==== Front eLife Elife eLife eLife 2050-084X eLife Sciences Publications, Ltd 33319750 58053 10.7554/eLife.58053 Research Article Genetics and Genomics Downregulation of the tyrosine degradation pathway extends Drosophila lifespan Parkhitko Andrey A https://orcid.org/0000-0001-9852-8329aparkhitko@pitt.edu12 Ramesh Divya http://orcid.org/0000-0003-1387-783234 Wang Lin https://orcid.org/0000-0002-9370-689156 Leshchiner Dmitry 1 Filine Elizabeth 1 Binari Richard 17 Olsen Abby L 8 Asara John M 9 Cracan Valentin https://orcid.org/0000-0002-3280-05931011 Rabinowitz Joshua D 56 Brockmann Axel https://orcid.org/0000-0003-0201-96563 Perrimon Norbert https://orcid.org/0000-0001-7542-472Xperrimon@receptor.med.harvard.edu17 1 Department of Genetics, Blavatnik Institute, Harvard Medical SchoolBostonUnited States 2 Aging Institute of UPMC and the University of PittsburghPittsburghUnited States 3 National Centre for Biological Sciences, Tata Institute of Fundamental ResearchBangaloreIndia 4 Department of Biology, University of KonstanzKonstanzGermany 5 Department of Chemistry, Princeton UniversityPrincetonUnited States 6 Lewis-Sigler Institute for Integrative Genomics, Princeton UniversityPrincetonUnited States 7 Howard Hughes Medical InstituteBostonUnited States 8 Department of Neurology, Brigham and Women's Hospital, Massachusetts General Hospital, Harvard Medical SchoolBostonUnited States 9 Division of Signal Transduction, Beth Israel Deaconess Medical Center, and Department of Medicine, Harvard Medical SchoolBostonUnited States 10 Scintillon InstituteSan DiegoUnited States 11 Department of Chemistry, The Scripps Research InstituteLa JollaUnited States Kapahi Pankaj Reviewing EditorBuck Institute for Research on AgingUnited States Tyler Jessica K Senior EditorWeill Cornell MedicineUnited States 15 12 2020 2020 9 e5805319 4 2020 28 11 2020 © 2020, Parkhitko et al2020Parkhitko et alhttp://creativecommons.org/licenses/by/4.0/This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.Aging is characterized by extensive metabolic reprogramming. To identify metabolic pathways associated with aging, we analyzed age-dependent changes in the metabolomes of long-lived Drosophila melanogaster. Among the metabolites that changed, levels of tyrosine were increased with age in long-lived flies. We demonstrate that the levels of enzymes in the tyrosine degradation pathway increase with age in wild-type flies. Whole-body and neuronal-specific downregulation of enzymes in the tyrosine degradation pathway significantly extends Drosophila lifespan, causes alterations of metabolites associated with increased lifespan, and upregulates the levels of tyrosine-derived neuromediators. Moreover, feeding wild-type flies with tyrosine increased their lifespan. Mechanistically, we show that suppression of ETC complex I drives the upregulation of enzymes in the tyrosine degradation pathway, an effect that can be rescued by tigecycline, an FDA-approved drug that specifically suppresses mitochondrial translation. In addition, tyrosine supplementation partially rescued lifespan of flies with ETC complex I suppression. Altogether, our study highlights the tyrosine degradation pathway as a regulator of longevity. tyrosine aminotransferaseTATtigecyclinemitochondrianeurotransmittersETC Complex IResearch organism D. melanogasterhttp://dx.doi.org/10.13039/100000049National Institute on AgingK99/R00 AG057792Parkhitko Andrey A http://dx.doi.org/10.13039/100000002National Institutes of Health5P01CA120964Perrimon Norbert http://dx.doi.org/10.13039/501100005879National Centre for Biological Sciences12P4167Brockmann Axel http://dx.doi.org/10.13039/100005366American Foundation for Aging ResearchPerrimon Norbert The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementThe tyrosine degradation pathway reprogramming connects mitochondrial dysfunction, aging, and production of tyrosine-derived neuromediators that can be targeted with an FDA-approved drug, Tigecycline. ==== Body Introduction Aging is the primary risk factor for many major human pathologies, including cancer, diabetes, cardiovascular disorders, and neurodegenerative diseases (López-Otín et al., 2013). Untargeted and targeted metabolomics analysis in worms (Fuchs et al., 2010), flies (Hoffman et al., 2014; Avanesov et al., 2014; Parkhitko et al., 2016), mice (Tomás-Loba et al., 2013), and humans (Yu et al., 2012) have documented changes in the metabolome during the aging process. Manipulations of metabolic pathways that change with age might suppress aging and extend lifespan (Parkhitko et al., 2020). For example, perturbation of mitochondrial function (Copeland et al., 2009; Owusu-Ansah et al., 2013; Fridell et al., 2005), activation of the pentose phosphate pathway (Legan et al., 2008), suppression of purine nucleotide metabolism (Stenesen et al., 2013), suppression of fatty acid oxidation (Mourikis et al., 2006), and inhibition of glycogen metabolism (Sinadinos et al., 2014; Post et al., 2018) have been shown to extend lifespan. Moreover, interventions that are known to extend lifespan, like dietary restriction, genetic selection or manipulations of specific pathways might reverse age-dependent metabolic reprogramming (Laye et al., 2015). In addition, key master regulators of metabolism such as DILPs/Insulin signaling (Post et al., 2019; Bai et al., 2012; Broughton et al., 2005; Grönke et al., 2010; Clancy et al., 2001), Tor (Kapahi et al., 2004), AMPK (Ulgherait et al., 2014; Burkewitz et al., 2014), JNK (Wang et al., 2003), Spargel (Rera et al., 2011), Nrf2 (Sykiotis and Bohmann, 2008), Activin/TGFβ (Bai et al., 2013), and Sirt4 (Wood et al., 2018) are known to extend lifespan, although whether they extend lifespan via their effect on metabolism or other processes is unknown. While numerous studies have shown that metabolism changes with age and the role of several metabolic pathways in aging has been characterized, we do not completely understand what drives these metabolic alterations and how they affect other biological processes. Amino acids serve as building blocks for proteins and fuel different metabolic pathways. In addition to a well-known role of amino acids in lifespan extension by dietary restriction, manipulating metabolism of specific amino acids can extend lifespan in flies and other organisms. For example, methionine restriction (Lee et al., 2014) or activation of methionine flux (Parkhitko et al., 2016; Parkhitko et al., 2019) prolongs health and lifespan in flies and other species. Increased homocysteine processing via overexpression of cystathionine β-synthase (dCBS) extends Drosophila lifespan and is required for the beneficial effects of dietary restriction (Kabil et al., 2011). Genetic and pharmacological impairment of the tryptophan/kynurenine pathway promotes Drosophila lifespan (Oxenkrug et al., 2012) and tryptophan restriction extends rat lifespan (Ooka et al., 1988). Impairing threonine catabolism via glycine-C-acetyltransferase suppression promotes Caenorhabditis elegans lifespan (Ravichandran et al., 2018). Glycine supplementation can extend lifespan in both C. elegans (Liu et al., 2019) and mice (Miller et al., 2019). Despite the accumulating evidence, the role of non-proteogenic metabolism of specific amino acids in the regulation of aging and lifespan and their mechanisms are still poorly characterized. One approach to identify new traits responsible for aging is to compare how these traits change with age in control and long-lived animals of the same species (Milman and Barzilai, 2016). For example, centenarians have a distinctive epigenetic profile compared to an age-matched control population (Horvath et al., 2015). Similarly, we previously showed that flies with increased longevity have dramatic differences in many metabolites associated with methionine metabolism even at 1 week of age when 100% of both control- and long-lived flies are still alive (Parkhitko et al., 2016). To identify novel metabolic pathways that correlate with lifespan and that can be responsible for aging, we compared the metabolome of 1-week- and 4-week-old wild-type and long-lived flies to identify changes in metabolites that correlate with lifespan and identified tyrosine as an age-dependent metabolite. We demonstrate that Drosophila has a single tyrosine aminotransferase (TAT). Whole-body or neuronal-specific downregulation of TAT as well as other downstream enzymes in the tyrosine degradation pathway significantly extend Drosophila lifespan, cause alterations of multiple metabolites associated with increased lifespan, and lead to an increase in tyrosine and tyrosine-derived neuromediators (dopamine, octopamine, and tyramine). We further demonstrate that mitochondrial dysfunction may serve as an age-dependent stimulus that redirects tyrosine from neuromediator production into mitochondrial metabolism. In conclusion, our studies highlight the important role of the tyrosine degradation pathway and position TAT as a link between neuromediator production, dysfunctional mitochondria, and aging. Results Age-dependent changes in tyrosine levels We previously demonstrated that many metabolites associated with methionine metabolism, a metabolic pathway playing a key role in regulation of aging, are dramatically different between 1-week-old wild-type and long-lived flies (Parkhitko et al., 2016). These long-lived flies have been selected for delayed reproductive senescence over 170 generations and maintained on a generation interval of 70 days, while control lines were maintained on a 2-week generation interval (Carnes et al., 2015). To further extend our metabolic analysis and reveal new metabolites involved in the regulation of aging and lifespan, we compared differences in metabolomes in 1-week and 4-week-old wild-type (B3) and long-lived (O1 and O3) flies, searching for metabolites that are either different between control vs. long-lived flies of the same age and/or metabolites that change differently with age between control vs. long-lived flies. Although longevity is not the only trait that is different between these lines and these metabolites can be linked to other traits such as reproduction; we used this list of candidate metabolic pathways for the further analysis in wild-type flies. Including metabolites in methionine metabolism, we identified 49 metabolites whose changes were significantly different with age between control and both lines of long-lived flies (Figure 1A). While many of these metabolites belong to the metabolic pathways that have been previously described as being important players in the regulation of aging and longevity (tryptophan metabolism, NADPH, nucleotide metabolism etc.), many of them have not been studied before, including tyrosine. Figure 1. Tyrosine is a new lifespan-dependent metabolite. (A) Heat map showing the metabolites that significantly changed in 1-week and 4-week-old wild-type (B3) and long-lived (O1 and O3) flies. Each row represents a mean of five biological replicates. (B) Box plots of relative levels of tyrosine in 1-week and 4-week-old wild-type (B3) and long-lived (O1 and O3) flies extracted from the heat map (A). (C) Relative mRNA levels of CG1461 in 1-week-old control (B3) and long-lived (O1, O3) flies. Means ± SD. (D) Relative mRNA levels of CG1461, Faa, Hgo, CG11796, GstZ2, and Hn from 1-week and 5-week-old wild-type (OreR) flies. Means ± SD. (E) Tyrosine metabolism pathway. *p<0.05, **p<0.01, ***p<0.001. Figure 1—figure supplement 1. Age-dependent increase of GFP-tagged CG1461. Immunoblot analysis of GFP and tubulin in 1-week, 4-week, and 8-week CG1461(TyrAm)-GFP-tagged flies. Interestingly, levels of tyrosine significantly increased with age in both lines of long-lived flies (Figure 1B). In addition to its proteogenic function, tyrosine can be used either as a precursor for the synthesis of neuromediators, such as dopamine, octopamine, and tyramine, or can be degraded via the tyrosine degradation pathway producing acetoacetate and fumarate (Figure 1E). The first and rate-limiting enzyme in the tyrosine degradation pathway is tyrosine aminotransferase (TAT). Based on the DIOPT ortholog prediction tool (Hu et al., 2011), Drosophila has a single TAT ortholog, CG1461. We tested whether levels of CG1461/TAT were different between control and long-lived flies. Strikingly, mRNA levels of CG1461/TAT were significantly decreased in both long-lived O1 and O3 female and male flies compared to B3 control flies (Figure 1C), suggesting that TAT levels may explain age-dependent differences in the level of tyrosine. Next, we examined CG1461/TAT expression levels in young (1 w) vs. old (5 w) wild-type Oregon R (OreR) flies and detected a significant mRNA increase in older flies (Figure 1D). Consistent with this observation, using a GFP-tagged transgenic line from the fly-TransgeneOme (fTRG) library (Sarov et al., 2016), we observed an increase in TAT with age (Figure 1—figure supplement 1). In addition, mRNA levels of other enzymes in the tyrosine degradation pathway, Hgo, CG11796, GstZ2, and Hn, were significantly increased with age in wild-type flies (Figure 1D,E). Altogether, these findings suggest that tyrosine catabolism increases during aging. Supplementing tyrosine extends lifespan and CG1461 functions as TAT to cope with high tyrosine levels TAT catalyzes the conversion of tyrosine to 4-hydroxyphenylpyruvate and is the first and rate-limiting enzyme in the tyrosine catabolic pathway (Figure 1E). We first tested whether the Drosophila ortholog of TAT, CG1461, is involved in tyrosine degradation. We confirmed the knockdown efficiency of three independent CG1461 RNAi lines by qRT-PCR (CG1461 RNAi-1, ~50% [weak line]; CG1461 RNAi-2 and 3, ~80% [strong lines]) (Figure 2A) and generated CG1461-deficient flies using CRISPR/Cas9 (Figure 2B). To test the functional significance of CG1461 for tyrosine degradation, we ubiquitously downregulated CG1461 in adult flies using the tubulin-Gal4, tubulin-Gal80ts temperature-inducible system. Gal80ts is active at 18°C and represses Gal4, whereas at 29°C, Gal80ts is inactivated, allowing Gal4-dependent expression of CG1461 RNAi. Flies were grown at 18°C, switched to 29°C after eclosion to induce expression of CG1461 RNAi and after 2 weeks switched on food supplemented with 5 g/L of tyrosine, which represents approximately a 5- to 10-fold increase of tyrosine compared to regular food (Piper, 2017). Extra tyrosine caused acute toxicity and death when CG1461 expression was downregulated and the rate of death correlated with the strength of the RNAi lines, suggesting that CG1461 is critical in the degradation of excess tyrosine (Figure 2C). Similarly, when we switched CG1461 wild-type, heterozygous, or mutant flies on food supplemented with 5 g/L of tyrosine it caused acute toxicity and death of CG1461 mutant but no acute toxicity was observed in wild-type or heterozygous flies (Figure 2D). We further tested a range of different concentrations of tyrosine (1X, 2.5X, 5X, and 10X) and observed a gradual and significant decrease in the lifespan of mutant flies (−53%, −54%, −39%, −20% for 10X, 5X, 2.5X, and 1X concentrations of tyrosine in male flies and −69%, −67%, −48%, −37% for 10X, 5X, 2.5X, and 1X concentrations of tyrosine in female flies, respectively) (Figure 2—figure supplement 1A,B); while the lifespan was either non-affected in male wild-type flies (Figure 2—figure supplement 1A), or decreased at the highest (5X and 10X) concentrations by a much lower extent in female wild-type flies (−38% and −24% for 10X and 5X concentrations of tyrosine) (Figure 2—figure supplement 1B). In addition, accordingly with the beneficial role of tyrosine, feeding flies with low concentrations of tyrosine significantly increased their lifespan by 9% in male flies (1X concentration of tyrosine, p<0.0001, log-rank test) (Figure 2—figure supplement 1A) and by 11.5% in female flies (1X concentration of tyrosine, p=0.002, log-rank test) (Figure 2—figure supplement 1B). Tyrosine is a conditionally essential amino acid because it can be synthetized from phenylalanine (but not vice versa). To examine whether CG1461 regulates levels of tyrosine and phenylalanine, we performed metabolomic profiling of CG1461 wild-type and mutant flies fed with either control or high-tyrosine diets. Feeding control flies with tyrosine increased the level of tyrosine and phenylalanine because phenylalanine is degraded via its conversion into tyrosine (Figure 2E,F); however, CG1461 mutant flies on control diet had significantly higher levels of tyrosine, suggesting that a significant portion of tyrosine from regular food undergoes degradation via the tyrosine degradation pathway. Moreover, feeding CG1461 mutant flies with tyrosine further increased levels of tyrosine and phenylalanine (Figure 2E,F) and caused their death (Figure 2D). We further tested whether the level of a GFP-tagged CG1461 changed in response to high tyrosine feeding, as we previously observed increased levels of CG1461 with age. Feeding flies with 5 g/L of tyrosine increased the level of GFP-tagged CG1461 (Figure 2—figure supplement 1C). Interestingly, male flies had higher levels of GFP-tagged CG1461 both on control and tyrosine supplemented food (Figure 2—figure supplement 1C) that may explain the differences in response to the high concentration of tyrosine in male and female flies (Figure 2—figure supplement 1A,B). Moreover, mRNA levels of other enzymes from the tyrosine degradation pathway, CG11796, Hgo, Faa, Hn, were increased in male flies, whereas the level of RP49 did not change (Figure 2—figure supplement 1D). Altogether, these data suggest that CG1461 is a functional ortholog of mammalian TAT that is required for the degradation of excess tyrosine to maintain stable levels of tyrosine on regular diet, and it is strongly induced when excess tyrosine is present. These data also point to the beneficial role of tyrosine in the regulation of lifespan in wild-type flies. Figure 2. CG1461 functions as Tyrosine Aminotransferase/TAT and is necessary to degrade tyrosine. (A) Relative mRNA levels of CG1461 in tubulin-Gal80ts, tubulin-Gal4 flies expressing either no RNAi, control RNAi or three different CG1461 RNAi for 10 days. Means ± SD. *p<0.05, ***p<0.001 (B) Relative mRNA levels of CG1461 in wild-type and CG1461-deficient flies (both backcrossed to wild-type OreR flies). Means ± SD. ***p<0.001 (C) Feeding adult flies with 5 g/L of tyrosine significantly suppresses lifespan of flies with ubiquitous adult-onset downregulation of CG1461. Arrow indicates the beginning of tyrosine feeding. p<0.001. (D) Feeding adult flies with 5 g/L of tyrosine significantly suppresses lifespan of CG1461 mutant but not wild-type or heterozygous flies. Arrow indicates the beginning of tyrosine feeding. p<0.001. Box plots of relative levels of tyrosine (E) and phenylalanine (F) in wild-type and CG1461-deficient flies fed either control or high level of tyrosine (5 g/L) diet. Figure 2—figure supplement 1. Tyrosine supplementation increases lifespan of wild-type OreR flies and increases expression of GFP-tagged CG1461. Lifespan of male (A) and female (B) wild-type and CG1461-deficient flies (both backcrossed to wild-type OreR flies) fed with the range of tyrosine concentrations (1X = 0.5 g/L). Arrow indicates the beginning of tyrosine feeding. (C) Immunoblot analysis of GFP and tubulin in CG1461(TyrAm)-GFP-tagged flies fed either control or high-tyrosine diet. (D) Relative mRNA levels of CG1461, CG11796, Hgo, Faa, Hn, Rp49 in male and female flies. Means ± SD. Means ± SD. *p<0.05, **p<0.01, ***p<0.001. The tyrosine degradation pathway regulates lifespan Since supplementing tyrosine to wild-type flies increased their lifespan, levels of TAT and other enzymes in the tyrosine degradation pathway increased with age, and the levels of tyrosine were higher in the long-lived flies; we evaluated the effects of TAT and other enzymes in the tyrosine degradation pathway on lifespan using RNAi. To avoid developmental effects and differences in genetic backgrounds, we used the Actin Gene-Switch (Actin-GS) inducible Gal4/UAS expression system (Roman et al., 2001; Osterwalder et al., 2001), whereby UAS-RNAi expression is driven by Gal4 when flies are fed mifepristone (RU486). Expression of different control RNAi lines did not affect lifespan (Parkhitko et al., 2016), while two independent RNAi lines against TAT significantly extended lifespan (TAT RNAi-1 (weak), 9% increase in Mean Lifespan, p<0.0001, log-rank test; TAT RNAi-3 (strong), 17% increase in Mean Lifespan, p<0.0001, log-rank test) (Figure 3A,B), and better RNAi efficiency was consistent with more robust lifespan extension. While downregulation of TAT can result in lifespan extension due to a general inhibition of the tyrosine degradation pathway, it can also be due to a potential (although unknown) alternative function of TAT. To confirm that modulation of tyrosine degradation was responsible for lifespan extension, we downregulated two additional enzymes: CG11796 and Hgo. CG11796 is a 4-hydroxyphenylpyruvate dioxygenase that catalyzes the conversion of 4-hydroxyphenylpyruvate to homogentisate, the second step in the tyrosine degradation pathway (Figure 1E). Hgo is a homogentisate 1,2-dioxygenase that catalyzes the conversion of homogentisate to 4-maleylacetoacetate (Figure 1E). Downregulation of both CG11796 (Figure 3C) and Hgo (Figure 3D) moderately but significantly increased lifespan (CG11796 RNAi, 10% increase in Mean Lifespan, p<0.0001, log-rank test; Hgo RNAi, 12% increase in Mean Lifespan, p<0.0001, log-rank test). Figure 3. Whole-body and neuronal-specific downregulation of CG1461/Tyrosine Aminotransferase extends lifespan. (A) Ubiquitous adult-onset expression of CG1461 RNAi-1 increases lifespan in females. p<0.0001. (B) Ubiquitous adult-onset expression of CG1461 RNAi-3 increases lifespan in females. p<0.0001. (C) Ubiquitous adult-onset expression of CG11796 RNAi increases lifespan in females. p<0.0001. (D) Ubiquitous adult-onset expression of Hgo RNAi increases lifespan in females. p<0.0001. (E) Fat body-specific adult-onset expression of CG1461 RNAi does not affect lifespan in females. (F) Intestine-specific adult-onset expression of CG1461 RNAi does not affect lifespan in females. (G) Neuronal-specific adult-onset expression of CG1461 RNAi-1 increases lifespan in females. p<0.0001. (H) Neuronal-specific adult-onset expression of CG1461 RNAi-2 increases lifespan in females. p<0.0001. (I) Neuronal-specific adult-onset expression of CG1461 RNAi-1, -2, and -3 increases lifespan in females. p<0.0001. Figure 3—figure supplement 1. Neuronal-specific downregulation of Tyrosine Aminotransferase/TAT leads to metabolic reprogramming similar to the whole-body downregulation of TAT. Box plots of relative levels of tyrosine (A), glucosamine (B), methylcysteine (C), and NADH (D) in elav-Gal4,tubulin-Gal80ts flies expressing either control RNAi or TAT RNAi. FDR adjusted p-value. *p<0.05, **p<0.01. To further dissect the role of TAT in lifespan extension, we next tested whether specific tissues were responsible for lifespan extension. Expression of a strong TAT RNAi in the entire fat-body of adult flies starting at 1 week of age using Geneswitch driver strain WB-FB-GS, which contains both a head fat-body driver (S1-32) and a body-fat-body driver (S1-106) (Giannakou et al., 2007; Shen et al., 2009), did not affect lifespan (Figure 3E). Similarly, expression of strong TAT RNAi using the TIGS-2 Geneswitch driver (TIGS-2), which is associated with digestive tract-specific expression (Rera et al., 2011; Poirier et al., 2008), did not affect lifespan (Figure 3F). However, the 3XElav Geneswitch driver (3XElav-GS), which drives nervous-system-specific expression (Osterwalder et al., 2001; Shen et al., 2009), led to a significant extension of lifespan when two different TAT RNAi were expressed starting at 1 week (TAT RNAi-1 (weak), 12.6% increase in Mean Lifespan, p<0.0001, log-rank test; TAT RNAi-3 (strong), 24.5% increase in Mean Lifespan, p<0.0001, log-rank test) (Figure 3G,H). Similar results were obtained when TAT RNAi lines were expressed in the nervous system of adult flies using ElavGal4 and the temperature-sensitive tubulin-Gal80ts repressor. Flies were allowed to develop at 18°C and then switched to 29°C after eclosion to induce RNAi expression. Adult onset neuronal-specific TAT RNAi expression resulted in strong lifespan extension compared to no RNAi or control RNAi expression (TAT RNAi-1, 15% increase in Mean Lifespan, p<0.0001, log-rank test; TAT RNAi-2, 18% increase in Mean Lifespan, p<0.0001; TAT RNAi-3, 17% increase in Mean Lifespan, p<0.0001, log-rank test) (Figure 3I). Interestingly, nervous-system-specific TAT downregulation resulted in stronger lifespan extension than with a ubiquitous driver. While differences in genetic background or/and the strength of Gal4 induction by mifepristone could explain these effects, one possibility is that TAT downregulation can be both beneficial and detrimental depending on tissue and cell type. Altogether, our results suggest that ubiquitous and tissue-specific suppression of the tyrosine degradation pathway is sufficient to extend lifespan. Ubiquitous downregulation of TAT causes metabolic reprogramming by affecting mitochondrial/antioxidant pro-longevity metabolic factors To understand the mechanisms of lifespan extension by TAT downregulation, we performed metabolomic profiling of flies that expressed either control RNAi or two different strong TAT RNAi under the control of the ubiquitous temperature-sensitive (tubulin-Gal4, tubulin-Gal80ts) driver for 10 days. Principal component analysis (PCA) of the measured metabolites clearly distinguished flies with control and TAT RNAi but clustered the two independent TAT RNAi lines together (Figure 4A). We identified 24 metabolites that were significantly and commonly changed in flies expressing two different strong TAT RNAi compared to control flies (Figure 4B). As expected, one of the significantly altered metabolites was tyrosine (Figure 4B,C). Some of the other significantly changed metabolites have been previously connected to lifespan regulation. Normal aging and premature aging in mtDNA mutator mice exhibit increased brain lactate (Ross et al., 2010) and cerebrospinal fluid lactate is elevated in aging humans (Yesavage et al., 1982). Dietary supplementation with D-glucosamine-6-phosphate (GlcN-6-phosphate) extends lifespan of nematodes and aging mice acting as an inhibitor of glycolysis and promoting mitochondrial function (Weimer et al., 2014). Downregulation of TAT led to a significant increase of GlcN-6-phosphate (Figure 4D) and decrease in products of glycolysis - lactate (Figure 4E) and NADH (Figure 4F). Another lifespan-related metabolite that was significantly upregulated after downregulation of TAT was nicotinamide (Figure 4J). Nicotinamide supplementation improves healthspan in mice, reduces oxidative stress and inflammation (Mitchell et al., 2018). In flies, overexpression of Nicotinamide mononucleotide adenylyltransferase (Nmnat) and Nicotinamidase (Naam), which encode enzymes involved in conversion of nicotinamide to NAD promotes longevity, improves mitochondrial function and protects against oxidative stress (Balan et al., 2008; Liu et al., 2018). Moreover, downregulation of TAT led to a significant increase of methylcysteine (Figure 4G) and decrease of the oxidized form of methionine, methionine sulfoxide (target of the MSRA antioxidant system). Dietary supplementation with S-methyl-L-cysteine has been shown to enhance the MSRA antioxidant system in Drosophila and to delay the progression of the movement defect in flies overexpressing α-synuclein in the nervous system (Wassef et al., 2007). Strikingly, five of the significantly altered metabolites, NADH, thiamine pyrophosphate, NADP, glutathione and lactate, belong to the pyruvate metabolism (Figure 4B,E,F,I,K) and point to metabolic pathways associated with mitochondrial function. Pyruvate is ultimately destined for transport into mitochondria as a major fuel to drive ATP production by oxidative phosphorylation and feed into multiple biosynthetic pathways intersecting the TCA cycle. The major sources of pyruvate in the cytoplasm are phosphoenolpyruvate, alanine and lactate (Gray et al., 2014). Figure 4. Downregulation of CG1461/Tyrosine Aminotransferase leads to reprogramming of metabolism related to mitochondrial function. (A) Principal component analysis of tubulin-Gal4, tubulin-Gal80ts flies expressing either control RNAi or two different TAT RNAi. (B) Heat map showing the significantly and commonly changed metabolites in flies expressing two different TAT RNAi. Box plots of relative levels of tyrosine (C), lactate (D), glucosamine (E), nicotinamide (F), methylcysteine (G) in tubulin-Gal4,tubulin-Gal80ts flies expressing either control RNAi or two different TAT RNAi. (H) Metabolic Set Enrichment Analysis of the metabolites that changed significantly and commonly in flies expressing two different TAT RNAi. Box plots of relative levels of NADH (I), thiamine pyrophosphate (J), NADP (K) in tubulin-Gal4,tubulin-Gal80ts flies expressing either control RNAi or two different TAT RNAi. Figure 4—figure supplement 1. Neuronal-specific downregulation of Tyrosine Aminotransferase/TAT increases levels of tyrosine-derived neurotransmitters. Head levels of Histamine (A) and GABA (B) in CG1461/TAT wild-type (wt), heterozygous (het), and mutant (mut) flies. Head levels of DOPA (C), Octopamine (D), Dopamine (E), Tyramine (F) in elav-Gal4, tubulin-Gal80ts > control RNAi or TAT RNAi flies maintained either on the regular food or the food containing 5 mM of tyrosine for 2 days. Means ± SD. *p<0.05, **p<0.01, ***p<0.001. Feeding adult male (G) and female (H) OreR flies with 5 mM Octopamine, L-DOPA, or Tyramine starting day 14. We further tested whether neuronal-specific downregulation of TAT would cause metabolic alterations in whole flies similar to the whole-body downregulation of TAT. We performed metabolomics of flies that expressed either control RNAi or strong TAT RNAi (shRNA-2) under the control of the neuronal-specific temperature sensitive (elav-Gal4, tubulin-Gal80ts) driver for 10 days. Neuronal-specific downregulation of TAT caused the upregulation of tyrosine (Figure 3—figure supplement 1A) and metabolic reprogramming similar to the whole-body downregulation of TAT. We detected several metabolites (glucosamine, methylcysteine, and NADH) that were similarly altered as a result of whole-body-driven and neuronal-specific downregulation of TAT (Figure 3—figure supplement 1B–D). Altogether, our results suggest that downregulation of TAT causes global metabolic reprogramming involving metabolites belonging to mitochondrial metabolism and antioxidant defense that have known roles in the regulation of lifespan. Whole-body downregulation of TAT elevates levels of tyrosine-derived neurotransmitters Tyrosine is a precursor for biogenic amine neurotransmitters: dopamine, tyramine, and octopamine. Tyrosine can be hydroxylated by tyrosine hydroxylase (TH/ple) to produce DOPA, and DOPA can be decarboxylated by Dopa decarboxylase (Ddc) to produce dopamine. Alternatively, tyrosine can be decarboxylated by tyrosine decarboxylase (Tdc1/Tdc2) to produce tyramine. Tyramine can be further converted by tyramine-β-hydroxylase (TβH) to octopamine. Octopamine and tyramine are the invertebrate counterparts of the vertebrate adrenergic transmitters adrenaline and noradrenaline. We hypothesized that redirection of tyrosine from the production of neurotransmitters into the tyrosine degradation pathway could result in either decreased levels of neurotransmitters or aggravation of mitochondrial function via feeding of tyrosine into the TCA cycle. To test whether TAT is involved in the regulation of the levels of tyrosine-derived neurotransmitters, we measured levels of tyrosine, DOPA, Dopamine, Tyramine, and Octopamine in heads of TAT wild-type, heterozygous, and mutant middle-age flies when the levels of TAT and other enzymes in the tyrosine degradation pathway are significantly increased. Loss of TAT led to the increase of tyrosine (Figure 5A) and all tyrosine-derived neurotransmitters (Figure 5B,C,D,E), but did not affect the levels of Histamine or GABA (Figure 4—figure supplement 1A,B). We further tested whether neuronal-specific downregulation of TAT would also increase the levels of tyrosine-derived neurotransmitters. We measured levels of DOPA, Dopamine, Tyramine, and Octopamine in heads of flies that expressed either control RNAi or strong TAT RNAi under the control of the neuronal-specific temperature sensitive (elav-Gal4, tubulin-Gal80ts) driver for 7 days and that were maintained either on regular food or food containing 5 mM of tyrosine for 2 days before the analysis. Neuronal-specific downregulation of TAT in the combination with supplementation of tyrosine caused upregulation of DOPA and Octopamine (Figure 4—figure supplement 1C,D). We have not detected significant increase in the levels of either tyramine or dopamine (Figure 4—figure supplement 1E,F), potentially, due to compensatory degradation of tyrosine in non-neuronal tissues or insufficient timing of TAT downregulation. Figure 5. Whole-body downregulation of Tyrosine Aminotransferase/TAT elevates levels of tyrosine-derived neurotransmitters in fly heads. Head levels of Tyrosine (A), DOPA (B), Dopamine (C), Tyramine (D), and Octopamine (E) in CG1461/TAT wild-type (wt), heterozygous (het), and mutant (mut) flies. Means ± SD. *p<0.05, **p<0.01, ***p<0.001. Figure 5—figure supplement 1. Suppression of complex I of ETC upregulates mRNA levels of enzymes in the tyrosine degradation pathway and decreases lifespan that can be partially rescued by supplementation of tyrosine. (A) Relative mRNA levels of Faa, CG11796, Hgo in tubulin-Gal80ts, tubulin-Gal4 flies expressing either no RNAi, control RNAi or RNAi against different subunits of mitochondrial ETC Complex I – CG9762, NP15.6, mtacp1 for 10 days. Means ± SD. (B) Relative mRNA levels of CG1461/TAT, CG11796, Hgo, Faa, and Hn in tubulin-Gal80ts, elav-Gal4 flies expressing either control RNAi or RNAi against NP15.6. Lifespans of male (C) and female (D) tubulin-Gal80ts, tubulin-Gal4 flies expressing either control RNAi or RNAi against NP15.6 fed with the range of tyrosine concentrations (1X = 0.5 g/L). Neuronal counts (E) and histology (F) of hematoxylin-stained heads from flies with or without expression of wild-type human α-synuclein with or without three different RNAi against TAT. Means ± SD. *p<0.05, **p<0.01, ***p<0.001. We then tested whether supplementation of neurotransmitters via feeding can prolong lifespan. It has been previously demonstrated that octopamine-deficient Tβh-null flies are sterile because they retain fully developed eggs, a defect that can be rescued by transferring flies onto octopamine- or norepinephrine- supplemented food (Monastirioti et al., 1996). Also, intermittent octopamine feeding to adult flies can substitute for exercise in sedentary flies, providing a number of pro-healthspan benefits (Sujkowski et al., 2017). Similarly, behavioral defect (sensitization to cocaine) in iav mutant flies that have significantly reduced levels of tyramine due to reduced activity of the enzyme tyrosine decarboxylase can be rescued by supplementing the food with tyramine (McClung and Hirsh, 1999). In addition, L-DOPA feeding rescues disrupted behaviors in neural dopamine-deficient flies (Riemensperger et al., 2011). To test whether age-dependent decrease in the levels of neurotransmitters are related to aging, we fed wild-type OreR flies with 5 mM of tyramine, octopamine, and L-DOPA starting at week 2 of age (choosing the concentration that was able to rescue genetic defects associated with loss of these neurotransmitters). Although this supplementation marginally (but statistically significantly) increased Drosophila lifespan (Figure 4—figure supplement 1G,H), the effect was weaker as compared to the lifespan extension observed following neuronal TAT downregulation, suggesting potential involvement of additional mechanisms of lifespan extension by downregulation of TAT. Inhibition of the electron transport chain upregulates expression of components of the tyrosine degradation pathway that can be rescued by Tigecycline While most cells use glucose/pyruvate/lactate for ATP synthesis, changes in cellular homeostasis can lead to a switch in fuel utilization that results in the oxidation of fatty acids and amino acids to produce NADH and FADH2 to feed the mitochondrial electron transport chain (ETC) (Area-Gomez et al., 2019). Tyrosine can be degraded via the tyrosine degradation pathway and generate two fragments, each of which can enter the TCA cycle. Four of the nine carbon atoms of tyrosine generate free acetoacetate, which is converted into acetoacetyl-CoA, and the second four-carbon fragment is recovered as fumarate. Eight of the nine carbon atoms of these two amino acids thus enter the citric acid cycle and the remaining carbon is lost as CO2. We hypothesized that aging and neurodegeneration can serve as a signal for the switch in tyrosine metabolism from production of neurotransmitters into the tyrosine degradation pathway and further aggravate mitochondrial dysfunction. To test our hypothesis, we expressed RNAi against different components of ETC (CG9762 – Complex I, SDHC – Complex II, CG18809 – Complex IV, and ms [Hoffman et al., 2014] 72Dt – Complex V) in young flies under the control of a ubiquitous temperature-sensitive driver (tubulin-Gal4, tubulin-Gal80ts) for 10 days. Suppression of all components of ETC resulted in a profound increase of mRNA levels of TAT (between 1.5- and two fold induction) with the greatest effect seen with downregulation of CG9762 (Complex I) (Figure 6A). We tested eight additional different subunits of complex I (CG9172, NP15.6, CG8680, CG1970, CG3214, mtacp1). Downregulation of each of them resulted in a similar increase in mRNA levels of TAT (up to fivefold induction) (Figure 6A). We then tested whether other enzymes in the tyrosine degradation pathway respond to the suppression of complex I of ETC. Similar to TAT, downregulation of different subunits of complex I caused a strong increase in mRNA levels of faa, Hgo, and CG11796, enzymes that act downstream of TAT in the tyrosine degradation pathway (Figure 5—figure supplement 1A). We also tested whether neuronal-specific suppression of complex I of ETC via downregulation of NP15.6 would phenocopy the effect of the whole body downregulation of NP15.6. We measured levels of TAT and other enzymes in the tyrosine degradation pathway in whole flies that expressed either control RNAi or strong TAT RNAi under the control of the neuronal-specific temperature-sensitive (elav-Gal4, tubulin-Gal80ts) driver for 10 days. Suppression of complex I of ETC only in neuronal cells was not enough to increase the expression of TAT or other enzymes in the tyrosine degradation pathway (Figure 5—figure supplement 1B). Interestingly, downregulation of components of complex I ETC can either extend or suppress the Drosophila lifespan depending on the strength and/or duration of this suppression (Copeland et al., 2009; Foriel et al., 2019; Rea et al., 2007). We further tested whether supplementation of tyrosine to flies with the whole-body downregulation of a component of Complex I ETC - NP15.6 would affect their lifespan. Expression of NP15.6 RNAi under the control of the ubiquitous temperature sensitive (tubulin-Gal4, tubulin-Gal80ts) driver caused significant reduction of lifespan with a stronger effect in female flies (−13% in male flies, p<0.0001, log-rank test; −33% in female flies, p<0.0001, log-rank test) (Figure 5—figure supplement 1C,D). Supplementation of different concentrations of tyrosine partially rescued lifespan in both male (+8.7%, + 11%, +11% for 1X, 2.5X, and 5X concentrations of tyrosine, p<0.0001, log-rank test) (Figure 5—figure supplement 1C) and female flies (+9.5%, + 10%, +10.5% for 1X, 2.5X, 5X concentrations of tyrosine, p<0.0001, p=0.0016, p=0.0002, log-rank test) (Figure 5—figure supplement 1D). In summary, inhibition of mETC Complex I function can decrease lifespan, which can be partially rescued by tyrosine supplementation. Figure 6. Mitochondrial dysfunction/neurodegeneration upregulates the level of CG1461/tyrosine aminotransferase. (A) Relative mRNA levels of CG1461/TAT in Gal80ts; tubulin-Gal4 flies expressing either no RNAi, control RNAi or RNAi against different subunits of mitochondrial ETC – CG9762, SDHC, CG18809, CG5548, NP15.6, CG8680, CG1970, CG3214, mtacp1 for 10 days. Means ± SD. (B) Relative mRNA levels of CG1461/TAT and α -synuclein in heads of flies with or without expression of wild-type human α-synuclein. Means ± SD. (C) Relative mRNA levels of CG1461/TAT in tubulin-Gal80ts, tubulin-Gal4 flies overexpressing control or p60 (inhibitory subunit of InR), dTsc1/dTsc2 (TSC complex, dTOR inhibitor) or PGC1a/Spargel. Means ± SD. (D) Immunoblot analysis of GFP and tubulin in heads of 1-week and 3-week-old flies expressing either control or TAT RNAi under pan-neuronal driver (ElavGal4) in the presence of GstD-GFP. (E) Ubiquitous adult-onset downregulation of TAT prolongs lifespan under oxidative stress (10 mM Paraquat). (F) Relative mRNA levels of CG1461/TAT in tubulin-Gal80ts, tubulin-Gal4 flies expressing either control or NP15.6 RNAi and fed with 10 mM reduced Glutathione, 100 µM mitoQ, 10 mM methyl pyruvate, 100 µM Ibedenone, or 100 µM Tigecycline. Means ± SD (G) Relative mRNA levels of CG1461/TAT, CG11796, faa, and Hgo in tubulin-Gal80ts, tubulin-Gal4 flies expressing either control or NP15.6 RNAi and fed with either control or 100 µM Tigecycline. (H) Working model. *p<0.05, **p<0.01, ***p<0.001. Figure 6—figure supplement 1. The effect of downregulation of tyrosine aminotransferase/TAT on GFP-tagged reporters relevant to aging. (A) Schematic diagram of mitophagy/mitochondrial biogenesis regulation by Insulin signaling, TOR, and PGC1a/Spargel. (B) Immunoblot analysis of GFP and tubulin in heads of 1-week and 3-week-old tubulin-Gal80ts, elav-Gal4 flies in the presence of GFP-CL1 (B), hsp22-GFP (C), 10XSTAT92-GFP (D), Drs-GFP (E) reporters expressing either control or TAT RNAi. (F) Relative mRNA levels of CLPX, HSP10, HSP60, and HSP22 in tubulin-Gal80ts, tubulin-Gal4 flies expressing either control RNAi or NP15.6 RNAi and fed with either control or 100 µM Tigecycline. Means ± SD. There is extensive evidence for the involvement of mitochondrial dysfunction in the pathogenesis of neurodegenerative diseases such as Alzheimer’s disease (AD) and Parkinson’s disease (PD) (Area-Gomez et al., 2019). Thus, we further tested whether pathological conditions associated with mitochondrial dysfunction would also cause the upregulation of TAT. To investigate whether expression of α-synuclein previously shown to promote mislocalization of the mitochondrial fission protein Drp1 leading to mitochondrial dysfunction and neuronal death also induced expression of TAT, we used a Drosophila α-synucleinopathy model (Ordonez et al., 2018). As expected and similar to ETC complex I inhibition, expression of wild-type human α-synuclein using the Syb-QF2 panneuronal driver resulted in the increase of TAT mRNA levels (Figure 6B). We further tested whether downregulation of TAT would rescue the neuronal loss associated with α-synuclein expression. We downregulated TAT using three different RNAi lines in the presence of α-synuclein expression. As expected, α-synuclein expression caused strong neurodegeneration and dramatic neuronal loss; however, downregulation of TAT with three different RNAi lines did not suppress this phenotype (Figure 5—figure supplement 1E,F). PD is characterized by extensive reprogramming of metabolism and targeting of multiple metabolic pathways may be required to prevent neurodegeneration (Shao and Le, 2019). To test whether stimulation of mitophagy/mitochondrial biogenesis decreases the level of TAT in young flies, we tested how overexpression of Spargel (Drosophila orthologue of PGC1α), p60 (inhibitory subunit of InR), or dTsc1/dTsc2 (TSC complex, dTOR inhibitor) affects the level of TAT. Both overexpression of Spargel (Rera et al., 2011) and suppression of InR (Clancy et al., 2001) or TOR (Kapahi et al., 2004) signaling are critical regulators of mitophagy/mitochondrial biogenesis and extend Drosophila lifespan (Figure 6—figure supplement 1A). Overexpression of Spargel, p60, and dTsc1/dTsc2 significantly suppressed expression of TAT (Figure 6C). To test how mechanistically downregulation of TAT extends lifespan, we crossed flies expressing either control RNAi or TAT RNAi with a pan-neuronal driver (ElavGal4) to a number of GFP reporter lines relevant to different age-dependent processes—GstD-GFP (oxidative stress) (Sykiotis and Bohmann, 2008), GFP-CL1 (proteosomal activity) (Pandey et al., 2007), hsp22-GFP (mitochondrial stress) (Yang and Tower, 2009), STAT92E-GFP (Stat pathway) (Bach et al., 2007), and Drs-GFP (antimicrobial response) (Ferrandon et al., 1998)—and tested their activity in fly heads. We found that the amount of GFP under the control of the GstD promoter increased with age in fly brains, and this increase was suppressed by downregulation of TAT (Figure 6D),while we have not detected differences between control and TAT RNAi with other reporters, at least at the tested conditions (Figure 6—figure supplement 1B–E). This suggests that downregulation of TAT may regulate lifespan at least partially via counteracting the accumulation of oxidative stress in neuronal tissue. We further found that downregulation of TAT strongly increased resistance to 10 mM paraquat (redox cycler which causes oxidative damage) (Figure 6E). Downregulation of ETC complex I can have multiple effects on mitochondria leading to increased mitoROS production, mtUPR, decreased NAD+/NADH ratio, decreased ATP production and other effects (Rhooms et al., 2020). To dissect a potential mechanism of how downregulation of ETC Complex I and potentially aging cause upregulation of TAT, we fed flies with an available toolbox of chemical inhibitors: mitoQ dye (quencher of mitochondrial ROS), methyl pyruvate (membrane permeable pyruvate), idebenone (a bypass of mitochondrial complex I), Tigecycline (antibiotic that can inhibit mitochondrial translation), and reduced glutathione (antioxidant) (Wisnovsky et al., 2016). Only treatment with Tigecycline suppressed upregulation of TAT induced by inhibition of ETC Complex I (Figure 6F), although we cannot rule out that other chemicals did not rescue TAT upregulation because of technical limitations associated with feeding flies with chemicals (poor distribution in fly body, wrong concentration, instability in fly food, etc.). The effect observed for Tigecycline suggests that downregulation of ETC Complex I and potentially aging causes an integrated stress response that can be rescued by inhibition of mitochondrial protein translation. Moreover, treatment with Tigecycline also suppressed other enzymes in the tyrosine degradation pathway (CG11796, Hgo, Faa) that were upregulated by the inhibition of ETC Complex I but did not affect their levels in control flies (Figure 6G). Interestingly, although inhibition of mitochondrial translation would be expected to cause mitochondrial stress, at this concentration/timing, we have not observed upregulation of markers of mitochondrial stress (ClpX, hsp10, hsp60, or hsp22) in both control flies and in flies with inhibition of ETC Complex I (Figure 6—figure supplement 1F). Altogether, our results suggest that, similar to aging, mitochondrial dysfunction serves as a signal to elevate expression of TAT and other enzymes in the tyrosine degradation pathway and that this effect can be rescued by the FDA-approved drug Tigecycline. Discussion By comparing metabolic changes in control and long-lived flies during aging, we identified the amino acid tyrosine and the tyrosine degradation pathway as potential targets for lifespan extension. Supplementing flies with tyrosine or whole-body and tissue-specific downregulation of tyrosine aminotransferase/TAT, the first and rate-limiting enzyme in the tyrosine degradation pathway, significantly extended lifespan. Moreover, upregulation of TAT might serve as a switch between neurotransmitter production and anaplerosis under mitochondrial dysfunction and aging. In addition, we found that the FDA-approved drug Tigecycline can suppress the upregulation of enzymes in the tyrosine degradation pathway under the conditions of mitochondrial dysfunction. Age-dependent metabolic reprogramming We searched for changes in the fly metabolome caused by aging in control and long-lived flies and hypothesized that preventing some of these changes would increase lifespan and prevent age-dependent health deterioration. Previously, we found striking differences in multiple methionine metabolism intermediates between control and long-lived flies, including S-adenosylhomocysteine and homocysteine, and showed that modulating levels of these metabolites extended lifespan (Parkhitko et al., 2016). Here, we extended our analysis and identified 49 metabolites that changed significantly with age between control and long-lived flies. Some of these metabolites represent metabolic pathways that were previously implicated in lifespan extension and the role of others is unknown. Systematic interrogation of the enzymes regulating these metabolites should lead to identification of previously unknown regulators of lifespan in Drosophila. Amino acid metabolism and lifespan extension Amino acids play a key role in lifespan extension by calorie/dietary restriction. In Drosophila, restricting dietary protein extends lifespan, whereas carbohydrate and lipid restriction have little effect on survival (Mair et al., 2005). In addition, manipulation of metabolism of specific amino acids can extend lifespan in flies and other organisms. For example, methionine restriction (Lee et al., 2014) or activation of the methionine flux (Parkhitko et al., 2016; Parkhitko et al., 2019) prolongs health- and lifespan in flies and other species, whereas the mechanisms of lifespan extension do not overlap. This effect could be due to the processing of harmful metabolites, as activation of the methionine flux would promote processing of SAH, which accumulates with age and inhibits methyltransferases (Parkhitko et al., 2019). Impairing threonine catabolism by downregulation of glycine-C-acetyltransferase promotes the lifespan of C. elegans via stimulation of methylglyoxal formation (Ravichandran et al., 2018). Methylglyoxal is a reactive dicarbonyl inducing oxidative stress and while its high concentration is harmful, low concentration stimulates stress-responsive pathways and hormetic activity on lifespan in C. elegans (Ravichandran et al., 2018). Increased homocysteine processing via the transsulfuration pathway (Kabil et al., 2011) and glycine supplementation extend Drosophila and C. elegans lifespan, respectively, partially via stimulating the flux through methionine metabolism. Here, we identified a new branch of amino acid metabolism, namely the tyrosine degradation pathway that can regulate lifespan. In agreement with our data showing that levels of TAT are decreased in flies with overexpression of dTsc1/Tsc2, Yuan et al. found that the level of hpd-1, the worm orthologue of 4-hydroxyphenylpyruvate dioxygenase/CG11796, is decreased in long-lived eat-2 mutant worms (genetic model of calorie restriction in worms). Moreover, downregulation of hpd-1 increased worm lifespan, which is consistent with increased Drosophila lifespan observed with downregulation of CG11796 (Yuan et al., 2012). In addition, the C. elegans ortholog of TAT, tatn-1, influences insulin signaling, development, and lifespan via modulation of aak-2/AMPK signaling (Ferguson et al., 2013). Also, in worms, AMPK/calcineurin-mediated longevity was regulated cell-nonautonomously via regulation of octopamine (Burkewitz et al., 2015). Altogether, we propose two potential mechanisms of lifespan extension: preservation of the production of neurotransmitters and prevention of increased tyrosine feeding into the TCA cycle (Figure 6H). Amino acid catabolism and mitochondria Aging is characterized by progressive accumulation of dysfunctional mitochondria and a reduced capacity to produce ATP. Mitochondrial ETC generates a proton gradient derived from NADH and FADH2 that are produced in the TCA cycle, and ATP synthase uses this gradient for the production of ATP from ADP. Changes in cellular homeostasis can result in the oxidation of amino acids to produce NADH and FADH2 to feed the mitochondrial electron transport chain (ETC) (Area-Gomez et al., 2019). Due to the fact that: (a) metabolism of different amino acids has recently been shown to play an important role in the regulation of aging; (b) mitochondrial dysfunction is evident in aging and neurodegeneration; (c) tyrosine can play anaplerotic role via the tyrosine degradation pathway and production of acetoacetyl CoA and fumarate; and (d) enzyme levels in the tyrosine degradation pathway increase with age, we hypothesize that, at least in flies, aging drives upregulation of tyrosine catabolism and redirects tyrosine from neurotransmitter production into the tyrosine degradation pathway to compensate for age-driven mitochondrial dysfunction (Figure 6H). Moreover, we demonstrate that these changes can be phenocopied by the inhibition of mETC with the strongest effect seen with inhibition of mETC complex I. Although it is unknown how the activity of the mETC complex I is changed with age in neuronal cells in flies, complex I activity declines with age in both rodents and human in different organs including brain (Gómez and Hagen, 2012). Moreover, overexpression of NDI1, an alternative NADH dehydrogenase that can bypass complex I, prolonged Drosophila lifespan when it was either expressed in whole flies or only in neuronal cells (Sanz et al., 2010; Bahadorani et al., 2010), raising the question of how downregulation of mETC complex I extends lifespan while it can also phenocopy aging and reduce lifespan. It has been shown in worms that lifespan extension caused by inhibition of ETC is limited by the narrow window of timing of treatment and strength of knockdown (Rea et al., 2007). Similarly in flies, lifespan extension by inhibition of mETC was achieved with the da-GeneSwitch driver, which is weaker and mosaic compared with non-inducible Gal4 drivers (Copeland et al., 2009), whereas usage of stronger and ubiquitous drivers caused severe lifespan shortening (Foriel et al., 2019). It is still an open question why inhibition of mETC is beneficial in one context and detrimental in another. Tyrosine aminotransferase and tyrosinemia Tyrosinemia type II, also known as Richner-Hanhart Syndrome (OMIM # 276600), is a rare autosomal recessive disorder, caused by mutations in the gene encoding tyrosine aminotransferase and is manifested by eye, skin, and central nervous system alterations (Scott, 2006). Why would downregulation of TAT extend lifespan in flies but cause disease in humans? The degree of downregulation, duration, and tissue specificity could be a key for the beneficial effects of TAT downregulation. Indeed, we observed stronger lifespan extension with nervous-specific TAT downregulation than with ubiquitous ActinGeneSwitch driver. In addition, TAT-mutant flies had shortened lifespan. Moreover, the ubiquitous ActinGeneSwitch driver has a mosaic pattern of expression that would probably still allow degradation of some tyrosine and create a balance between neurotransmitter production and tyrosine degradation. This notion is consistent with the fact that patients heterozygous for TAT do not exhibit any clinical manifestations. In agreement with the beneficial role of downregulation of TAT on lifespan, our metabolomics analysis revealed upregulation of several metabolites previously connected to lifespan extension. These metabolites include GlcN-6-phosphate (Weimer et al., 2014), nicotinamide (Balan et al., 2008; Liu et al., 2018), and methylcysteine (Wassef et al., 2007). Targeting metabolic pathways attributed to these metabolites extend health- and lifespan across different species (Parkhitko et al., 2020). It will be of interest to elucidate the mechanisms leading to the elevation of these metabolites. NTBC/nitisinone/Orfadin (2-(2-nitro-4-trifluoromethylbenzoyl)cyclohexane-1,3-dione) is an FDA-approved drug that inhibits 4-hydroxyphenylpyruvate dioxygenase in the tyrosine degradation pathway and is currently approved for the treatment of hereditary tyrosinemia type 1 (Lock et al., 2014). Given that our current study shows that inhibition of the tyrosine degradation pathway and specifically of CG11796, the fly ortholog of 4-hydroxyphenylpyruvate dioxygenase, extends lifespan, it would be of interest to test the potential of NTBC/nitisinone/Orfadin to promote health- and lifespan in humans. Tyrosine supplementation in human clinical trials Tyrosine is a precursor for biogenic amine neurotransmitters: dopamine, tyramine, and octopamine. Tyramine and octopamine in flies are analogous to epinephrine (adrenaline) and norepinephrine (noradrenaline) in humans. In mice, tyrosine supplementation reaches maximum concentration in the brain 1 hr after oral ingestion (Topall and Laborit, 1989) and enhances catecholamine synthesis in particular noradrenergic neurons (Gibson and Wurtman, 1978; Milner and Wurtman, 1986). In rats, tyrosine supplementation increases dopamine concentration in the extracellular fluid of corpus striatum and nucleus accumbens (During et al., 1988; Woods and Meyer, 1991). Due to the beneficial role of catecholamines in coping with stress, a number of clinical trials in healthy subjects have been designed to investigate whether tyrosine reduces cognitive and physiological stress in humans exposed to a combination of mental and physical stressors. In humans, tyrosine has been shown to improve cold-induced decrements in working memory (Shurtleff et al., 1994), improve subject performance on stress-sensitive attention tasks (Deijen and Orlebeke, 1994), improve attentional focus in the presence of a distractor (Deijen and Orlebeke, 1994), and attenuate performance decrements and adverse mood states associated with acute exposure to cold and hypoxia (Deijen and Orlebeke, 1994; Banderet and Lieberman, 1989; Dollins et al., 1995; Shukitt-Hale et al., 1996). Most of these clinical trials in healthy subjects have been performed on young volunteers. Interestingly, the first study investigating the effects of tyrosine on cognitive effects in older adults has demonstrated unfavorable effects of higher doses tyrosine on working memory performance (van de Rest et al., 2017). These findings are consistent with our hypothesis that tyrosine metabolism is reprogrammed in older adults and that at this stage tyrosine supplementation enhances the tyrosine degradation pathway instead of enhancing the production of neurotransmitters. Finally, it would be interesting to test whether Tigecycline, an FDA-approved drug that suppresses the activity of the tyrosine degradation pathway in flies in response to mitochondrial dysfunction could restore normal levels of tyrosine-derived neurotransmitters in elderly people. Materials and methods Key resources table Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-α-Tubulin Sigma T5168 Antibody Anti-GFP Invitrogen A-6455 Strain, strain background (Escherichia coli) One Shot TOP10 Chemically Competent E. coli Thermo Fisher Scientific C404003 Commercial assay or kit iScript Reverse Transcription Supermix Bio-Rad 1708896 Commercial assay or kit iQ SYBR Green Supermix Bio-Rad 1708880 Commercial assay or kit BenchMark Prestained Protein Ladder Invitrogen 10748–010 Chemical compound, drug TRIzol reagent Invitrogen 15596–018 Chemical compound, drug Mifepristone Cayman Chemical Company 10006317 Chemical compound, drug Methyl viologen dichloride hydrate (Paraquat) Sigma-Aldrich 856177 Chemical compound, drug ProSieve EX transfer buffer Lonza 00200309 Chemical compound, drug ProSieve EX running buffer Lonza 200307 Chemical compound, drug L-Glutathione reduced Sigma-Aldrich G6013-5G Chemical compound, drug Laemmli Sample Buffer Bio-Rad 1610737 Chemical compound, drug RIPA Cell Signaling 9806 Chemical compound, drug Protease Inhibitor Cocktail Tablets Roche 4693159001 Chemical compound, drug Idebenone Cayman Chemical Company 15475 Chemical compound, drug Mitoquinol Cayman Chemical Company 89950 Chemical compound, drug Nuclease-Free Water (not DEPC-Treated) Ambion, Inc AM9930 Chemical compound, drug 3,4-Dihydroxy-L-phenylalanine Millipore Sigma D9628 Chemical compound, drug Octopamine hydrochloride Millipore Sigma O0250 Chemical compound, drug RQ1 RNase-Free DNase Promega M6101 Chemical compound, drug Tyramine Sigma-Aldrich T90344 Commercial assay or kit 4–20% Mini-PROTEAN TGX Precast Protein Gels Bio-Rad 4561095 Commercial assay or kit pENTR/D-TOPO Cloning Kit Life Technologies K2400-20 Commercial assay or kit Gateway LR Clonase II Enzyme mix Invitrogen 11791–020 Genetic reagent (D. melanogaster) white RNAi (HMS00017) Bloomington Drosophila Stock Center # 33623 Genetic reagent (D. melanogaster) GFP RNAi (HMS00314) Perrimon’s lab Genetic reagent (D. melanogaster) CG1461 RNAi (HMC03212) Bloomington Drosophila Stock Center # 51470 Genetic reagent (D. melanogaster) CG1461 RNAi (HMS05690) Bloomington Drosophila Stock Center # 67830 Genetic reagent (D. melanogaster) CG1461 RNAi (HMS05877) Bloomington Drosophila Stock Center # 76065 Genetic reagent (D. melanogaster) Hgo RNAi (HMC03775) Bloomington Drosophila Stock Center # 55629 Genetic reagent (D. melanogaster) CG11796 RNAi (HMC03663) Bloomington Drosophila Stock Center # 52923 Genetic reagent (D. melanogaster) CG9762 RNAi (HMC06415) Bloomington Drosophila Stock Center # 67311 Genetic reagent (D. melanogaster) Sdhc RNAi (HMC03497) Bloomington Drosophila Stock Center # 53281 Genetic reagent (D. melanogaster) CG18809 RNAi (HMS04326) Bloomington Drosophila Stock Center # 56907 Genetic reagent (D. melanogaster) CG5548 RNAi (HM05255) Bloomington Drosophila Stock Center # 30511 Genetic reagent (D. melanogaster) NP15.6 RNAi (HMS01560) Bloomington Drosophila Stock Center # 36672 Genetic reagent (D. melanogaster) CG8680 RNAi (HMC03434) Bloomington Drosophila Stock Center # 51860 Genetic reagent (D. melanogaster) CG1970 RNAi (HMC04814) Bloomington Drosophila Stock Center # 57499 Genetic reagent (D. melanogaster) CG3214 RNAi (HMS01584) Bloomington Drosophila Stock Center # 36695 Genetic reagent (D. melanogaster) mtacp1 RNAi (HM05206) Bloomington Drosophila Stock Center # 29528 Genetic reagent (D. melanogaster) B3 Gift from Dr. Trudy Mackay Genetic reagent (D. melanogaster) O1 Gift from Dr. Trudy Mackay Genetic reagent (D. melanogaster) O3 Gift from Dr. Trudy Mackay Genetic reagent (D. melanogaster) OregonR Perrimon’s lab Genetic reagent (D. melanogaster) tubulinGal4; tubulinGal80ts Perrimon’s lab Genetic reagent (D. melanogaster) CG1461-mutant This paper Genetic reagent (D. melanogaster) Actin-GeneSwitch-Gal4 Gift from Dr. John Tower Genetic reagent (D. melanogaster) Whole body fat body – GeneSwitch – Gal4 Gift from Dr. John Tower Genetic reagent (D. melanogaster) TIGS-2 Gift from Dr. John Tower Genetic reagent (D. melanogaster) 3X Elav-GeneSwitch-Gal4 Gift from Dr. Scott Pletcher Genetic reagent (D. melanogaster) ElavGal4; tubulinGal80ts Perrimon’s lab Genetic reagent (D. melanogaster) UAS-dTsc1,Tsc2 Tapon et al., 2002 Genetic reagent (D. melanogaster) UAS-p60 Bloomington Drosophila Stock Center # 25899 Genetic reagent (D. melanogaster) UAS-Spargel Gift from Dr. David Walker Genetic reagent (D. melanogaster) GstD-GFP Gift from Dr. Dirk Bohmann Genetic reagent (D. melanogaster) CG1461-GFP-tagged VDRC stock center # 318640 Genetic reagent (D. melanogaster) GFP-CL1 Gift from Dr. Udai Pandey Genetic reagent (D. melanogaster) hsp22-GFP Gift from Dr. John Tower Genetic reagent (D. melanogaster) STAT92-GFP Bloomington Drosophila Stock Center # 26198 Genetic reagent (D. melanogaster) Drs-GFP Bloomington Drosophila Stock Center # 55707 Genetic reagent (D. melanogaster) Xbp1-GFP Bloomington Drosophila Stock Center # 60730 Genetic reagent (D. melanogaster) Syb-QF2; QUAS- α-synuclein Gift from Dr. Mel Feany Lifespan analysis For survival analysis, flies were collected within 24 hr from eclosion, sorted by sex under light CO2 anesthesia, and reared at standard density (20–25 flies per vial) on cornmeal/soy flour/yeast fly food at 25°C and 60% humidity with 12 hr on/off light cycle. Flies were transferred to fresh vials every 2 days and dead flies counted. RU486 dissolved in ethanol was administered in the media at the final concentration of 150 ug/mL. The following RNAi lines were used: white RNAi (HMS00017); GFP RNAi (HMS00314); CG1461/TAT/tyrosine aminotransferase RNAi [TAT-1 HMC03212 (weak), TAT-2 HMS05690 (strong), TAT-3 HMS05877 (strong)], Hgo RNAi (HMC03775), CG11796 RNAi (HMC03663), CG9762 RNAi (HMC06415), Sdhc RNAi (HMC03497), CG18809 RNAi (HMS04326), CG5548 RNAi (HM05255), NP15.6 RNAi (HMS01560), CG8680 RNAi (HMC03434), CG1970 RNAi (HMC04814), CG3214 RNAi (HMS01584), mtacp1 RNAi (HM05206). All lifespan counts are listed in the Supplementary file 1. qRT-PCR Total RNA was extracted with the TRIzol reagent (Life Technologies), followed by DNase digestion using RQ1 RNase-Free DNase (Promega). Total RNA was reverse transcribed with the iScript cDNA synthesis kit (Bio-Rad). qRT-PCR was performed with the iQ SYBR Green Supermix (Bio-Rad) and a CFX96 Real- Time PCR Detection System (Bio-Rad). RpL32 and alpha-Tubulin 84B were used as a normalization reference. Relative quantitation of mRNA levels was determined with the comparative CT method. Gene FlyPrimerBank ID Forward primer Reverse primer TAT PP16388 CGCTGTCCATTGGTGATCCC TGGCATACCCATTGTACTTGC TAT PP28777 GGCTCCAAGCTATCCCTTAACA CACCAATGGACAGCGGTATCA Faa PP37488 GGGATGTGGTAAGAAGCCAGA CTGTGGCACAATGGAAACCG Hgo PP36016 CTTCCATTCCAGCCCTTCAAG TTTCCATCCTTTGGAGGCAAG CG11796 PP24189 GGATTGCCCTCCACCAAGC CAGGATTCTCTCGTACCAGGA GstZ2 PP18005 CCGCGAGGTGAATCCAATG CTGGGGACGTGTTTCCTCC Hn PP19433 TGTTTTCGCCCAAGGATTCGT CACCAGGTTTATGTCATGCTTCT aSynuclein AAGAGGGTGTTCTCTATGTAGGC GCTCCTCCAACATTTGTCACTT Rp49 ATCGGTTACGGATCGAACAA GACAATCTCCTTGCGCTTCT Antibodies and immunoblot analyses A rabbit anti-GFP antibody was obtained from Abcam, and the anti-tubulin antibody from Sigma-Aldrich. For immunoblot analyses, 10 flies or 20 heads were grinded in bead beader in RIPA (Cell Signaling) lysis buffer with phosphatase and protease inhibitors (Roche). Whole-cell lysates were resolved by electrophoresis, and proteins were transferred onto PVDF membranes (Immobilon P; Millipore), blocked in Tris-buffered saline Tween-20 buffer (Cell Signaling Technology) containing 2.5% dry milk, and probed with the indicated antibodies diluted in this buffer. Statistical analysis Statistical analyses were performed in either JMP (SAS, Cary, NC, USA) or Excel. Metabolite profiling Ten to 20 flies per sample (four biological replicates) were collected and intracellular metabolites extracted using 80% (v/v) aqueous methanol. A 5500 QTRAP hybrid triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu) was used for steady-state analyses of the samples. Selected reaction monitoring (SRM) of 287 polar metabolites using positive/negative switching with HILIC chromatography was performed. Peak areas from the total ion current for each metabolite SRM transition were integrated using MultiQuant v2.1 software (AB/SCIEX). The resulting raw data from the MultiQuant software were analyzed using MetaboAnalyst (http://www.metaboanalyst.ca/MetaboAnalyst/). Quantification of neurotransmitters from fly heads Five fly heads per sample (three biological replicates) were homogenized in 190 μL of acidified acetone, 10 μL of 10 mM ascorbic acid and 1 μL of a 5 μg/mL mixture of the corresponding deuterated internal standards (CDN Isotopes, Quebec, Canada). The supernatants were collected, dried, and derivatized using in-house synthesized 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate (AQC). Sample cleanup was done using solid phase extraction (SPE) cartridges (Phenomenex, Inc Hyderabad, India). The eluted samples were completely dried before reconstitution in 2% acetonitrile with 0.5% formic acid and injection into the UHPLC ESI-MS. The liquid chromatography (LC) gradient and electro-spray ionization (ESI) conditions were as described in Ramesh and Brockmann, 2019. The calibration curves were made in neat solvents over a 32-fold concentration range. The highest concentration on column for the different compounds: Tyrosine 64 ng, DOPA 0.16 ng, Dopamine 1.6 ng, Tyramine 0.32 ng, Octopamine 1.6 ng, Histamine 3.2 ng, GABA 160 ng. Quantitation was done using the Xcalibur software (version 2.2 SP1.48). Neuron counts Neurons were counted according to the protocol developed by Ordonez et al., 2018; Olsen and Feany, 2019. Flies were fixed in formalin, embedded in paraffin, and 2 μm serial frontal sections were prepared through the entire fly brain. Slides were processed through xylene, ethanols, and into water and stained with hematoxylin. Images of the medulla brain region were taken at 40x magnification using the SPOT software. The neurons were counted and normalized to a pixel aspect ratio of 2.6 pixels/µm in the FIJI (ImageJ) software. For each fly genotype, six brains were imaged and analyzed. Funding Information This paper was supported by the following grants: http://dx.doi.org/10.13039/100000049National Institute on Aging K99/R00 AG057792 to Andrey A Parkhitko. http://dx.doi.org/10.13039/100000002National Institutes of Health 5P01CA120964 to Norbert Perrimon. http://dx.doi.org/10.13039/501100005879National Centre for Biological Sciences 12P4167 to Axel Brockmann. http://dx.doi.org/10.13039/100005366American Foundation for Aging Research to Norbert Perrimon. Acknowledgements We thank Trudy Mackay for providing the B3, O1 and O3 flies, John Tower for the GeneSwitch fly stocks and hsp22-GFP line, Scott Pletcher for providing the TIGS-2 and 3XElav Gene-Switch driver lines, David Walker for providing UAS-dPGC-1/Spargel line, Mel Feany for providing Syb-QF2; QUAS- α-synuclein line, Udai Pandey for GFP-CL1 line, Dirk Bohmann for GstD-GFP line. We thank Jay Hirsh for comments on measuring neurotransmitters and Kit Tuen for excellent technical assistance. We thank Stephanie Mohr for critical reading of the manuscript. We thank the TRiP at Harvard Medical School supported by NIH/NIGMS R01-GM084947 for providing transgenic RNAi lines and NCBS institutional fund to AB (12P4167) to support the quantification of neurotransmitters. This work was supported by NIA K99/R00 AG057792 (AP), 5P01CA120964 (NP) and AFAR (NP). NP is an investigator of the Howard Hughes Medical Institute. Additional information Competing interests No competing interests declared. Author contributions Conceptualization, Data curation, Formal analysis, Funding acquisition, Investigation, Writing - original draft, Writing - review and editing. Formal analysis, Investigation, Methodology. Investigation, Methodology. Investigation. Investigation. Investigation. Supervision, Methodology. Resources, Investigation, Methodology. Conceptualization. Conceptualization, Methodology. Supervision, Methodology. Conceptualization, Resources, Supervision, Funding acquisition, Project administration, Writing - review and editing. Additional files Supplementary file 1. Lifespan counts are recorded for all experiments. Transparent reporting form Data availability All data generated or analyzed during this study are included in the manuscript and supporting files. Additional metabolomics data are available in our previous publication (https://doi.org/10.1101/gad.282277.116). The following datasets were generated: 10.7554/eLife.58053.sa1 Decision letter Kapahi Pankaj Reviewing EditorBuck Institute for Research on AgingUnited States Kapahi Pankaj ReviewerBuck Institute for Research on AgingUnited States Walker David ReviewerUCLAUnited States In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses. Acceptance summary: This study demonstrates that aging and mitochondrial dysfunction upregulates the tyrosine degradation pathway and its downregulation extends lifespan. Parkhitko et al. demonstrate how reversing the age related increase in the tyrosine degradation enzyme, TAT, extends lifespan and enhances oxidative stress resistance. Decision letter after peer review: Thank you for submitting your article "Aging and mitochondrial dysfunction upregulate the tyrosine degradation pathway and its downregulation extends lifespan" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Pankaj Kapahi as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Jessica Tyler as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: David Walker (Reviewer #2). The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission. As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Summary: In "Aging and mitochondrial dysfunction upregulate the tyrosine degradation pathway and its downregulation extends lifespan," Parkhitko et al. demonstrate that reversing the age related increase in the tyrosine degradation enzyme, TAT, extends lifespan. They suggest that inhibition of ETC function, which changes with age, alters tyrosine metabolism. The scientific rationale of the study is novel and the study is technically well performed to support the hypothesis. However, there are a number of issues and questions could be addressed to make the study stronger. Reviewer #1: In "Aging and mitochondrial dysfunction upregulate the tyrosine degradation pathway and its downregulation extends lifespan," Parkhitko et al. demonstrate how reversing the age related increase in the tyrosine degradation enzyme, TAT, extends lifespan. The scientific rationale of the study is novel and the study is technically well performed to support the hypothesis. However, there are a few issues and questions could be addressed to make the study stronger. Figure 3 demonstrates that TAT knockdown in the neurons extends lifespan, and that whole body knockdown might not be as strong due to detrimental effects in other tissues. However, the later figures revert back to exploring the effects of TAT knockdown in whole body. As such, could the authors describe how Figures 4, 5 and 6E would be impacted with Elav-driven TAT RNAi in addition to whole body. In Figure 6 the authors put forward the hypothesis that aging and neurodegeneration can serve as a signal for the switch in tyrosine metabolism from production of neurotransmitters into the tyrosine degradation pathway to compensate for age-dependent functional decline, which would further aggravate mitochondrial dysfunction. However, several questions remain to be answered to validate this hypothesis. What happens to the ETC-I during normal aging in the long-lived flies shown in Figure 1? Are the ETC-I -RNAi flies short lived? There are fly studies with opposite effects too. Importantly for this study, can this shortening be rescued by increasing tyr levels and knockdown of TAT. Does loss of ETC-I cell-autonomously drive TAT expression? The final figure claims a link of TAT activity to neurodegeneration and PD, which is an interesting aspect of the study that would broaden its significance. Could the authors support their findings by examining neurodegeneration in WT and PD strains to support these arguments. I have concerns about the tigecycline results as it is also known to cause mitochondrial dysfunction and oxidative stress. Furthermore, several assays described above need to be done with tigecycline thus I suggest to remove it from this study unless it can be supported further. Reviewer #2: This is a very interesting new paper from Parkhitko et al. The major strength of the work is the use of an unbiased “omics” approach to identify a novel pathway (Tyrsosine degradation) relevant to aging and lifespan determination in Drosophila. The findings outlined in the paper will be of interest to a general readership and will likely inspire additional work in this new area. In terms of potential experimental limitations to the work, it seems that the authors have not provided an "RU486 control" for any of the experimental work. This is potentially important as the Tower and Ja labs have reported that depending upon the food used and RU conc. used there can be unpredictable effects of RU feeding on fly longevity. e.g., J Gerontol A Biol Sci Med Sci. 2017 Feb;72(2):173-180. Hence, it is strongly advised to include the following control for longevity studies: control strain/GS Driver line +/- RU (same conc. as used with transgene of interest). I note, however, that the authors tested several RNAi lines and not all produced positive effects. Therefore, the observed effects are unlikely due to RU feeding alone. In addition, it is always sensible to assay food intake in the context of longevity-promoting interventions. This also seems to be missing from the study, which could complicate interpretation of the findings. Suggested edits and perceived impact of the work: In an ideal world (without a pandemic), at least some of the suggestions below could be addressed with experiments. But, given current events, these issues could be further discussed in the manuscript: It is interesting and potentially informative that Tyrosine levels go up in long-lived flies. This may reflect a midlife increase, with “midlife” being a different chronological age in different genetic backgrounds. Presumably, even in long-lived strains tyrosine levels decrease in late life? Can the genetic interventions reported prolong lifespan when the interventions are started in mid- or even late-life? If so, this would significantly increase the perceived impact of the work. The relationship with ETC knockdown and tyrosine degradation is interesting. The authors report that ETC knockdown (mito dysfunction) phenocopies aging. However, as the authors note in the Introduction: moderate ETC knockdown can prolong lifespan in flies (Copeland et al.,; Owusu-Ansah et al.) and worms. Different outcomes (lifespan extensions vs lifespan shortening) are likely a question of timing and level of knock-down and this may be worth discussing further. On face value, however, this appears paradoxical. Hence, more discussion may benefit the readers. The work showing that tigecycline prevents activation of the tyrosine degradation pathway, upon mito dysfunction, is an additional strength of the paper. However, it raises an obvious follow up question: can tigecycline be used to treat aging WT flies in a similar manner? If so, this would significantly increase the impact of the work. If the drug could be used to slow aging/prolong lifespan upon treatment of aged WT flies. Can the drug rescue the decrease in tyrosine levels in WT aged flies? Reviewer #3: Parkhitko studies the impact of TAT on lifespan, metabolites and reporter phenotypes. The work contrasts metabolomic profiles of the Rose "B" and "O" lines and shows different age patterns of tyrosine among the lines. This leads to a putative tyrosine aminotransferase (TAT/CG1461). Lifespan is extended when TAT is reduced in adults. The authors record many correlated phenotypes of TAT RNAi flies, ranging from metabolomics to neurotransmitters. They find inhibition of mitochondrial ETC increases tyrosine degradation elements. Some data are indeed interesting but conclusions on mechanisms of aging are overly extrapolated and untested. The work has substantial problems in terms of inference, design and scientific rigor. Summary of substantive concerns: 1) Comparing the "B" and "O" lines is difficult to interpret – issues explained years back by many authors but here unaware. Fundamentally, the B lines are not “unselected controls”. Before Rose, they were strongly selected for precocious development and reproductive schedule, and they also accumulated substantial mutational load for genes expressed soon after eclosion. The O lines swept out the load and selected back toward a normal reproductive schedule. Traits among the lines can show age-dependent differences but have no bearing on aging. 2) It is not sufficient to measure only two ages. That tyrosine increases between 1 and 4w in O lines (or 1 and 5w in OreR) is incomplete. Perhaps tyrosine increases until 2w then declines thereafter, yet is higher at 4w than at 1w. Aging is a progressive function. 3) O lines ramp up fecundity only after a few weeks. The B lines start from eclosion. It is quite possible that tyrosine metabolism reflects reproductive activity, not progress of somatic aging. 4) We need to see the absolute amount of tyrosine at 1 and 4w for each B and O line. Using “relative amount” obscures. 5) In many places the paper generates correlative data but packages interpretations as causality. For instance, no data establish "downregulation of TAT causes metabolic reprogramming by affecting mitochondrial/antioxidant pro-longevity metabolic factors". The data show that downregulation of TAT induces metabolic changes, some of which are associated with “mitochondrial/antioxidant factors”. The work does not establish TAT acts through mitochondria to cause the observed metabolic changes, or that this affects aging. Overall, the work requires epistasis analyses. 6) It is interesting to show that inhibition of ETC upregulates TAT mRNA (and other components), which can be rescued by a drug to block ETC damage. No data establish a role for ETC via tyrosine metabolism to extend survival. Likewise, to “test how mechanistically downregulation of TAT extends lifespan” only measures stress GFP reporters, not lifespan. 7) The neuropeptide work is incomplete. Here, is the drug assimilated? If not, a negative effect is meaningless. Yet, L-DOPA does improve survival. The “marginal and significant” but “much weaker” (subjective call) survival increase is actually within the range of the TAT RNAi data, if we can interpret the survival plot with its poor dynamics. And the drug study was not replicated. These data do not rule out a role of elevated L-DOPA. 8) There are many inconsistent uses of which RNAi strain, driver, and gender combinations to make any one point. Why, or what data is not being shown? 10.7554/eLife.58053.sa2 Author response The scientific rationale of the study is novel and the study is technically well performed to support the hypothesis. However, there are a number of issues and questions could be addressed to make the study stronger. Reviewer #1: In "Aging and mitochondrial dysfunction upregulate the tyrosine degradation pathway and its downregulation extends lifespan," Parkhitko et al. demonstrate how reversing the age related increase in the tyrosine degradation enzyme, TAT, extends lifespan. The scientific rationale of the study is novel and the study is technically well performed to support the hypothesis. However, there are a few issues and questions could be addressed to make the study stronger. Figure 3 demonstrates that TAT knockdown in the neurons extends lifespan, and that whole body knockdown might not be as strong due to detrimental effects in other tissues. However, the later figures revert back to exploring the effects of TAT knockdown in whole body. As such, could the authors describe how Figures 4, 5 and 6E would be impacted with Elav-driven TAT RNAi in addition to whole body. Based on our model, we propose that downregulation of TAT prevents redirection of tyrosine from the degradation pathway to the production of neuromediators, and inhibition of this redirection in neuronal cells is enough to extend lifespan. However, these neuromediators could have pro-health and pro-longevity effects throughout the whole body. In Figure 4, we demonstrate that whole-body driven TAT knockdown causes wholebody metabolic changes associated with increased lifespan. In Figure 5, we demonstrate that TAT mutant flies have increased levels of neuromediators, and in Figure 6 we demonstrate that whole-body knockdown of ETC components upregulates levels of enzymes in the tyrosine degradation pathway. To address the reviewer’s question, we measured the levels of neurotransmitters in heads of flies with neuronal-specific Elav-Gal4-driven TAT downregulation. Neuronal-specific downregulation of TAT in combination with supplementation of tyrosine causes upregulation of dopa and octopamine. We have not detected significantly increased levels of either tyramine or dopamine potentially due to degradation of tyrosine in non-neuronal tissues. Similarly, neuronal-specific downregulation of TAT caused the upregulation of tyrosine and metabolic reprogramming similar to whole-body downregulation of TAT. We detected several metabolites (tyrosine, glucosamine, methylcysteine, and NADH) that were commonly and significantly altered as a result of whole-body-driven and neuronal-specific downregulation of TAT. In contrast, neuronal-specific inhibition of mETC Complex I has not resulted in the whole-body upregulation of TAT or other enzymes in the tyrosine degradation pathway. Based on our model, mitochondrial dysfunction leads to the redirection of tyrosine metabolism into the tyrosine degradation pathway that causes alteration in the production of neuromediators, and neuromediators cause nonautonomous effects on other tissues in the organism. It is also possible, that mitochondrial dysfunction can reprogram tyrosine metabolism in other organs non-autonomously, an issue that would be interesting to investigate in follow up studies. In Figure 6 the authors put forward the hypothesis that aging and neurodegeneration can serve as a signal for the switch in tyrosine metabolism from production of neurotransmitters into the tyrosine degradation pathway to compensate for age-dependent functional decline, which would further aggravate mitochondrial dysfunction. However, several questions remain to be answered to validate this hypothesis. What happens to the ETC-I during normal aging in the long-lived flies shown in Figure 1? In our original manuscript we demonstrated that inhibition of other ETC complexes also caused the upregulation of the enzymes in the tyrosine degradation pathway but the effect of ETC-I inhibition was the strongest. Although it is unknown how the activity of mETC complex I is changed with age in neuronal cells in flies, complex I activity declines with age in both rodents and human in different organs including the brain that we now mention. We also added additional references demonstrating that bypass of ETC-1 extends lifespan and similar to our studies it had a neuronal-specific effect. Regarding a comparison of ETC function in B and O flies, we cannot perform this experiment as we do not have the original flies any longer. These flies that we originally received from Dr. Trudy Mackay were maintained under special selection regimen (kept in population cages and only eggs from 1 month old flies would be transferred to fresh cages to prevent selection for fast reproduction) and are no longer available as the MacKay lab did not maintain them under this special selection regimen. Are the ETC-I -RNAi flies short lived? There are fly studies with opposite effects too. Importantly for this study, can this shortening be rescued by increasing tyr levels and knockdown of TAT. This is a very context-dependent question. We describe in the Introduction that downregulation of components of ETC extends Drosophila lifespan (Copeland et al.). Moreover, in the Copeland et al. paper downregulation of CG9762 extends lifespan and we demonstrate that downregulation of CG9762 upregulates mRNA levels of TAT. However, there are also Drosophila models of Complex I deficiency that are characterized by decreased lifespan. In addition, bypass of Complex I via overexpression of Ndi1 has been shown to extend Drosophila lifespan. Also, in worms, suppression of ETC extends lifespan only under very specific circumstances including timing of treatment and strength of knockdown. In the Copeland et al. paper, the authors used the da-GS-Gal4 driver, while in our study we used tubulin-Gal4, tubulin-Gal80ts driver. The two studies are quite different, especially as GeneSwitch drivers are in general weaker and mosaic. We discussed these differences in the Discussion. We used tubulin-Gal4, tubulin-Gal80ts driver to suppress Complex I via expression of NP15.6 RNAi and maintained flies at different concentrations of tyrosine. Downregulation of NP15.6 strongly decreased lifespan in females but had a weaker effect in males. Feeding flies with different concentrations of tyrosine partially rescued their decreased lifespan. Interestingly, these gender-specific differences correlate with sex-specific differences in expression of the components of the tyrosine degradation pathway. Does loss of ETC-I cell-autonomously drive TAT expression? In worms, octopamine mediates cell-nonautonomous effects of AMPK/calcineurin-mediated longevity (Burkewitz et al.) and ETC knockdown in neurons affects mitochondrial homeostasis in distal tissues (Durieux et al.). It is a great area for the future investigations whether ETC downregulation and tyrosine metabolism alterations interact via cell-autonomous or cell-nonautonomous mechanisms. We have not detected wholebody upregulation of TAT or other enzymes in the tyrosine degradation pathway as a result of neuronal-specific inhibition of mETC Complex I. However, it does not exclude the possibility of non-autonomous interactions between inhibition of mETC Complex I and the regulation of the tyrosine degradation pathway. The final figure claims a link of TAT activity to neurodegeneration and PD, which is an interesting aspect of the study that would broaden its significance. Could the authors support their findings by examining neurodegeneration in WT and PD strains to support these arguments. To address the reviewer’s comment we performed histology on control and PD flies with control or three different TAT RNAi lines. As expected, expression of α-Synuclein caused strong neurodegeneration and loss of neurons. However, downregulation of TAT did not prevent the neuronal loss. α-Synuclein expression potentially causes extensive reprogramming of metabolism and it may require targeting of multiple metabolic pathways to prevent neurodegeneration. I have concerns about the tigecycline results as it is also known to cause mitochondrial dysfunction and oxidative stress. Furthermore, several assays described above need to be done with tigecycline thus I suggest to remove it from this study unless it can be supported further. We expect the tigecycline effects (similar to inhibition of Complex I of ETC) to be very context/time dependent. For example, tigecycline has been shown to have very different effects between normal and cancer cells. To address whether tigecycline causes upregulation of the markers of mitochondrial dysfunction, we tested several markers of mitochondrial stress by qRT-PCR, CLPX, HSP10, HSP60, and HSP22. The concentration and duration of tigecycline that prevents upregulation of TAT does not cause upregulation of markers of mitochondrial dysfunction. Reviewer #2: This is a very interesting new paper from Parkhitko et al. The major strength of the work is the use of an unbiased “omics” approach to identify a novel pathway (Tyrsosine degradation) relevant to aging and lifespan determination in Drosophila. The findings outlined in the paper will be of interest to a general readership and will likely inspire additional work in this new area. In terms of potential experimental limitations to the work, it seems that the authors have not provided an "RU486 control" for any of the experimental work. This is potentially important as the Tower and Ja labs have reported that depending upon the food used and RU conc. used there can be unpredictable effects of RU feeding on fly longevity. e.g., J Gerontol A Biol Sci Med Sci. 2017 Feb;72(2):173-180. Hence, it is strongly advised to include the following control for longevity studies: control strain/GS Driver line +/- RU (same conc. as used with transgene of interest). I note, however, that the authors tested several RNAi lines and not all produced positive effects. Therefore, the observed effects are unlikely due to RU feeding alone. In addition, it is always sensible to assay food intake in the context of longevity-promoting interventions. This also seems to be missing from the study, which could complicate interpretation of the findings. We tested all GeneSwitch lines crossed to control strains in our previous paper (Parkhitko et al., 2016). In this paper, we also tested and published that doubling of the concentration of RU486 does not affect the lifespan in our hands. Suggested edits and perceived impact of the work: In an ideal world (without a pandemic), at least some of the suggestions below could be addressed with experiments. But, given current events, these issues could be further discussed in the manuscript: It is interesting and potentially informative that Tyrosine levels go up in long-lived flies. This may reflect a midlife increase, with “midlife” being a different chronological age in different genetic backgrounds. Presumably, even in long-lived strains tyrosine levels decrease in late life? We agree with this statement. We included only 1w and 4w flies because we wanted to avoid the actively dying state. The goal was only to get potential metabolic pathways as candidates for lifespan extension. Can the genetic interventions reported prolong lifespan when the interventions are started in mid- or even late-life? If so, this would significantly increase the perceived impact of the work. We agree that it would have a strong translational impact. We added this to the text. However, one caveat is that GeneSwitch Gal4 lines may not be as active later in life as in the beginning (based on unpublished discussions with other people in aging field), which could make the interpretation of results difficult. The relationship with ETC knockdown and tyrosine degradation is interesting. The authors report that ETC knockdown (mito dysfunction) phenocopies aging. However, as the authors note in the Introduction: moderate ETC knockdown can prolong lifespan in flies (Copeland et al.,; Owusu-Ansah et al.) and worms. Different outcomes (lifespan extensions vs lifespan shortening) are likely a question of timing and level of knock-down and this may be worth discussing further. On face value, however, this appears paradoxical. Hence, more discussion may benefit the readers. We expanded this part in the Discussion. See also comments to reviewer #1. The work showing that tigecycline prevents activation of the tyrosine degradation pathway, upon mito dysfunction, is an additional strength of the paper. However, it raises an obvious follow up question: can tigecycline be used to treat aging WT flies in a similar manner? If so, this would significantly increase the impact of the work. If the drug could be used to slow aging/prolong lifespan upon treatment of aged WT flies. Can the drug rescue the decrease in tyrosine levels in WT aged flies? It is an interesting question. Tigecycline is a mitochondrial translation inhibitor. We do not expect that long-term treatment with tigecycline would prolong lifespan because of prolonged mitochondrial stress – an issue also raised by reviewer #1. In the timeframe that we used to treat flies control flies and flies with inhibition of ETC CI we did not observe activation of markers of mitochondrial stress. However, it would be a great separate project to study how inhibition of mitochondrial translation interplays with aging and production of neuromediators. Reviewer #3: Parkhitko studies the impact of TAT on lifespan, metabolites and reporter phenotypes. The work contrasts metabolomic profiles of the Rose "B" and "O" lines and shows different age patterns of tyrosine among the lines. This leads to a putative tyrosine aminotransferase (TAT/CG1461). Lifespan is extended when TAT is reduced in adults. The authors record many correlated phenotypes of TAT RNAi flies, ranging from metabolomics to neurotransmitters. They find inhibition of mitochondrial ETC increases tyrosine degradation elements. Some data are indeed interesting but conclusions on mechanisms of aging are overly extrapolated and untested. The work has substantial problems in terms of inference, design and scientific rigor. Summary of substantive concerns: 1) Comparing the "B" and "O" lines is difficult to interpret – issues explained years back by many authors but here unaware. Fundamentally, the B lines are not “unselected controls”. Before Rose, they were strongly selected for precocious development and reproductive schedule, and they also accumulated substantial mutational load for genes expressed soon after eclosion. The O lines swept out the load and selected back toward a normal reproductive schedule. Traits among the lines can show age-dependent differences but have no bearing on aging. We used these lines only to get a list of candidate metabolic pathways that can potentially be relevant to aging. Next, we used this information to validate changes in levels of enzymes belonging to the tyrosine degradation pathway in wild-type flies, flies with inhibition of ETC CI, and in flies with downregulation of enzymes belonging to the tyrosine degradation pathway. 2) It is not sufficient to measure only two ages. That tyrosine increases between 1 and 4w in O lines (or 1 and 5w in OreR) is incomplete. Perhaps tyrosine increases until 2w then declines thereafter, yet is higher at 4w than at 1w. Aging is a progressive function. We decided to choose these two time points because in both B and O lines 100% of the flies are still alive. We did not aim to use metabolomics to explain differences between these strains; our goal was only to get potential candidates for testing in wild-type flies. In addition, we could only run a limited number of samples at the given time and our metabolomics platform does not allow combining results from independent runs. We agree that it could be an interesting and independent project to characterize age-dependent metabolic changes in these lines. 3) O lines ramp up fecundity only after a few weeks. The B lines start from eclosion. It is quite possible that tyrosine metabolism reflects reproductive activity, not progress of somatic aging. As mentioned above, we expanded the analysis of the tyrosine degradation pathway to fly lines that are independent of B/O lines. 4) We need to see the absolute amount of tyrosine at 1 and 4w for each B and O line. Using “relative amount” obscures. This point was also raised by another reviewer. Unfortunately, the commercially available kits did not work in our hands on fly samples and we don’t have these lines anymore. 5) In many places the paper generates correlative data but packages interpretations as causality. For instance, no data establish "downregulation of TAT causes metabolic reprogramming by affecting mitochondrial/antioxidant pro-longevity metabolic factors". The data show that downregulation of TAT induces metabolic changes, some of which are associated with “mitochondrial/antioxidant factors”. The work does not establish TAT acts through mitochondria to cause the observed metabolic changes, or that this affects aging. Overall, the work requires epistasis analyses. We agree with this but did not want to over-interpret the data. We only stated that downregulation of TAT causes metabolic alterations that are known to be associated with increased lifespan. We agree that epistatic analysis would be very helpful but because GeneSwitch lines are in general weak Gal4 drivers, we did not want to use them for the longevity experiments in flies. In addition, we and others found that the addition of extra UAS constructs dilutes Gal4 and can weaken phenotypes making results difficult to interpret, in addition of mixing genetic backgrounds. 6) It is interesting to show that inhibition of ETC upregulates TAT mRNA (and other components), which can be rescued by a drug to block ETC damage. No data establish a role for ETC via tyrosine metabolism to extend survival. Likewise, to “test how mechanistically downregulation of TAT extends lifespan” only measures stress GFP reporters, not lifespan. To partially address this comment, we tested how downregulation of one of the components of ETC Complex I that causes strong upregulation of TAT affects the lifespan and whether these changes can be rescued by supplementing tyrosine. 7) The neuropeptide work is incomplete. Here, is the drug assimilated? If not, a negative effect is meaningless. Yet, L-DOPA does improve survival. The “marginal and significant” but “much weaker” (subjective call) survival increase is actually within the range of the TAT RNAi data, if we can interpret the survival plot with its poor dynamics. And the drug study was not replicated. These data do not rule out a role of elevated L-DOPA. We fed flies with concentrations of drugs that have been previously reported to rescue genetic defects associated with production of these neurotransmitters and we used concentrations reported in these publications. We agree that insufficient rescue can still be related to poor drug uptake, drug instability, etc.,. We expanded the Discussion on these potential caveats. The drug study was done on a sufficient number of flies to detect even small changes and lifespans are performed in multiple vials independently and the data on survival are combined. 8) There are many inconsistent uses of which RNAi strain, driver, and gender combinations to make any one point. Why, or what data is not being shown? In general, we use GeneSwitch lines to perform lifespans and TubulinGal4/ElavGal4,Gal80ts lines to perform biochemical analysis because GeneSwitch lines are mosaic and weaker. For the metabolomics analysis, we could run only a limited number of samples and cannot combine results from separate runs. Due to this limitation, we performed metabolomics only for female flies. Because the mitochondrial dysfunction and CI inhibition results originated from the metabolomics studies, we performed CI inhibition experiments on female flies. We have not shown data on multiple sensors to prevent overcrowding the figures but since another reviewer also requested this we have now added the missing data. ==== Refs References Area-Gomez E Guardia-Laguarta C Schon EA Przedborski S 2019 Mitochondria, OxPhos, and neurodegeneration: cells are not just running out of gas Journal of Clinical Investigation 129 34 45 10.1172/JCI120848 30601141 Avanesov AS Ma S Pierce KA Yim SH Lee BC Clish CB Gladyshev VN 2014 Age- and diet-associated metabolome remodeling characterizes the aging process driven by damage accumulation eLife 3 e02077 10.7554/eLife.02077 24843015 Bach EA Ekas LA Ayala-Camargo A Flaherty MS Lee H Perrimon N Baeg GH 2007 GFP reporters detect the activation of the Drosophila JAK/STAT pathway in vivo Gene Expression Patterns 7 323 331 10.1016/j.modgep.2006.08.003 17008134 Bahadorani S Cho J Lo T Contreras H Lawal HO Krantz DE Bradley TJ Walker DW 2010 Neuronal expression of a single-subunit yeast NADH-ubiquinone oxidoreductase (Ndi1 ) extends Drosophila lifespan Aging Cell 9 191 202 10.1111/j.1474-9726.2010.00546.x 20089120 Bai H Kang P Tatar M 2012 Drosophila insulin-like peptide-6 (dilp6 ) expression from fat body extends lifespan and represses secretion of Drosophila insulin-like peptide-2 from the brain Aging Cell 11 978 985 10.1111/acel.12000 22935001 Bai H Kang P Hernandez AM Tatar M 2013 Activin signaling targeted by insulin/dFOXO regulates aging and muscle proteostasis in Drosophila PLOS Genetics 9 e1003941 10.1371/journal.pgen.1003941 24244197 Balan V Miller GS Kaplun L Balan K Chong Z-Z Li F Kaplun A VanBerkum MFA Arking R Freeman DC Maiese K Tzivion G 2008 Life span extension and neuronal cell protection by Drosophila nicotinamidase Journal of Biological Chemistry 283 27810 27819 10.1074/jbc.M804681200 Banderet LE Lieberman HR 1989 Treatment with tyrosine, a neurotransmitter precursor, reduces environmental stress in humans Brain Research Bulletin 22 759 762 10.1016/0361-9230(89)90096-8 2736402 Broughton SJ Piper MD Ikeya T Bass TM Jacobson J Driege Y Martinez P Hafen E Withers DJ Leevers SJ Partridge L 2005 Longer lifespan, altered metabolism, and stress resistance in Drosophila from ablation of cells making insulin-like ligands PNAS 102 3105 3110 10.1073/pnas.0405775102 15708981 Burkewitz K Zhang Y Mair WB 2014 AMPK at the nexus of energetics and aging Cell Metabolism 20 10 25 10.1016/j.cmet.2014.03.002 24726383 Burkewitz K Morantte I Weir HJM Yeo R Zhang Y Huynh FK Ilkayeva OR Hirschey MD Grant AR Mair WB 2015 Neuronal CRTC-1 governs systemic mitochondrial metabolism and lifespan via a catecholamine signal Cell 160 842 855 10.1016/j.cell.2015.02.004 25723162 Carnes MU Campbell T Huang W Butler DG Carbone MA Duncan LH Harbajan SV King EM Peterson KR Weitzel A Zhou S Mackay TF 2015 The genomic basis of postponed senescence in Drosophila melanogaster PLOS ONE 10 e0138569 10.1371/journal.pone.0138569 26378456 Clancy DJ Gems D Harshman LG Oldham S Stocker H Hafen E Leevers SJ Partridge L 2001 Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein Science 292 104 106 10.1126/science.1057991 11292874 Copeland JM Cho J Lo T Hur JH Bahadorani S Arabyan T Rabie J Soh J Walker DW 2009 Extension of Drosophila life span by RNAi of the mitochondrial respiratory chain Current Biology 19 1591 1598 10.1016/j.cub.2009.08.016 19747824 Deijen JB Orlebeke JF 1994 Effect of tyrosine on cognitive function and blood pressure under stress Brain Research Bulletin 33 319 323 10.1016/0361-9230(94)90200-3 8293316 Dollins AB Krock LP Storm WF Wurtman RJ Lieberman HR 1995 L-tyrosine ameliorates some effects of lower body negative pressure stress Physiology & Behavior 57 223 230 10.1016/0031-9384(94)00278-D 7716196 During MJ Acworth IN Wurtman RJ 1988 Effects of systemic L-tyrosine on dopamine release from rat corpus striatum and nucleus accumbens Brain Research 452 378 380 10.1016/0006-8993(88)90043-1 3401745 Ferguson AA Roy S Kormanik KN Kim Y Dumas KJ Ritov VB Matern D Hu PJ Fisher AL 2013 TATN-1 mutations reveal a novel role for tyrosine as a metabolic signal that influences developmental decisions and longevity in Caenorhabditis elegans PLOS Genetics 9 e1004020 10.1371/journal.pgen.1004020 24385923 Ferrandon D Jung AC Criqui M Lemaitre B Uttenweiler-Joseph S Michaut L 1998 A drosomycin-GFP reporter transgene reveals a local immune response in Drosophila that is not dependent on the Toll pathway The EMBO Journal 17 1217 1227 10.1093/emboj/17.5.1217 9482719 Foriel S Renkema GH Lasarzewski Y Berkhout J Rodenburg RJ Smeitink JAM Beyrath J Schenck A 2019 A Drosophila mitochondrial complex I deficiency phenotype array Frontiers in Genetics 10 245 10.3389/fgene.2019.00245 30972103 Fridell YW Sánchez-Blanco A Silvia BA Helfand SL 2005 Targeted expression of the human uncoupling protein 2 (hUCP2) to adult neurons extends life span in the fly Cell Metabolism 1 145 152 10.1016/j.cmet.2005.01.005 16054055 Fuchs S Bundy JG Davies SK Viney JM Swire JS Leroi AM 2010 A metabolic signature of long life in Caenorhabditis elegans BMC Biology 8 14 10.1186/1741-7007-8-14 20146810 Giannakou ME Goss M Jacobson J Vinti G Leevers SJ Partridge L 2007 Dynamics of the action of dFOXO on adult mortality in Drosophila Aging Cell 6 429 10.1111/j.1474-9726.2007.00290.x 17465980 Gibson CJ Wurtman RJ 1978 Physiological control of brain norepinephrine synthesis by brain tyrosine concentration Life Sciences 22 1399 1405 10.1016/0024-3205(78)90633-1 672404 Gómez LA Hagen TM 2012 Age-related decline in mitochondrial bioenergetics: does supercomplex destabilization determine lower oxidative capacity and higher superoxide production? Seminars in Cell & Developmental Biology 23 758 767 10.1016/j.semcdb.2012.04.002 22521482 Gray LR Tompkins SC Taylor EB 2014 Regulation of pyruvate metabolism and human disease Cellular and Molecular Life Sciences 71 2577 2604 10.1007/s00018-013-1539-2 24363178 Grönke S Clarke DF Broughton S Andrews TD Partridge L 2010 Molecular evolution and functional characterization of Drosophila insulin-like peptides PLOS Genetics 6 e1000857 10.1371/journal.pgen.1000857 20195512 Hoffman JM Soltow QA Li S Sidik A Jones DP Promislow DE 2014 Effects of age, sex, and genotype on high-sensitivity metabolomic profiles in the fruit fly, Drosophila melanogaster Aging Cell 13 596 604 10.1111/acel.12215 24636523 Horvath S Pirazzini C Bacalini MG Gentilini D Di Blasio AM Delledonne M Mari D Arosio B Monti D Passarino G De Rango F D'Aquila P Giuliani C Marasco E Collino S Descombes P Garagnani P Franceschi C 2015 Decreased epigenetic age of PBMCs from italian semi-supercentenarians and their offspring Aging 7 1159 1170 10.18632/aging.100861 26678252 Hu Y Flockhart I Vinayagam A Bergwitz C Berger B Perrimon N Mohr SE 2011 An integrative approach to ortholog prediction for disease-focused and other functional studies BMC Bioinformatics 12 357 10.1186/1471-2105-12-357 21880147 Kabil H Kabil O Banerjee R Harshman LG Pletcher SD 2011 Increased transsulfuration mediates longevity and dietary restriction in Drosophila PNAS 108 16831 16836 10.1073/pnas.1102008108 21930912 Kapahi P Zid BM Harper T Koslover D Sapin V Benzer S 2004 Regulation of lifespan in Drosophila by modulation of genes in the TOR signaling pathway Current Biology 14 885 890 10.1016/j.cub.2004.03.059 15186745 Laye MJ Tran V Jones DP Kapahi P Promislow DE 2015 The effects of age and dietary restriction on the tissue-specific metabolome of Drosophila Aging Cell 14 797 808 10.1111/acel.12358 26085309 Lee BC Kaya A Ma S Kim G Gerashchenko MV Yim SH Hu Z Harshman LG Gladyshev VN 2014 Methionine restriction extends lifespan of Drosophila melanogaster under conditions of low amino-acid status Nature Communications 5 3592 10.1038/ncomms4592 24710037 Legan SK Rebrin I Mockett RJ Radyuk SN Klichko VI Sohal RS Orr WC 2008 Overexpression of Glucose-6-phosphate Dehydrogenase Extends the Life Span of Drosophila melanogaster Journal of Biological Chemistry 283 32492 32499 10.1074/jbc.M805832200 Liu X Liu M Tang C Xiang Z Li Q Ruan X Xiong K Zheng L 2018 Overexpression of nmnat improves the adaption of health span in aging Drosophila Experimental Gerontology 108 276 283 10.1016/j.exger.2018.04.026 29727704 Liu YJ Janssens GE McIntyre RL Molenaars M Kamble R Gao AW Jongejan A Weeghel MV MacInnes AW Houtkooper RH 2019 Glycine promotes longevity in Caenorhabditis elegans in a methionine cycle-dependent fashion PLOS Genetics 15 e1007633 10.1371/journal.pgen.1007633 30845140 Lock E Ranganath LR Timmis O 2014 The role of nitisinone in tyrosine pathway disorders Current Rheumatology Reports 16 457 10.1007/s11926-014-0457-0 25266991 López-Otín C Blasco MA Partridge L Serrano M Kroemer G 2013 The hallmarks of aging Cell 153 1194 1217 10.1016/j.cell.2013.05.039 23746838 Mair W Piper MDW Partridge L 2005 Calories do not explain extension of life span by dietary restriction in Drosophila PLOS Biology 3 e223 10.1371/journal.pbio.0030223 16000018 McClung C Hirsh J 1999 The trace amine tyramine is essential for sensitization to cocaine in Drosophila Current Biology 9 853 860 10.1016/S0960-9822(99)80389-3 10469593 Miller RA Harrison DE Astle CM Bogue MA Brind J Fernandez E Flurkey K Javors M Ladiges W Leeuwenburgh C Macchiarini F Nelson J Ryazanov AG Snyder J Stearns TM Vaughan DE Strong R 2019 Glycine supplementation extends lifespan of male and female mice Aging Cell 18 e12953 10.1111/acel.12953 30916479 Milman S Barzilai N 2016 Dissecting the mechanisms underlying unusually successful human health span and life span Cold Spring Harbor Perspectives in Medicine 6 a025098 10.1101/cshperspect.a025098 Milner JD Wurtman RJ 1986 Catecholamine synthesis: physiological coupling to precursor supply Biochemical Pharmacology 35 875 881 10.1016/0006-2952(86)90071-7 2869759 Mitchell SJ Bernier M Aon MA Cortassa S Kim EY Fang EF Palacios HH Ali A Navas-Enamorado I Di Francesco A Kaiser TA Waltz TB Zhang N Ellis JL Elliott PJ Frederick DW Bohr VA Schmidt MS Brenner C Sinclair DA Sauve AA Baur JA de Cabo R 2018 Nicotinamide improves aspects of Healthspan, but not lifespan, in mice Cell Metabolism 27 667 676 10.1016/j.cmet.2018.02.001 29514072 Monastirioti M Linn CE White K 1996 Characterization of Drosophila tyramine beta-hydroxylase gene and isolation of mutant flies lacking octopamine The Journal of Neuroscience 16 3900 3911 8656284 Mourikis P Hurlbut GD Artavanis-Tsakonas S 2006 Enigma, a mitochondrial protein affecting lifespan and oxidative stress response in Drosophila PNAS 103 1307 1312 10.1073/pnas.0510564103 16434470 Olsen AL Feany MB 2019 Glial alpha-synuclein promotes neurodegeneration characterized by a distinct transcriptional program in vivo Glia 67 1933 1957 10.1002/glia.23671 31267577 Ooka H Segall PE Timiras PS 1988 Histology and survival in age-delayed low-tryptophan-fed rats Mechanisms of Ageing and Development 43 79 98 10.1016/0047-6374(88)90099-1 3374178 Ordonez DG Lee MK Feany MB 2018 α-synuclein induces mitochondrial dysfunction through spectrin and the actin cytoskeleton Neuron 97 108 124 10.1016/j.neuron.2017.11.036 29249285 Osterwalder T Yoon KS White BH Keshishian H 2001 A conditional tissue-specific transgene expression system using inducible GAL4 PNAS 98 12596 12601 10.1073/pnas.221303298 11675495 Owusu-Ansah E Song W Perrimon N 2013 Muscle mitohormesis promotes longevity via systemic repression of insulin signaling Cell 155 699 712 10.1016/j.cell.2013.09.021 24243023 Oxenkrug G Navrotskaya V Vorobyova L Summergrad P 2012 Minocycline effect on life and health span of Drosophila melanogaster Aging and Disease 3 352 23185716 Pandey UB Nie Z Batlevi Y McCray BA Ritson GP Nedelsky NB Schwartz SL DiProspero NA Knight MA Schuldiner O Padmanabhan R Hild M Berry DL Garza D Hubbert CC Yao T-P Baehrecke EH Taylor JP 2007 HDAC6 rescues neurodegeneration and provides an essential link between autophagy and the UPS Nature 447 860 864 10.1038/nature05853 Parkhitko AA Binari R Zhang N Asara JM Demontis F Perrimon N 2016 Tissue-specific down-regulation of S-adenosyl-homocysteine via suppression of dAhcyL1/dAhcyL2 extends health span and life span in Drosophila Genes & Development 30 1409 1422 10.1101/gad.282277.116 27313316 Parkhitko AA Jouandin P Mohr SE Perrimon N 2019 Methionine metabolism and methyltransferases in the regulation of aging and lifespan extension across species Aging Cell 18 e13034 10.1111/acel.13034 31460700 Parkhitko AA Filine E Mohr SE Moskalev A Perrimon N 2020 Targeting metabolic pathways for extension of lifespan and healthspan across multiple species Ageing Research Reviews 64 101188 10.1016/j.arr.2020.101188 33031925 Piper MD 2017 Using artificial diets to understand the nutritional physiology of Drosophila melanogaster Current Opinion in Insect Science 23 104 111 10.1016/j.cois.2017.07.014 29129274 Poirier L Shane A Zheng J Seroude L 2008 Characterization of the Drosophila Gene-Switch system in aging studies: a cautionary tale Aging Cell 7 758 770 10.1111/j.1474-9726.2008.00421.x 18691185 Post S Karashchuk G Wade JD Sajid W De Meyts P Tatar M 2018 Drosophila Insulin-Like peptides DILP2 and DILP5 differentially stimulate cell signaling and glycogen phosphorylase to regulate longevity Frontiers in Endocrinology 9 245 10.3389/fendo.2018.00245 29892262 Post S Liao S Yamamoto R Veenstra JA Nässel DR Tatar M 2019 Drosophila insulin-like peptide dilp1 increases lifespan and glucagon-like akh expression epistatic to dilp2 Aging Cell 18 e12863 10.1111/acel.12863 30511458 Ramesh D Brockmann A 2019 Mass spectrometric quantification of arousal associated neurochemical changes in single honey bee brains and brain regions ACS Chemical Neuroscience 10 1950 1959 10.1021/acschemneuro.8b00254 30346719 Ravichandran M Priebe S Grigolon G Rozanov L Groth M Laube B Guthke R Platzer M Zarse K Ristow M 2018 Impairing L-Threonine Catabolism Promotes Healthspan through Methylglyoxal-Mediated Proteohormesis Cell Metabolism 27 914 925 10.1016/j.cmet.2018.02.004 29551589 Rea SL Ventura N Johnson TE 2007 Relationship between mitochondrial electron transport chain dysfunction, development, and life extension in Caenorhabditis elegans PLOS Biology 5 e259 10.1371/journal.pbio.0050259 17914900 Rera M Bahadorani S Cho J Koehler CL Ulgherait M Hur JH Ansari WS Lo T Jones DL Walker DW 2011 Modulation of longevity and tissue homeostasis by the Drosophila PGC-1 homolog Cell Metabolism 14 623 634 10.1016/j.cmet.2011.09.013 22055505 Rhooms SK Murari A Goparaju NSV Vilanueva M Owusu-Ansah E 2020 Insights from Drosophila on mitochondrial complex I Cellular and Molecular Life Sciences 77 607 618 10.1007/s00018-019-03293-0 31485716 Riemensperger T Isabel G Coulom H Neuser K Seugnet L Kume K Iché-Torres M Cassar M Strauss R Preat T Hirsh J Birman S 2011 Behavioral consequences of dopamine deficiency in the Drosophila central nervous system PNAS 108 834 839 10.1073/pnas.1010930108 21187381 Roman G Endo K Zong L Davis RL 2001 P[Switch], a system for spatial and temporal control of gene expression in Drosophila melanogaster PNAS 98 12602 12607 10.1073/pnas.221303998 11675496 Ross JM Oberg J Brene S Coppotelli G Terzioglu M Pernold K Goiny M Sitnikov R Kehr J Trifunovic A Larsson N-G Hoffer BJ Olson L 2010 High brain lactate is a hallmark of aging and caused by a shift in the lactate dehydrogenase A/B ratio PNAS 107 20087 20092 10.1073/pnas.1008189107 21041631 Sanz A Soikkeli M Portero-Otín M Wilson A Kemppainen E McIlroy G Ellilä S Kemppainen KK Tuomela T Lakanmaa M Kiviranta E Stefanatos R Dufour E Hutz B Naudí A Jové M Zeb A Vartiainen S Matsuno-Yagi A Yagi T Rustin P Pamplona R Jacobs HT 2010 Expression of the yeast NADH dehydrogenase Ndi1 in Drosophila confers increased lifespan independently of dietary restriction PNAS 107 9105 9110 10.1073/pnas.0911539107 20435911 Sarov M Barz C Jambor H Hein MY Schmied C Suchold D Stender B Janosch S K J VV Krishnan RT Krishnamoorthy A Ferreira IR Ejsmont RK Finkl K Hasse S Kämpfer P Plewka N Vinis E Schloissnig S Knust E Hartenstein V Mann M Ramaswami M VijayRaghavan K Tomancak P Schnorrer F 2016 A genome-wide resource for the analysis of protein localisation in Drosophila eLife 5 e12068 10.7554/eLife.12068 26896675 Scott CR 2006 The genetic tyrosinemias American Journal of Medical Genetics Part C: Seminars in Medical Genetics 142C 121 126 10.1002/ajmg.c.30092 Shao Y Le W 2019 Recent advances and perspectives of metabolomics-based investigations in Parkinson’s disease Molecular Neurodegeneration 14 3 10.1186/s13024-018-0304-2 30634989 Shen J Curtis C Tavaré S Tower J 2009 A screen of apoptosis and senescence regulatory genes for life span effects when over-expressed in Drosophila Aging 1 191 211 10.18632/aging.100018 20157509 Shukitt-Hale B Stillman MJ Lieberman HR 1996 Tyrosine administration prevents hypoxia-induced decrements in learning and memory Physiology & Behavior 59 867 871 10.1016/0031-9384(95)02107-8 8778879 Shurtleff D Thomas JR Schrot J Kowalski K Harford R 1994 Tyrosine reverses a cold-induced working memory deficit in humans Pharmacology Biochemistry and Behavior 47 935 941 10.1016/0091-3057(94)90299-2 8029265 Sinadinos C Valles-Ortega J Boulan L Solsona E Tevy MF Marquez M Duran J Lopez-Iglesias C Calbó J Blasco E Pumarola M Milán M Guinovart JJ 2014 Neuronal glycogen synthesis contributes to physiological aging Aging Cell 13 935 945 10.1111/acel.12254 25059425 Stenesen D Suh JM Seo J Yu K Lee KS Kim JS Min KJ Graff JM 2013 Adenosine nucleotide biosynthesis and AMPK regulate adult life span and mediate the longevity benefit of caloric restriction in flies Cell Metabolism 17 101 112 10.1016/j.cmet.2012.12.006 23312286 Sujkowski A Ramesh D Brockmann A Wessells R 2017 Octopamine drives endurance exercise adaptations in Drosophila Cell Reports 21 1809 1823 10.1016/j.celrep.2017.10.065 29141215 Sykiotis GP Bohmann D 2008 Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila Developmental Cell 14 76 85 10.1016/j.devcel.2007.12.002 18194654 Tapon N Harvey KF Bell DW Wahrer DC Schiripo TA Haber D Hariharan IK 2002 Salvador promotes both cell cycle exit and apoptosis in Drosophila and is mutated in human Cancer cell lines Cell 110 467 478 10.1016/S0092-8674(02)00824-3 12202036 Tomás-Loba A Bernardes de Jesus B Mato JM Blasco MA 2013 A metabolic signature predicts biological age in mice Aging Cell 12 93 101 10.1111/acel.12025 23107558 Topall G Laborit H 1989 Brain tyrosine increases after treating with prodrugs: comparison with tyrosine Journal of Pharmacy and Pharmacology 41 789 791 10.1111/j.2042-7158.1989.tb06368.x 2576051 Ulgherait M Rana A Rera M Graniel J Walker DW 2014 AMPK modulates tissue and organismal aging in a non-cell-autonomous manner Cell Reports 8 1767 1780 10.1016/j.celrep.2014.08.006 25199830 van de Rest O Bloemendaal M de Heus R Aarts E 2017 Dose-Dependent effects of oral tyrosine administration on plasma tyrosine levels and cognition in aging Nutrients 9 1279 10.3390/nu9121279 Wang MC Bohmann D Jasper H 2003 JNK signaling confers tolerance to oxidative stress and extends lifespan in Drosophila Developmental Cell 5 811 816 10.1016/S1534-5807(03)00323-X 14602080 Wassef R Haenold R Hansel A Brot N Heinemann SH Hoshi T 2007 Methionine sulfoxide reductase A and a dietary supplement S-methyl-L-cysteine prevent parkinson's-like symptoms Journal of Neuroscience 27 12808 12816 10.1523/JNEUROSCI.0322-07.2007 18032652 Weimer S Priebs J Kuhlow D Groth M Priebe S Mansfeld J Merry TL Dubuis S Laube B Pfeiffer AF Schulz TJ Guthke R Platzer M Zamboni N Zarse K Ristow M 2014 D-Glucosamine supplementation extends life span of Nematodes and of ageing mice Nature Communications 5 3563 10.1038/ncomms4563 24714520 Wisnovsky S Lei EK Jean SR Kelley SO 2016 Mitochondrial Chemical Biology: New Probes Elucidate the Secrets of the Powerhouse of the Cell Cell Chemical Biology 23 917 927 10.1016/j.chembiol.2016.06.012 27478157 Wood JG Schwer B Wickremesinghe PC Hartnett DA Burhenn L Garcia M Li M Verdin E Helfand SL 2018 Sirt4 is a mitochondrial regulator of metabolism and lifespan in Drosophila melanogaster PNAS 115 1564 1569 10.1073/pnas.1720673115 29378963 Woods SK Meyer JS 1991 Exogenous tyrosine potentiates the methylphenidate-induced increase in extracellular dopamine in the nucleus accumbens: a microdialysis study Brain Research 560 97 105 10.1016/0006-8993(91)91220-U 1760749 Yang J Tower J 2009 Expression of hsp22 and hsp70 transgenes is partially predictive of Drosophila survival under normal and stress conditions The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 64A 828 838 10.1093/gerona/glp054 Yesavage JA Holman CA Sarnquist FH Berger PA 1982 Elevation of cerebrospinal fluid lactate with aging in subjects with normal blood oxygen saturations Journal of Gerontology 37 313 315 10.1093/geronj/37.3.313 7069154 Yu Z Zhai G Singmann P He Y Xu T Prehn C Römisch-Margl W Lattka E Gieger C Soranzo N Heinrich J Standl M Thiering E Mittelstraß K Wichmann HE Peters A Suhre K Li Y Adamski J Spector TD Illig T Wang-Sattler R 2012 Human serum metabolic profiles are age dependent Aging Cell 11 960 967 10.1111/j.1474-9726.2012.00865.x 22834969 Yuan Y Kadiyala CS Ching TT Hakimi P Saha S Xu H Yuan C Mullangi V Wang L Fivenson E Hanson RW Ewing R Hsu AL Miyagi M Feng Z 2012 Enhanced energy metabolism contributes to the extended life span of calorie-restricted Caenorhabditis elegans Journal of Biological Chemistry 287 31414 31426 10.1074/jbc.M112.377275 22810224