==== Front J Immunol Res J Immunol Res JIR Journal of Immunology Research 2314-8861 2314-7156 Hindawi 10.1155/2020/1039458 Research Article Defects at the Posttranscriptional Level Account for the Low TCRζ Chain Expression Detected in Gastric Cancer Independently of Caspase-3 Activity Aguinaga-Barrilero Ana 1 Castro-Sánchez Patricia 1 Juárez Ignacio 1 Gutiérrez-Calvo Alberto 2 Rodríguez-Pérez Noelia 1 Lopez Adela 2 Gómez Remedios 2 https://orcid.org/0000-0002-2436-8585Martin-Villa José M. jmmvilla@ucm.es 1 3 1Inmunología, Facultad de Medicina, Universidad Complutense de Madrid, Madrid, Spain 2Servicio de Cirugía General y Aparato Digestivo, Hospital Universitario Príncipe de Asturias, Alcalá de Henares, Madrid, Spain 3Instituto de Investigación Sanitaria Gregorio Marañón (IISGM), Madrid, Spain Academic Editor: Paulina Wlasiuk 2020 28 11 2020 2020 103945814 5 2020 10 11 2020 12 11 2020 Copyright © 2020 Ana Aguinaga-Barrilero et al.2020This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background Reduced TCRζ chain surface has been reported in T cells from patients with different inflammatory conditions and cancer. However, the causes of this diminished expression in cancer remain elusive. Methods T cell-enriched populations of blood or tissue (tumoral and nontumoral) origin from 44 patients with gastric adenocarcinoma and 33 healthy subjects were obtained. Samples were subjected to cytofluorimetry, Western blot analysis, TCRζ cDNA sequencing experiments, measurement of TCRζ mRNA levels, and caspase-3 activity assays. Results Cytofluorimetry revealed a decreased TCRζ expression in T cells of patients, assessed either as percentage of cells expressing this chain (blood: control subjects 99.8 ± 0.1%, patients 98.8 ± 1.1%P < 0.001; tissue: control subjects 96.7 ± 0.9%, patients tumoral tissue 67.9 ± 27.0%, patients nontumoral tissue 82.8 ± 12.6%, P = 0.019) or mean fluorescence intensity (MFI) value (blood: control subjects 102.2 ± 26.0; patients 58.0 ± 12.3, P = 0.001; tissue: control subjects 99.4 ± 21.4; patients tumoral tissue 41.6 ± 21.4; patients nontumoral tissue 62.3 ± 16.6, P = 0.001). Other chains pertaining to the TCR-CD3 complex (CD3ε) showed no significant differences (MFI values). Subsequent TCRζ cDNA sequencing experiments or measurements of TCRζ mRNA levels disclosed no differences between patients and control subjects. Evaluation of caspase-3 activity showed higher levels in T cell extracts of patients, and this activity could be decreased by 70% with the use of the inhibitor Ac-DEVD-FMK, although CD3ζ expression levels did not recover. Conclusions These results further place the defect responsible for the low TCRζ expression in cancer at the posttranscriptional level and suggests contrary to what has been proposed in other pathologies that elevated caspase-3 activity is not the causative agent. Universidad Complutense de MadridFondo de Investigación SanitariaPI18/00626PI12/01663 ==== Body 1. Introduction Tumoral antigens expressed upon neoplastic transformation may be targets of cells of the immune system, such as T lymphocytes. In fact, tumor-specific T cells are found in the circulation of patients with cancer [1], or infiltrating the tumor tissue (tumor-infiltrating lymphocytes, TIL), exerting immunosurveillance functions [2]. Recent immunotherapeutic approaches to cancer and tumour dissemination have focused on limiting physiological T cell inactivation (via CD80-CTLA4 or PD1-PDL1 interactions) to enhance T cell activation to tumoral cells [3]. To accomplish this task, T cells require fully functional signaling machinery, able to detect the presence of “de novo” antigens and carry out an adequate response. However, several phenotypic or functional T cell alterations have been described in patients with cancer, and, therefore, T cells are unable to keep tumoral cells at bay [4]. Downregulation of T cell receptor- (TCR-) associated cell surface proteins, such as TCRζ (CD247) [5], is one of such alterations. This downregulation was found not only in cancer but also in other inflammatory conditions, as systemic lupus erythematosus, (SLE [6, 7]) amongst others. The TCRζ chain is a 16 kDa protein expressed by NK, NKT, and T cells and contains a long cytoplasmic tail with three immunoreceptor tyrosine-based activation motifs (ITAM). It is involved in signal transduction and is crucial for the correct function of T lymphocytes [8], and therefore, its downregulation certainly limits the ability of T cells to respond to tumor antigens. The causes whereby T cells from patients express low TCRζ levels remain unclear, and several mechanisms have been proposed: lysosomal degradation [9], alternative mRNA splicing [10], presence of peroxide metabolites [11], Fas-FasL interactions [12], or increased caspase-3 activity [7]. Our group previously suggested that the defect seemed inherent to T cells, since Herpesvisrus saimiri- (HVS-) transformed T cell lines, grown in vitro for several months, maintained this TCRζ defective expression [13–16]. We wished to confirm this defect in freshly isolated T cells of blood and gastric origin from patients with gastric adenocarcinoma. Once the TCRζ expression was assessed, TCRζ cDNA sequencing and measurement of TCRζ mRNA levels were carried out. Furthermore, caspase-3 activity was also quantitated in the absence or presence of the caspase inhibitor Ac-DEVD-FMK, to determine whether the defect could be placed at the genomic, transcriptional, or posttranscriptional level. 2. Material and Methods 2.1. Patients Forty-four patients with gastric adenocarcinoma, classified according to the Japanese Research Society for Gastric Cancer criteria [17] were included in this study. Patients (30 men, 14 women, median age: 67 yrs. range 42 yrs.-89 yrs.) were submitted by the Department of General Surgery (Servicio de Cirugía General y Aparato Digestivo) of the Hospital Príncipe de Asturias, Alcalá de Henares. As a control group, blood samples were obtained from nineteen healthy unrelated individuals (10 men, 9 women, mean age: 28 yrs. range 24 yrs-50 yrs) who were included. In addition, blood and tissue samples were obtained from further 14 individuals (5 men; 9 women; median age: 48 yrs. range 30–61) who underwent gastric surgery for reasons other than cancer (morbid obesity). 2.2. Preparation of Blood Samples Blood from patients was drawn on the day of surgery using EDTA-containing tubes, prior to any manipulation of the patient. Purified T cells were isolated from the blood samples using a T cell enrichment cocktail (RosetteSep, Stem Cell technologies), following manufacturer's indications. In brief, 20 mL whole blood was incubated with 500 μL of the above reagent for 20 minutes at room temperature. Then, the suspension was subjected to centrifugation (45 min, 900 g) on a lymphoprep cushion, and T cells were isolated at the interphase and washed twice with phosphate-buffered saline (PBS). T cell purity achieved was always higher than 95%. 2.3. Preparation of Tissue Samples Tissue samples were obtained upon surgery and transported to the laboratory in RPMI 1640 medium with antibiotic and minced in a Petri dish with HBSS in 0.5 cm fragments and treated with DTT for 30 minutes with gentle agitation. After two washing steps with PBS, samples were treated for further 40 minutes with HBSS 1 mM EDTA. Supernatant, rich in intraepithelial lymphocytes, was then collected and kept on ice until use. Next, to isolate lamina propria lymphocytes, pieces were washed with PBS to eliminate DTT and EDTA and subjected to collagenase digestion (50 U/mL in RPMI) for 90 minutes at 37°C with gentle agitation. Suspensions thus obtained, along with the cells previously kept on ice, were filtered through a 70 μm mesh and washed twice. Then, cells were layered onto a Percoll gradient (20%-44%-67%) and centrifuged. Lymphocytes were collected at the 44%-67% interphase and washed twice with PBS. Finally, a T cell enrichment step was carried out using a Pan T cell isolation kit (MiltenyiBiotec). T cell enriched populations thus obtained were used for cytometry, mRNA isolation, cDNA sequencing, or quantitative RT-PCR (qRT-PCR) or caspase-3 activity experiments. Blood and tissue samples from control subjects were treated likewise. 2.4. Flow Cytometry CD3ε (surface) and TCRζ (intracellular) expression was assessed by flow cytometry. The analysis of the expression of TCRζ was done using two different monoclonal antibodies. Purified T cells (2 × 105) were incubated with an APC-conjugated CD3ε-specific monoclonal antibody (clone UCHT1, BD) for 30 min at 4°C, washed twice, and treated with Cellfix solution (Becton Dickinson) for 10 min at 4°C. Cells were then permeabilized with 0.5% BSA-0.1% saponin in PBS and incubated either with a primary unconjugated (clone G3, Serotec) or a FITC-conjugated (clone 6B10.2, BioLegend) TCRζ-specific monoclonal antibody for 30 min at room temperature (RT). After two washing steps with permeabilization solution, cells were either resuspended in FACS flow or, when required, incubated with a secondary polyclonal anti-mouse FITC-conjugated antibody (Serotec) for further 30 minutes in the dark. Finally, and after two further washing steps, cells were resuspended in Facs Flow (Becton Dickinson). Isotype-matched monoclonal antibodies were used as negative controls in all cases. A minimum of 50000 cells were analyzed per sample and gated to exclude nonviable cells. Fluorescence intensities above the upper limit of the negative control distribution were considered positive. In Figure 1, representative dot plots and histograms of CD3ζ gating and MFI analysis are shown. 2.5. Western Blot Enriched T cells (5 × 106) of blood origin were used. Cells were pelleted and resuspended in 50 μL of lysis buffer supplemented with protease inhibitors, 5 mM NaF, 0.2 mM sodium vanadate, and 1 mM phenylmethylsulfonyl fluoride (PMSF) for two hours on ice. Then, the suspension was centrifuged at 14000 rpm for 5 minutes, and the supernatant collected. 40 μg of protein extract were boiled (100°C, 5 min) and resolved on a 12% polyacrylamide gel in reducing conditions (100 V, 90 min) and transferred (30 V, 60 min) onto a polyvinylidene fluoride (PDVF) membrane. Membrane was then blocked in nonfat milk, followed by incubation with a primary monoclonal antibody (Santa Cruz) TCRζ- or a CD3ε-specific (overnight incubation, 4°C). After several washing steps, membranes were incubated with a goat anti-mouse horseradish peroxidase- (HRP-) conjugated secondary antibody (Santa Cruz) and developed with ECL reagents. Bands were quantitated by densitometry and the optical density (OD) of the TCRζ band normalized against the CD3ε band (used as a load control protein) for each sample. 2.6. RNA and DNA Extraction RNA and DNA extraction from purified T cells was achieved using TRIzol reagent (Invitrogren). This reagent allows sequential purification of RNA and then DNA from a single sample. 2.7. cDNA Sequencing Total RNA was retrotranscribed to cDNA using the First-Strand cDNA synthesis kit (Roche). TCRζ-specific cDNA amplification was then carried out. To amplify the whole cDNA transcript, five pairs of primers were used (see Table 1). Amplification conditions were as follows: 94°C 5 minutes; 94°C 30 seconds; 55°C 30 seconds; 72°C 30 seconds (35 cycles); final extension step 72°C 10 minutes. PCR products were run in an agarose gel, eluted from the gel (Quiagen Elute Gel extraction kit 250), and sequenced in the DNA sequencing facility of the CSIC, Madrid (Secugen). Analysis of the sequences obtained was done using the Chromalite Software (v2.0.1 Technelysium Pty Ltd) and compared to already deposited sequences at the NCBI database. 2.8. TCRζ-mRNA Expression Levels Total RNA was treated with DNAase (Ambion) to achieve DNA-free RNA sample, and it was then retrotranscribed to cDNA, as before. mRNA levels were measured (at the Genomic Unit, Parque Científico de Moncloa, UCM) by qRT-PCR using a TaqMan Gene Expression assay kit and TCRζ-specific primers (Applied Biosystems). As reference, and to normalize TCRζ levels, 18S rRNA amplification was also carried out. 2.9. Measurement of Caspase-3 Activity Caspase-3 activity was measured in blood T lymphocytes with the Caspase-3 Cellular Assay Kit PLUS (Enzo Life Sciences) following manufacturer's instructions. The assay is based on the cleavage of the substrate DEVD bound to the chromophore p-nitroanilide (pNA) by caspase-3. Briefly, cells were lysed, and lysates (10 μL) were incubated with the substrate DEVD-pNa (200 μM) at 37°C. Caspase-3 activity was measured by reading the absorbance (at 405 nm) of the samples every 15 minutes for 90 min. Lysate protein content was determined by Bradford assay, and caspase-3-specific activity was calculated as pmol of p-Na produced per minute per μg of protein (pmol p-Na/min/μg protein). To assess the specificity of the assay, caspase-3 was inhibited by incubating the cells for 8 hours in a CO2 incubator with the inhibitor Z-Asp-Glu-Val-Asp-FMK (DEVD, Calbiochem) 50 μM prior to lysis, and caspase-3 activity was measured as before. 2.10. Statistical Analysis Results obtained are shown as mean value ± standard deviation (s.d.). Mann-Whitney U-test was used to carry out comparisons between patient and control groups, with the SPSS (19.0 version) software. In experiments where more than two groups were compared, Kruskal-Wallis test followed by post hoc test for pairwise comparison of subgroups, using the MedCalc software. A P value less than 0.05 was considered significant. 3. Results 3.1. Flow Cytometry 3.1.1. Blood-Derived T Cells Purified T cells were obtained from 21 patients and 28 control subjects. The percentage of T cells expressing TCRζ rose to 99.8 ± 0.1% in control subjects and 98.8 ± 1.1% in patients (P < 0.05). When MFI values are considered TCRζ, MFI is significantly reduced in patients (102.2 ± 26.0 vs. 58.0 ± 12.3; P = 0.01). This lower MFI was found on both CD4+ and CD8+ T cells, showing that the defect affects all T cells and is not lineage-specific. As for the CD3ε MFI value, we detected just a minor, not significant, reduction in the level of the CD3ε chain on the cell surface in gastric cancer compared to healthy subjects. Thus, TCRζ is reduced in T cells from patients with cancer. This impaired expression does not affect other constituents of the T cell receptor (TCR) complex, such as CD3ε. 3.1.2. Mucosa-Derived T Cells TCRζ and CD3ε expression was also analyzed in tissue-derived (tumoral or nontumoral) T lymphocytes from patients with gastric cancer (n = 5) and control individuals (n = 5) subjected to surgery for reasons other than cancer. The percentage of TCRζ-expressing cells is significantly diminished (Kruskall-Wallis test P = 0.019) in tumoral tissue-derived T cells from patients (67.9 ± 27.0%) when compared to nontumoral tissue-derived cells from patients (82.8 ± 12.6%) or to control subjects (96.7 ± 0.9%). With regard to TCRζ MFI value, it is lower (Kruskall-Wallis test P = 0.001) in T cells from patients, irrespective of their anatomical location, whether tumoral (41.6 ± 21.4) or nontumoral (62.3 ± 16.6), when compared to control subjects (99.4 ± 21.4). As before, CD3ε showed no significant differences. Due to scarcity of tissue-derived T cells, the remaining experiments (Western blot, cDNA and mRNA analysis, and caspase-3 activity) were done only in T cells of blood origin. However, we may assume that the results obtained can confidently be extrapolated to tissue T lymphocytes based on the flow cytometry data. 3.1.3. Western Blot TCRζ expression was also analyzed by Western blot. Figure 2 shows the results obtained with 11 patients (not previously analyzed by flow cytometer) and 4 healthy subjects. In some patients (see P3, P6, P7, and P8), low TCRζ levels were clearly observed, with a TCRζ/CD3ε ratio below 0.3, whereas some other patients yielded results comparable to the ones obtained with control subjects. These results mirror flow cytometry data in that TCRζ expression is defective in some, but not all, patients. 3.1.4. cDNA Sequence cDNA was obtained and sequenced in patients (n = 14) or healthy individuals (n = 8), to assess whether genomic differences could account for the defective TCRζ expression (Table 2). Nine single-nucleotide polymorphisms (SNPs) were found. Six of them were already described (with no known relation to function, although, interestingly, the 1572 G to A transition is found in eleven of twelve patients and in three of five control subjects), whereas three new ones are reported in the present work: a C to T transition in position 373 and a G to A transition in positions 856 and 1542 (GenBank accession numbers EF364117, EF364118, and EF364119, respectively). The TAC to TAT transversion yields a synonymous change and will not influence TCRζ levels. The remaining two are in the noncoding region of the gene (3′-UTR). Targetscan software analysis revealed that the latter (position 1542) could be target of miRNA MiR6832-5p and potentially modulate the posttranscriptional regulation of the gene. The elucidation of the functional relevance of these SNPs merits further consideration, increasing the number of patients studied. 3.1.5. TCRζ mRNA Levels To assess whether TCRζ mRNA levels mirrored the decreased protein expression found, qRT-PCR was carried out to measure specific TCRζ mRNA levels. Mann-Whitney test disclosed no difference between the group of patients (n = 19; 0.58) and healthy individuals (n = 18; 0.99 p N.S., data not shown). 3.1.6. Caspase-3 Activity Since elevated caspase-3 activity has been involved in low TCRζ expression in other pathologies (SLE), we measured this enzymatic activity in cell extracts. Patients (n = 6) showed higher activity (2.97 ± 1.9 pmol p-Na/min/μg protein) than control subjects (n = 5, 1.02 ± 0.5 pmol p-Na/min/μg protein, P = 0.009). Moreover, the use of the caspase-3 inhibitor Ac-DEVD-FMK in T cells of patients reduced by 70% the activity of the enzyme (P < 0.05 Wilcoxon test). However, TCRζ expression was not recovered, suggesting that additional mechanisms must be involved in this expression defect. 4. Discussion T lymphocytes are crucial to maintain cancerous progression in check [18], and defective cells will poorly carry out this task. The immune system tries to control tumor proliferation. T cells primed with tumoral antigens initiate a response aiming at eliminating tumoral cells (immunosurveillance). In this process, however, T cell activation is physiologically controlled (immune checkpoints), and this immunosuppression can promote tumor progression. In fact, cancer immunotherapy aiming at checkpoint inhibitors has gained support in recent years [19]. Low expression of the TCRζ chain has been reported in several types of cancer, including head and neck cancer [20], ovarian carcinoma [21], renal cell carcinoma [22], prostate [23], colorectal carcinoma [24], melanoma [25], oral cancer [9], and, in the present work, gastric carcinoma. We have measured the presence of this chain in enriched T cell populations and observed that the values obtained were consistently lower in patients. Thus, the percentage of TCRζ-expressing cells was reduced in patients with cancer, as compared to healthy subjects, along with a significantly reduced MFI expression on the surface of T lymphocytes. This is true for blood- and tissue-derived T cells and is consistent with results obtained using different TCRζ-specific monoclonal antibodies (results not shown). Regarding the TCRζ expression in tissue-derived T cells from patients, two aspects merit further comment. First, the levels achieved were always lower than the ones obtained in their blood-derived counterparts, assessed either as percentage or as MFI values. This decrease was even more pronounced in T cells eluted from tumoral specimens. A similar finding was previously reported by our group [14]. Secondly, when compared to tissue-derived cells from healthy subjects instead, the protein expression level was consistently lower in patients, irrespective of the origin, tumoral or nontumoral, of the pieces used to isolate T cells. It is then clear that in patients, the expression of the TCRζ chain is decreased, more in tissue than in blood and more in cancerous than in noncancerous regions of the tissue. Western blot analysis (Figure 2) supports the cytometric results, as weaker bands are observed in the lanes corresponding to patients. Our results match previous published data [26] that also reported diminished expression of this protein in the peripheral blood of some, but not all, gastric cancer patients, especially in patients with advanced disease. Given the size of our cohort, no sound statistical comparisons could be done if the group were split according to clinical status. Although there are slight age differences between our groups of patients and healthy subjects, published work state that age differences between patients and control subjects does not affect CD3ζ expression levels. Thus, we can confidently accept the results obtained [27]. It remains unclear how this defective expression takes place in these cells, and two main types of mechanisms have been proposed: either a genetic defect underlies it or an exogenous substance (such as arginase or a tumor-derived factor) is the causative agent. However, this substance has not been clearly identified, though some reports have been published [21]. Since previous data from our group suggested that this defective expression could be inherent to the T cells of patients [15] it seemed adequate to study the TCRζ cDNA sequence in patients and compare it to healthy subjects. Most of the sequences obtained matched already published sequences, although three new polymorphisms (see Table 2) were found, whose frequency, however, did not differ between the two groups studied. Thus, no genomic TCRζ defect seems then responsible for this defective TCRζ expression in patients. We described a 9pb deletion in the 3′-UT region of the TCRζ gene [28] in between two adenisone-uridine rich elements (AREs), in a patient with cutaneous angiosarcoma and gastric metastases. Interestingly, and according to http://www.targetscan.org/, this 9 bp sequence acts as potential target of two miRNAs (hsa-miRNA-767 and hsa-miRNA-4470), thus likely affecting protein expression [29]. Given the relevance of this region in the mRNA stability and, thus TCRζ protein expression, this deletion may affect protein levels. In our cohort, only one of the patients and none of the control subjects analyzed presented this deletion. Since no differences were found in the cDNA sequence, we then decided to test whether differences in the mRNA levels could explain our findings. However, qRT-PCR revealed no significant differences in the level of TCRζ mRNA between patients and control subjects. Given that no changes in the mRNA molecule have been found (both the sequence and the levels are normal in the group of patients), and that our group [14] disclosed no differences in the promoter region of the gene, we felt that no further genomic (DNA) analysis (intron sequencing) was required. We then went on analyzing caspase-3 activity, involved by some authors in low TCRζ expression [6, 7]. In keeping with previous published data, our results revealed higher enzymatic activity in T cells from patients when compared to control subjects, activity which could be diminished (by 70%) using the Ac-DEVD-FMK inhibitor. However, and to some extent unexpectedly, CD3ζ expression does not recover in patients upon treatment with the inhibitor. Altogether, these data seem to locate at the posttranscriptional level the defect responsible for the altered CD3ζ expression. Nevertheless, and according to the data herein presented, caspase-3 activity does not account for it, and further research is then required to unveil the mechanism linked to this CD3ζ low expression. These results also resemble those published by Kulkarni et al. [9] in patients with oral cancer. They reported low TCRζ expression in T cells, whether of blood origin or located at the tumor site. In the latter, this low expression was clearly due to transcriptional problems, whereas in the former, posttranslational problems accounted for the defect. Likewise, it has been reported in ovarian carcinoma that TCRζ expression in T cells depended on the proximity to the tumoral mass [30]: when T cells were isolated from ascites fluid or peripheral blood, neither TCRζ nor the corresponding mRNA transcript was affected, whereas in solid tumor infiltrating T lymphocytes both, the protein and the mRNA were absent. Our group reported similar findings: stable gastric mucosa-derived T cell lines (HVS-transformed) displayed lower chain expression than peripheral blood derived T cell line [13]. Similarly, we show here that the loss of TCRζ expression is more prominent in tissue-derived T cells (and more so in tumor sections) than in blood T cells, when compared to corresponding samples from control individuals. Unfortunately, caspase-3 activity was not tested in T lymphocytes of tissue origin, due to scarcity of samples. Diminished expression of TCRζ might affect the surface expression of the whole TCR-CD3 complex, since TCRζ is the limiting factor in the assembly process [31], and it is then be conceivable to find a reduced CD3ε expression. In fact, published work [32] using immunoprecipitation of multiprotein complexes followed by flow cytometry (IP-FCM) revealed that a decreased TCRζ expression affected the integrity of the TCR-CD3 complex. Previous reports revealed that TCR complexes lacking the TCRζ chain are more rapidly endocytosed than full TCR complexes. TCRζ seems then to stabilize the TCR complex on the cell surface [33]. However, and in keeping with other published data [34, 35], we detected just a minor reduction in the level of the CD3ε chain on the cell surface, a reduction that did not reach significance. Moreover, Western blot analysis (which detects total protein amount and not just membrane-bound) showed that in patients with low TCRζ levels, CD3ε expression was like that of healthy individuals, indicating that its biosynthesis is not affected. Interestingly, previous analysis carried out on NK cells from SLE patients [6] revealed a diminished expression of CD3ζ with no effect on other molecules such as NKp30 and NKp46, which also signal via CD3ζ. There are, however, some discrepancies in the literature with this regard. While some authors mention a concomitant diminished CD3ε and TCRζ expression in rheumatoid arthritis [36], in response to TNF [37], in murine models of cancer [38], or in inflamed tissues [39], some others do not [5]. It must be stressed that in these latter instances, the absent TCRζ is substituted in the TCR complex by the FcεRγ chain, a feature not found in our patients with gastric adenocarcinoma [14]; this could explain the lower activation state found in T cells from gastric cancer patients. Acknowledgments This work is supported by the Fondo de Investigación Sanitaria (FIS) grants PI12/01663 and PI18/00626, with funds from the European Union (Fondo Europeo de Desarrollo Regional FEDER). AA-B and NR-P are grant recipients from UCM. IJ is a recipient of Universidad Complutense de Madrid-Harvard grant, (Ayudas para contratos predoctorales de personal investigador en formación CT18/16). Data Availability Data are available within the article on request from the authors. Ethical Approval All the experiments were carried out with the approval of the Ethics Committee of both institutions involved in the study, with the human subjects' understanding and consenting, and according to Helsinki declaration for research involving human beings. Conflicts of Interest All authors declare no competing interests. Figure 1 Representative DotPlots and histograms of the CD3z gating and MFI analysis. A two-gate strategy was employed, using forward scatter (FSC) versus side scatter (SSC) to characterize the previously isolated lymphocytes and CD3ε to determine the T lymphocytes. CD3ζ MFI were determined within the CD3ε-positive population. Figure 2 Western blot analysis of TCRζ and CD3ε expression. Some patients (P3, P6, P7, and P8) showed reduced TCRζ expression with an OD ratio below 0.3; others showed values comparable to those obtained in control subjects, C: control subjects, P: patients. Table 1 Primers used for TCRζ-cDNA amplification. Fragment (size) Primer Sequence Sense F1Z (296 pb) F1FZ CCTCTTTCTGAGGGAAAGGA 5′-3′ F1RZ CCACGTCTCTTGTCCAAAAC 5′-3′ F2Z (364 pb) F2FZ CGAGCTCAATCTAGGACGAA 5′-3′ F2RZ GTGAACCGGGTTGTAAATGC 5′-3′ F3Z (371 pb) F3FZ GGGGATTTCACCACTCAAAG 5′-3′ F3RZ CATTAGGGCATGTGCTAGCA 5′-3′ F4Z (381 pb) F4FZ CAGCTGAGTTGTTGAGTCTG 5′-3′ F4RZ CAGTCTGTTCATCTTCTGGC 5′-3′ F5Z (323 pb) F5FZ CGCACCATTGAACTGTACCA 5′-3′ F5RZ GAGCAGAGAGCGTTTTCCAT 5′-3′ Table 2 TCRζ gene polymorphisms in 44 gastric cancer patients and 33 control subjects. Genotype WT/WT WT/POL POL/POL SNP Controls Patients Controls Patients Controls Patients (n) (%) (n) (%) (n) (%) (n) (%) (n) (%) (n) (%) 373 C/T∗ 7 87.5 12 85.7 1 12.5 2 14.3 0 0.0 0 0.0 856 G/A∗ 7 87.5 14 100.0 1 12.5 0 0.0 0 0.0 0 0.0 1235 C/G 8 100.0 14 100.0 0 0.0 0 0.0 0 0.0 0 0.0 1343 ins/G 6 75.0 11 78.6 2 25.0 2 14.3 0 0.0 1 7.1 1453 C/G 6 75.0 11 78.6 2 25.0 2 14.3 0 0.0 1 7.1 1460 T/A 6 75.0 9 64.3 2 25.0 3 21.4 0 0.0 2 14.3 1542 G/A∗ 6 100.0 10 83.3 0 0.0 1 8.3 0 0.0 1 8.3 1553 A/T 6 100.0 12 100.0 0 0.0 0 0 0 0.0 0 0.0 1572 G/A 2 40.0 1 8.3 3 60.0 11 91.7 0 0.0 0 0.0 WT: wild type; POL: polymorphism; n: sample size SNP; ∗ new polymorphisms deposited at the GenBank with the accession numbers EF364119, EF364117, and EF364118, respectively. ==== Refs 1 Letsch A. Keilholz U. Schadendorf D. High frequencies of circulating melanoma-reactive CD8+ T cells in patients with advanced melanoma International Journal of Cancer 2000 87 5 659 664 10.1002/1097-0215(20000901)87:5<659::AID-IJC7>3.0.CO;2-7 10925359 2 Whiteside T. L. Tumor-infiltrating lymphocytes in human solid tumors Immunology series 1994 61 137 148 8011738 3 Dyck L. Mills K. H. G. Immune checkpoints and their inhibition in cancer and infectious diseases European Journal of Immunology 2017 47 5 765 779 10.1002/eji.201646875 2-s2.0-85018516222 28393361 4 Pawelec G. Tumour escape from the immune response Cancer Immunology, Immunotherapy 2004 53 10 p. 843 10.1007/s00262-004-0531-y 2-s2.0-4744367613 15185008 5 Baniyash M. TCR zeta-chain downregulation: curtailing an excessive inflammatory immune response Nature Reviews Immunology 2004 4 9 675 687 10.1038/nri1434 2-s2.0-4544309074 15343367 6 Suárez-Fueyo A. Bradley S. J. Katsuyama T. Downregulation of CD3ζ in NK cells from systemic lupus erythematosus patients confers a proinflammatory phenotype Journal of Immunology 2018 200 9 3077 3086 7 Krishnan S. Kiang J. G. Fisher C. U. Increased caspase-3 expression and activity contribute to reduced CD3ζ expression in systemic lupus erythematosus T cells Journal of immunology 2005 175 5 3417 3423 10.4049/jimmunol.175.5.3417 8 van Oers N. S. Tohlen B. Malissen B. Moomaw C. R. Afendis S. Slaughter C. A. The 21- and 23-kD forms of TCR zeta are generated by specific ITAM phosphorylations Nature immunology 2000 1 4 322 328 10.1038/79774 2-s2.0-0034305516 11017104 9 Kulkarni D. P. Wadia P. P. Pradhan T. N. Pathak A. K. Chiplunkar S. V. Mechanisms involved in the down-regulation of TCR zeta chain in tumor versus peripheral blood of oral cancer patients International Journal of Cancer 2009 124 7 1605 1613 10.1002/ijc.24137 2-s2.0-61449179357 19107944 10 Chowdhury B. Krishnan S. Tsokos C. G. Stability and translation of TCR zeta mRNA are regulated by the adenosine-uridine-rich elements in splice-deleted 3' untranslated region of zeta-chain Journal of immunology 2006 177 11 8248 8257 10.4049/jimmunol.177.11.8248 17114503 11 Kono K. Salazar-Onfray F. Petersson M. Hydrogen peroxide secreted by tumor-derived macrophages down-modulates signal-transducing zeta molecules and inhibits tumor-specific T cell-and natural killer cell-mediated cytotoxicity European journal of immunology 1996 26 6 1308 1313 10.1002/eji.1830260620 8647210 12 Rabinowich H. Reichert T. E. Kashii Y. Gastman B. R. Bell M. C. Whiteside T. L. Lymphocyte apoptosis induced by Fas ligand- expressing ovarian carcinoma cells. Implications for altered expression of T cell receptor in tumor-associated lymphocytes The Journal of clinical investigation 1998 101 11 2579 2588 10.1172/JCI1518 2-s2.0-0032102258 9616229 13 Lopez-Santalla M. Krishnan S. Valeri A. P. Defective CD3ζ chain expression in Herpesvirus saimiri (HVS)-derived T-cell lines in gastric adenocarcinoma Cellular Immunology 2005 238 2 113 122 10.1016/j.cellimm.2006.02.007 2-s2.0-33646072189 16616055 14 Lopez-Santalla M. Krishnan S. Valeri A. P. FcRγ chain does not replace CD3ζ chain in CD3ζ -deficient T lymphocytes of patients with gastric adenocarcinoma Molecular Immunology 2007 44 9 2400 2405 10.1016/j.molimm.2006.10.012 2-s2.0-33846263707 17134755 15 Valeri A. P. Pérez-Blas M. Gutiérrez A. Intrinsic defects explain altered proliferative responses of T lymphocytes and HVS-derived T-cell lines in gastric adenocarcinoma Cancer Immunology, Immunotherapy 2003 52 11 708 714 10.1007/s00262-003-0413-8 2-s2.0-0242297831 12830324 16 Valeri A. P. Aguilera-Montilla N. López-Santalla M. Herpesvirus saimiri transformation may help disclose inherent functional defects of mucosal T lymphocytes in patients with gastric adenocarcinoma Immunology & Cell Biology 2008 86 3 289 291 10.1038/sj.icb.7100157 2-s2.0-41149161139 18283295 17 Cancer A. J. G. Japanese classification of gastric carcinoma -2nd English edition - Gastric Cancer 1998 1 1 10 24 11957040 18 Koebel C. M. Vermi W. Swann J. B. Adaptive immunity maintains occult cancer in an equilibrium state Nature 2007 450 7171 903 907 10.1038/nature06309 2-s2.0-36849010167 18026089 19 Abril-Rodriguez G. Ribas A. SnapShot: immune checkpoint inhibitors Cancer cell 2017 31 6 848 848.e1 10.1016/j.ccell.2017.05.010 2-s2.0-85020645133 28609660 20 Kuss I. Saito T. Johnson J. T. Whiteside T. L. Clinical significance of decreased zeta chain expression in peripheral blood lymphocytes of patients with head and neck cancer Clinical cancer research: an official journal of the American Association for Cancer Research 1999 5 2 329 334 10037182 21 Taylor D. D. Bender D. P. Gerçel-Taylor Ç. Stanson J. Whiteside T. L. Modulation of TcR/CD3-zeta chain expression by a circulating factor derived from ovarian cancer patients British Journal of Cancer 2001 84 12 1624 1629 10.1054/bjoc.2001.1847 2-s2.0-0035875380 11401315 22 Finke J. H. Zea A. H. Stanley J. Loss of T-cell receptor zeta chain and p56lck in T-cells infiltrating human renal cell carcinoma Cancer research 1993 53 23 5613 5616 8242613 23 Meidenbauer N. Harris D. T. Spitler L. E. Whiteside T. L. Generation of PSA-reactive effector cells after vaccination with a PSA-based vaccine in patients with prostate cancer The Prostate 2000 43 2 88 100 10.1002/(SICI)1097-0045(20000501)43:2<88::AID-PROS3>3.0.CO;2-G 10754524 24 Choi S. H. Chung E. J. Whang D. Y. Lee S. S. Jang Y. S. Kim C. W. Alteration of signal-transducing molecules in tumor-infiltrating lymphocytes and peripheral blood T lymphocytes from human colorectal carcinoma patients Cancer Immunology, Immunotherapy 1998 45 6 299 305 10.1007/s002620050446 2-s2.0-15144339695 9490199 25 Zea A. H. Rodriguez P. C. Atkins M. B. Arginase-producing myeloid suppressor cells in renal cell carcinoma patients: a mechanism of tumor evasion Cancer research 2005 65 8 3044 3048 10.1158/0008-5472.CAN-04-4505 2-s2.0-20244367914 15833831 26 Takahashi A. Kono K. Amemiya H. Iizuka H. Fujii H. Matsumoto Y. Elevated caspase-3 activity in peripheral blood T cells coexists with increased degree of T-cell apoptosis and down-regulation of TCR zeta molecules in patients with gastric cancer Clinical cancer research: an official journal of the American Association for Cancer Research 2001 7 1 74 80 11205921 27 Miller R. A. Effect of aging on T lymphocyte activation Vaccine 2000 18 16 1654 1660 10.1016/S0264-410X(99)00502-2 2-s2.0-0033982069 10689144 28 Aguinaga-Barrilero A. Rodríguez-Pérez N. Pérez-Blas M. Gutiérrez-Calvo A. Martín-Villa J. M. New CD3zeta allele showing a 9-bp deletion in the 3'-UT region of the gene Tissue Antigens 2009 74 4 356 357 10.1111/j.1399-0039.2009.01327.x 2-s2.0-70349313387 19775377 29 Agarwal V. Bell G. W. Nam J. Bartel D. P. Predicting effective microRNA target sites in mammalian mRNAs eLife 2015 4 10.7554/eLife.05005 2-s2.0-84940502214 30 Pappas J. Wolfson A. D. Jung W. J. Differential expression of CD3zeta message and protein in tumor infiltrating lymphocytes from solid tumor specimens and malignant ascites from patients with ovarian carcinoma Anticancer Research 2009 29 11 4673 4682 20032419 31 Minami Y. Weissman A. M. Samelson L. E. Klausner R. D. Building a multichain receptor: synthesis, degradation, and assembly of the T-cell antigen receptor Proceedings of the National Academy of Sciences of the United States of America 1987 84 9 2688 2692 10.1073/pnas.84.9.2688 2-s2.0-0023188236 3495001 32 Nagaraj S. Schrum A. G. Cho H. I. Celis E. Gabrilovich D. I. Mechanism of T cell tolerance induced by myeloid-derived suppressor cells Journal of immunology 2010 184 6 3106 3116 10.4049/jimmunol.0902661 2-s2.0-77950829023 20142361 33 D'Oro U. Munitic I. Chacko G. Karpova T. McNally J. Ashwell J. D. Regulation of constitutive TCR internalization by the zeta-chain The Journal of Immunology 2002 169 11 6269 6278 10.4049/jimmunol.169.11.6269 12444133 34 Dar A. A. Pradhan T. N. Kulkarni D. P. Extracellular 2’5’-oligoadenylate synthetase 2 mediates T-cell receptor CD3-ζ chain down-regulation via caspase-3 activation in oral cancer Immunology 2016 147 2 251 264 10.1111/imm.12560 2-s2.0-84956604563 26595239 35 Hanaoka N. Jabri B. Dai Z. NKG2D initiates caspase-mediated CD3ζ degradation and lymphocyte receptor impairments associated with human cancer and autoimmune disease Journal of immunology 2010 185 10 5732 5742 10.4049/jimmunol.1002092 2-s2.0-78650642570 20926796 36 Ciszak L. Pawlak E. Kosmaczewska A. Potoczek S. Frydecka I. Alterations in the expression of signal-transducing CD3 zeta chain in T cells from patients with chronic inflammatory/autoimmune diseases Archivum Immunologiae et Therapiae Experimentalis 2007 55 6 373 386 10.1007/s00005-007-0042-6 2-s2.0-38349113208 18060371 37 Isomaki P. Panesar M. Annenkov A. Prolonged exposure of T cells to TNF down-regulates TCR zeta and expression of the TCR/CD3 complex at the cell surface Journal of immunology 2001 166 9 5495 5507 10.4049/jimmunol.166.9.5495 11313388 38 Rodriguez P. C. Quiceno D. G. Zabaleta J. Arginase I production in the tumor microenvironment by mature myeloid cells inhibits T-cell receptor expression and antigen-specific T-cell responses Cancer research 2004 64 16 5839 5849 10.1158/0008-5472.CAN-04-0465 2-s2.0-4143130091 15313928 39 Zhang Z. Gorman C. L. Vermi A. C. TCRzetadim lymphocytes define populations of circulating effector cells that migrate to inflamed tissues Blood 2007 109 10 4328 4335 10.1182/blood-2006-12-064170 2-s2.0-34248353538 17255353