active chromatin recruits homologous recombination at DNA double-strand breaks . Nat Struct Mol Biol . 2014 ;21 (4 ):366 –74 . 10.1038/nsmb.2796 24658350 27 Vitor AC , Huertas P , Legube G , de Almeida SF . Studying DNA Double-Strand Break Repair: An Ever-Growing Toolbox . Front Mol Biosci . 2020 ;7 :24 10.3389/fmolb.2020.00024 32154266 28 Ayrapetov MK , Gursoy-Yuzugullu O , Xu C , Xu Y , Price BD . DNA double-strand breaks promote methylation of histone H3 on lysine 9 and transient formation of repressive chromatin . Proc Natl Acad Sci U S A . 2014 ;111 (25 ):9169 –74 . 10.1073/pnas.1403565111 24927542 29 Brinkman EK , Chen T , de Haas M , Holland HA , Akhtar W , van Steensel B . Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks . Mol Cell . 2018 ;70 (5 ):801 –13.e6 . 10.1016/j.molcel.2018.04.016 29804829 30 Nickoloff JA , Sharma N , Taylor L . Clustered DNA Double-Strand Breaks: Biological Effects and Relevance to Cancer Radiotherapy . Genes (Basel) . 2020 ;11 (1 ). 10.3390/genes11010099 31952359 31 Bulina ME , Chudakov DM , Britanova OV , Yanushevich YG , Staroverov DB , Chepurnykh TV , et al A genetically encoded photosensitizer . Nat Biotechnol . 2006 ;24 (1 ):95 –9 . 10.1038/nbt1175 16369538 32 Carpentier P , Violot S , Blanchoin L , Bourgeois D . Structural basis for the phototoxicity of the fluorescent protein KillerRed . FEBS Lett . 2009 ;583 (17 ):2839 –42 . 10.1016/j.febslet.2009.07.041 19646983 33 Petrova NV , Luzhin AV , Serebrovskaya EO , Ryumina AP , Velichko AK , Razin SV , et al Inducing cellular senescence in vitro by using genetically encoded photosensitizers . Aging (Albany NY) . 2016 ;8 (10 ):2449 –62 . 10.18632/aging.101065 27744420 34 Forkink M , Smeitink JA , Brock R , Willems PH , Koopman WJ . Detection and manipulation of mitochondrial reactive oxygen species in mammalian cells . Biochim Biophys Acta . 2010 ;1797 (6–7 ):1034 –44 . 10.1016/j.bbabio.2010.01.022 20100455 35 Lan L , Nakajima S , Wei L , Sun L , Hsieh CL , Sobol RW , et al Novel method for site-specific induction of oxidative DNA damage reveals differences in recruitment of repair proteins to heterochromatin and euchromatin . Nucleic Acids Res . 2014 ;42 (4 ):2330 –45 . 10.1093/nar/gkt1233 24293652 36 Mali P , Esvelt KM , Church GM . Cas9 as a versatile tool for engineering biology . Nat Methods . 2013 ;10 (10 ):957 –63 . 10.1038/nmeth.2649 24076990 37 Dhar S , Gursoy-Yuzugullu O , Parasuram R , Price BD . The tale of a tail: histone H4 acetylation and the repair of DNA breaks . Philos Trans R Soc Lond B Biol Sci . 2017 ;372 (1731 ). 10.1098/rstb.2016.0284 28847821 38 Xu Y , Ayrapetov MK , Xu C , Gursoy-Yuzugullu O , Hu Y , Price BD . Histone H2A.Z controls a critical chromatin remodeling step required for DNA double-strand break repair . Mol Cell . 2012 ;48 (5 ):723 –33 . 10.1016/j.molcel.2012.09.026 23122415 39 Glaser A , McColl B , Vadolas J . GFP to BFP Conversion: A Versatile Assay for the Quantification of CRISPR/Cas9-mediated Genome Editing . Mol Ther Nucleic Acids . 2016 ;5 (7 ):e334 10.1038/mtna.2016.48 27404719 40 Strom CE , Johansson F , Uhlen M , Szigyarto CA , Erixon K , Helleday T . Poly (ADP-ribose) polymerase (PARP) is not involved in base excision repair but PARP inhibition traps a single-strand intermediate . Nucleic Acids Res . 2011 ;39 (8 ):3166 –75 . 10.1093/nar/gkq1241 21183466 41 Murai J , Huang SY , Das BB , Renaud A , Zhang Y , Doroshow JH , et al Trapping of PARP1 and PARP2 by Clinical PARP Inhibitors . Cancer Res . 2012 ;72 (21 ):5588 –99 . 10.1158/0008-5472.CAN-12-2753 23118055 42 Dickinson BC , Chang CJ . Chemistry and biology of reactive oxygen species in signaling or stress responses . Nat Chem Biol . 2011 ;7 (8 ):504 –11 . 10.1038/nchembio.607 21769097 43 D'Autréaux B , Toledano MB . ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis . Nat Rev Mol Cell Biol . 2007 ;8 (10 ):813 –24 . 10.1038/nrm2256 17848967 44 Fajrial AK , He QQ , Wirusanti NI , Slansky JE , Ding X . A review of emerging physical transfection methods for CRISPR/Cas9-mediated gene editing . Theranostics. 2020 ;10 (12 ):5532 –49 . 10.7150/thno.43465 32373229 45 Jasin M , Haber JE . The democratization of gene editing: Insights from site-specific cleavage and double-strand break repair . DNA Repair (Amst) . 2016 ;44 :6 –16 . 10.1016/j.dnarep.2016.05.001 27261202 46 Wu Y , Yang L , Chang T , Kandeel F , Yee JK . A Small Molecule-Controlled Cas9 Repressible System . Mol Ther Nucleic Acids . 2020 ;19 :922 –32 . 10.1016/j.omtn.2019.12.026 32000033 47 Gangopadhyay SA , Cox KJ , Manna D , Lim D , Maji B , Zhou Q , et al Precision Control of CRISPR-Cas9 Using Small Molecules and Light . Biochemistry . 2019 ;58 (4 ):234 –44 . 10.1021/acs.biochem.8b01202 30640437 48 Liu Y , Zou RS , He S , Nihongaki Y , Li X , Razavi S , et al Very fast CRISPR on demand . Science . 2020 ;368 (6496 ):1265 –9 . 10.1126/science.aay8204 32527834 49 Moore S , Berger ND , Luijsterburg MS , Piett CG , Stanley FKT , Schrader CU , et al The CHD6 chromatin remodeler is an oxidative DNA damage response factor . Nat Commun . 2019 ;10 (1 ):241 10.1038/s41467-018-08111-y 30651562 50 Tan R , Nakajima S , Wang Q , Sun H , Xue J , Wu J , et al Nek7 Protects Telomeres from Oxidative DNA Damage by Phosphorylation and Stabilization of TRF1 . Mol Cell . 2017 ;65 (5 ):818 –31 e5. 10.1016/j.molcel.2017.01.015 28216227 51 Sage E , Harrison L . Clustered DNA lesion repair in eukaryotes: relevance to mutagenesis and cell survival . Mutat Res . 2011 ;711 (1–2 ):123 –33 . 10.1016/j.mrfmmm.2010.12.010 21185841 52 Chen SH , Yu X . Targeting dePARylation selectively suppresses DNA repair-defective and PARP inhibitor-resistant malignancies . Sci Adv . 2019 ;5 (4 ):eaav4340 10.1126/sciadv.aav4340 30989114 53 Whitefield DB , Spagnol ST , Armiger TJ , Lan L , Dahl KN . Quantifying site-specific chromatin mechanics and DNA damage response . Sci Rep . 2018 ;8 (1 ):18084 10.1038/s41598-018-36343-x 30591710 54 Tan R , Lan L . Induction of Site-Specific Oxidative Damage at Telomeres by Killerred-Fused Shelretin Proteins . Methods Mol Biol . 2017 ;1587 :139 –46 . 10.1007/978-1-4939-6892-3_14 28324506 55 Tan R , Lan L . Guarding chromosomes from oxidative DNA damage to the very end . Acta Biochim Biophys Sin (Shanghai) . 2016 ;48 (7 ):617 –22 . 10.1093/abbs/gmw040 27174872 56 Sun L , Tan R , Xu J , LaFace J , Gao Y , Xiao Y , et al Targeted DNA damage at individual telomeres disrupts their integrity and triggers cell death . Nucleic Acids Res . 2015 ;43 (13 ):6334 –47 . 10.1093/nar/gkv598 26082495 57 Sedelnikova OA , Redon CE , Dickey JS , Nakamura AJ , Georgakilas AG , Bonner WM . Role of oxidatively induced DNA lesions in human pathogenesis . Mutat Res . 2010 ;704 (1–3 ):152 –9 . 10.1016/j.mrrev.2009.12.005 20060490 58 Georgakilas AG , O'Neill P , Stewart RD . Induction and repair of clustered DNA lesions: what do we know so far? Radiat Res . 2013 ;180 (1 ):100 –9 . 10.1667/RR3041.1 23682596 59 Cannan WJ , Pederson DS . Mechanisms and Consequences of Double-Strand DNA Break Formation in Chromatin . J Cell Physiol . 2016 ;231 (1 ):3 –14 . 10.1002/jcp.25048 26040249 60 Vilenchik MM , Knudson AG . Endogenous DNA double-strand breaks: production, fidelity of repair, and induction of cancer . Proc Natl Acad Sci U S A . 2003 ;100 (22 ):12871 –6 . 10.1073/pnas.2135498100 14566050 61 Mehta A , Haber JE . Sources of DNA double-strand breaks and models of recombinational DNA repair . Cold Spring Harb Perspect Biol . 2014 ;6 (9 ):a016428 10.1101/cshperspect.a016428 25104768 62 Cannan WJ , Tsang BP , Wallace SS , Pederson DS . Nucleosomes suppress the formation of double-strand DNA breaks during attempted base excision repair of clustered oxidative damages . J Biol Chem . 2014 ;289 (29 ):19881 –93 . 10.1074/jbc.M114.571588 24891506 63 Sharma V , Collins LB , Chen TH , Herr N , Takeda S , Sun W , et al Oxidative stress at low levels can induce clustered DNA lesions leading to NHEJ mediated mutations . Oncotarget . 2016 ;7 (18 ):25377 –90 . 10.18632/oncotarget.8298 27015367 64 Budworth H , Matthewman G , O'Neill P , Dianov GL . Repair of tandem base lesions in DNA by human cell extracts generates persisting single-strand breaks . J Mol Biol . 2005 ;351 (5 ):1020 –9 . 10.1016/j.jmb.2005.06.069 16054643 65 Singleton BK , Griffin CS , Thacker J . Clustered DNA damage leads to complex genetic changes in irradiated human cells . Cancer Res . 2002 ;62 (21 ):6263 –9 . 12414656 66 Shikazono N , Noguchi M , Fujii K , Urushibara A , Yokoya A . The yield, processing, and biological consequences of clustered DNA damage induced by ionizing radiation . J Radiat Res . 2009 ;50 (1 ):27 –36 . 10.1269/jrr.08086 19218779 67 Magnander K , Elmroth K . Biological consequences of formation and repair of complex DNA damage . Cancer Lett . 2012 ;327 (1–2 ):90 –6 . 10.1016/j.canlet.2012.02.013 22353687 68 Eccles LJ , O'Neill P , Lomax ME . Delayed repair of radiation induced clustered DNA damage: friend or foe? Mutat Res . 2011 ;711 (1–2 ):134 –41 . 10.1016/j.mrfmmm.2010.11.003 21130102 69 Hegde ML , Dutta A , Yang C , Mantha AK , Hegde PM , Pandey A , et al Scaffold attachment factor A (SAF-A) and Ku temporally regulate repair of radiation-induced clustered genome lesions . Oncotarget . 2016 ;7 (34 ):54430 –44 . 10.18632/oncotarget.9914 27303920 70 Yang JL , Chen WY , Mukda S , Yang YR , Sun SF , Chen SD . Oxidative DNA damage is concurrently repaired by base excision repair (BER) and apyrimidinic endonuclease 1 (APE1)-initiated nonhomologous end joining (NHEJ) in cortical neurons . Neuropathol Appl Neurobiol . 2020 ;46 (4 ):375 –90 . 10.1111/nan.12584 31628877 71 Chan KK , Zhang QM , Dianov GL . Base excision repair fidelity in normal and cancer cells . Mutagenesis . 2006 ;21 (3 ):173 –8 . 10.1093/mutage/gel020 16613912 72 Kunkel TA , Bebenek K . DNA replication fidelity . Annu Rev Biochem . 2000 ;69 :497 –529 . 10.1146/annurev.biochem.69.1.497 10966467 73 Atamna H , Cheung I , Ames BN . A method for detecting abasic sites in living cells: age-dependent changes in base excision repair . Proc Natl Acad Sci U S A . 2000 ;97 (2 ):686 –91 . 10.1073/pnas.97.2.686 10639140 74 Martin LJ . DNA damage and repair: relevance to mechanisms of neurodegeneration . J Neuropathol Exp Neurol . 2008 ;67 (5 ):377 –87 . 10.1097/NEN.0b013e31816ff780 18431258 75 Jackson SP . Sensing and repairing DNA double-strand breaks . Carcinogenesis . 2002 ;23 (5 ):687 –96 . 10.1093/carcin/23.5.687 12016139 76 Iliakis G , Wang H , Perrault AR , Boecker W , Rosidi B , Windhofer F , et al Mechanisms of DNA double strand break repair and chromosome aberration formation . Cytogenet Genome Res . 2004 ;104 (1–4 ):14 –20 . 10.1159/000077461 15162010 77 Jeggo PA , Geuting V , Löbrich M . The role of homologous recombination in radiation-induced double-strand break repair . Radiother Oncol. 2011 ;101 (1 ):7 –12 . 10.1016/j.radonc.2011.06.019 21737170 78 Mali P , Yang L , Esvelt KM , Aach J , Guell M , DiCarlo JE , et al RNA-guided human genome engineering via Cas9 . Science . 2013 ;339 (6121 ):823 –6 . 10.1126/science.1232033 23287722 79 Layer JV , Cleary JP , Brown AJ , Stevenson KE , Morrow SN , Van Scoyk A , et al Parp3 promotes long-range end joining in murine cells . Proc Natl Acad Sci U S A . 2018 ;115 (40 ):10076 –81 . 10.1073/pnas.1801591115 30213852 80 Brown AJ , Al-Soodani AT , Saul M , Her S , Garcia JC , Ramsden DA , et al High-Throughput Analysis of DNA Break-Induced Chromosome Rearrangements by Amplicon Sequencing . Methods Enzymol . 2018 ;601 :111 –44 . 10.1016/bs.mie.2017.11.028 29523230