==== Front Mol Biol Rep Mol Biol Rep Molecular Biology Reports 0301-4851 1573-4978 Springer Netherlands Dordrecht 33247800 5974 10.1007/s11033-020-05974-7 Short Communication Rapid development of 56 novel microsatellite markers for the benthic freshwater bug Aphelocheirus aestivalis using Illumina paired-end sequencing data and M13-tailed primers http://orcid.org/0000-0001-9186-4223Kaczmarczyk-Ziemba Agnieszka agnieszka.kaczmarczyk-ziemba@ug.edu.pl grid.8585.00000 0001 2370 4076Department of Genetics and Biosystematics, Faculty of Biology, University of Gdansk, Wita Stwosza 59, 80-308 Gdansk, Poland 28 11 2020 28 11 2020 2020 47 12 9995 10003 11 9 2020 3 11 2020 © The Author(s) 2020Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.The freshwater true bug Aphelocheirus aestivalis (Aphelocheiridae) is widely distributed in Europe but occurs rather locally and often in isolated populations. Moreover, it is threatened with extinction in parts of its range. Unfortunately, little is known about the genetic diversity and population structure due to the lack of molecular tools for this species. Thus, to overcome the limitations, a whole-genome sequencing has been performed to identify polymorphic microsatellite markers for A. aestivalis. The whole-genome sequencing has been performed with the Illumina MiSeq platform. Obtained paired-end reads were processed and overlapped into 2,378,426 sequences, and the subset of 267 sequences containing microsatellite motifs were then used for in silico primer designing. Finally, 56 microsatellite markers were determined and 34 of them were polymorphic. Analyses performed in two samples (collected from Drawa and Gowienica rivers, respectively) showed that the number of alleles per locus ranged from 2 to 21, and the observed and expected heterozygosity varied from 0 to 0.933 and 0.064 to 0.931, respectively. The microsatellite markers developed in the present study provide new suitable tools available for the scientific community to study A. aestivalis population dynamics. The assessment of its genetic diversity and population structure will provide important data, that can be used in population management and conservation efforts, elucidating the broad- and fine-scale population genetic structure of A. aestivalis. Keywords AphelocheiridaeFreshwater true bugHigh-throughput sequencingMicrosatellitesIlluminahttp://dx.doi.org/10.13039/501100004281Narodowe Centrum NaukiDEC-2017/01/X/NZ8/00649Kaczmarczyk-Ziemba Agnieszka University of Gdanskissue-copyright-statement© Springer Nature B.V. 2020 ==== Body Introduction The benthic freshwater true bug Aphelocheirus aestivalis (Fabricius 1794) and two endemic congeneric species from the Iberian Peninsula, A. murcius (Nieser and Millán 1989) and A. occidentalis (Nieser and Millán 1989) [1] are the only representatives of the family Aphelocheiridae in Europe. A. aestivalis is distributed throughout Europe [2], where lives in the middle and upper reaches of streams and rivers with β-mesosaprobic waters [3, 4]. The individuals of A. aestivalis occurring in Europe are predominantly micropterous [2]. Due to the fact that only a very few macropterous specimens capable of flight have been collected in the past [5], it has been assumed that A. aestivalis disperses mainly through the watercourses [6]. The remarkable downstream drift of nymphs and adults was observed e.g. in the Danube [6] and the Rhein rivers [5]. Although A. aestivalis is relatively tolerant of changes in some physical and chemical characteristics of water, it is mainly threatened by industrial and agricultural pollution and the regulation of watercourses [7]. In some European countries, A. aestivalis is considered an endangered species and is included in local and national Red Lists or Red Data Books [2]. Successful conservation efforts require not only an understanding of the biology of A. aestivalis and its environmental requirements (e.g. [2, 6, 8, 9]) but also the knowledge on the distribution of the genetic diversity in its populations. Therefore, information about the genetic diversity and differentiation should become incorporated into ecological research and further conservation strategies. However, only a few molecular data that analyze the distribution of A. aestivalis have been published so far. For instance, fragmentary data have been obtained during a comprehensive study based on DNA barcodes in aquatic Heteroptera [10], the differentiation among related species [3, 11], and in approaches leading to the effectiveness evaluation of new molecular tools [12]. More recently, the variability of selected mitochondrial and nuclear markers was evaluated in five populations of A. aestivalis [13]. Analyses revealed low genetic diversity at both levels. Interestingly, endosymbiotic bacteria of Wolbachia have been detected in all tested specimens, and its presence could correlate with decreasing mitochondrial diversity of A. aestivalis. However, the low genetic variation at both mitochondrial and nuclear level that has been observed in tested samples can also be a result of populations’ close relationships, past demographic phenomena, or a specific feature of A. aestivalis. In the past, microsatellite markers have emerged as one of the most popular and effective molecular tools [14]. Given their codominant and neutral nature, biparental mode of inheritance, and high level of polymorphism, microsatellites have been widely used for determining the genetic divergence among populations, estimation of population structure, and genetic diversity in different insect species (e.g. [15]). Nevertheless, such nuclear markers have not been developed for A. aestivalis so far, and thus, the structure of its populations, as well as the genetic divergence among them, have not been determined. To overcome the limitations described above, a set of novel microsatellite markers has been developed for A. aestivalis. Moreover, a fast and cost-effective protocol for species-specific microsatellite markers discovery using Illumina MiSeq sequencing, and the amplification of selected loci with M13-tailed forward primers is presented in this paper. Materials and methods Sample collection and DNA extraction Specimens of A. aestivalis were collected in 2017 from various rivers located in Central and Western Europe (Table 1). A. aestivalis is not an endangered or protected species in the sampling area and sampling activities were not performed at locations where specific permission is required. The samples were collected using dragnet, scraping 0.2 m2 of the bottom. The specimens were picked in situ from the collected material. All specimens were separately preserved in 70% ethanol and stored at − 20 °C until further analyses.Table 1 Geographic locations of sampling sites, where A. aestivalis specimens were collected for described analyses Sampling site [Country code] Sample ID Coordinates Brda river [PL] BR N 53.756944 E 17.761111 Drawa river (near Rzepowo) [PL] DR N 53.590231 E 16.096775 Słopica river (outflow of Dominikowo Lake [PL] DS N 53.208357 E 15.837871 Gowienica river [PL] GOW N 53.680119 E 14.812904 Krąpiel river (inflow to Ina River) [PL] KI N 53.318650 E 15.058834 Krąpiel river (near Krzywnica) [PL] KK N 53.434298 E 15.192272 Stary potok river [PL] SP N 53.309240 E 15.756783 Corgo river [PT] CR N 41.380941 W 7.699801 Genomic DNA was extracted from specimens using the High Pure PCR Template Preparation Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s protocol. Genetic material was extracted from the abdominal tissue of all collected individuals. Microsatellites identification Total genomic DNA isolated from four individuals collected from different populations (marked as DS, DR, SP, and BR) was pooled and used for library preparation using the TNEBNext® DNA Library Prep Master Mix Set for Illumina® (New England BioLabs Inc.). The sequencing was performed with an Illumina MiSeq sequencer at Genomed (Warsaw, Poland). A 2 × 250 base pair (bp) read mode was used during sequencing. The obtained sequences were trimmed and filtered with the Cutadapt v.1.12 software package [16]. The obtained sequences (2.4 Mega reads) were used for microsatellites detection with QDD v.3.1.2 [17]. Primers were initially designed in the QDD pipeline, but its further analyses (including determining the annealing temperature and the ability to form homo- and heterodimers) were performed with the FastPCR [18] and OligoAnalyzer [19] software. Microsatellites amplification and analyses All forward primers were tagged with M13(-21) (5′-TGTAAAACGACGGCCAGT-3′) tails at the 5′ end [20]. PCR reactions were performed in 20 µL volume containing 0.8x JumpStart Taq ReadyMix (1 U JumpStart Taq DNA polymerase, 4 mM Tris-HCl, 20 mM KCl, 0.6 mM MgCl2, 0.08 mM dNTP; Sigma-Aldrich, Germany), 0.4 µM of forward and reverse primers, 0.3 µM of fluorescently labeled (6-FAM, HEX or TAMRA) M13 primer and ~100 ng of DNA. The following PCR conditions were used: 1 min initial denaturation at 94°C, followed by 30 cycles of 94 °C for 30 s, gradient temperature for 30 s (range from 52 to 65 °C), and 72 °C for 1 min. Since the M13 primer needs a 53 °C annealing temperature, eight final cycles were added at the end of the PCR cycles to allow the annealing of the M13 primer with the previously formed amplicons (each cycle contained 30 s denaturation at 94 °C, 30 s M13 primer annealing at 53 °C and 1 min elongation at 72 °C). At the end was 7 min final extension at 72 °C. The amplification products were separated by 2% agarose gel electrophoresis in a 1 × SB buffer and visualized with SimplySafeTM (ethidium bromide replacement; EURx, Poland) in UV light. After the suitable annealing temperatures were determined, the screening for polymorphic and consistently amplifiable loci was performed. In the first step, DNA extracted from 14 A. aestivalis individuals collected from seven sampling sites from Central and Western Europe (Poland: specimens from Brda (BR), Słopica (DS), Drawa (DR), Stary Potok (SP) rivers, and two sampling sites from Krąpiel river (KK and KI, respectively), and Portugal: specimens from Corgo river (CR); two individuals per sample;) was used as templates for amplification. Then, microsatellite loci with amplification success were chosen for routine genotyping. Amplification products were run on an ABI Prism 310 DNA Sequencer (Applied Biosystems, Carlsbad, CA, USA) and analyzed with PeakScanner v.2.0 (Applied Biosystems) using GS-500 (ROX) as a size standard. Routine genotyping was performed using template DNA extracted from specimens collected from Drawa (DR; 30 individuals) and Gowienica (GOW; 30 individuals) rivers. Details for developed microsatellite loci are given in Table 2.Table 2 Primer sequences and general description of 56 new microsatellite loci for Aphelocheirus aestivalis. 5’ tails attached to forward primers are in brackets Locus name Degree of polymorphism Primer sequence 5′-3′ Repeat motif Ta (°C) Accession no. Aaesti2 monomorphic F: [M13]CCGCGCACTTTGTTACACT R:ATTTCGTGGAGTGCAATACG (ACTGA)5 59.9 MT988404 Aaesti3 monomorphic F: [M13]CATTTAATCGTTATTGTAACACGTTC R: AATTGCAAGATTCCACCTGC (TTTG)5 59.9 MT988405 Aaesti4 monomorphic F: [M13]AACAACTTCAAATATAGTTAGGTCGGC R: CCGGTCTCCTTGTACTAATGACT (ACAA)5 51.5 MT988406 Aaesti5 polymorphic F: [M13]TCATTCTGGCTCATTTGCAT R: AAACACTCACATTCAGGAACAGT (TTTA)5 51.5 MT988407 Aaesti7 monomorphic F: [M13]CGATGTGGAGACAGTTTGGA R: GTCATTGGCAGGCTCTTCAT (TATT)5 54.5 MT988408 Aaesti8 polymorphic F: [M13]AGCGCTCAAAGTACTGACAAG R: TGGCGATGTCCTTTATTCCT (TTAT)5 59.9 MT988409 Aaesti9 monomorphic F: [M13]ACTCATAGCCTTTCGTTATCTCTTC R: GAATTTAACTGTAGCCTGTAATTCTGC (ATTT)5 52.9 MT988410 Aaesti11 monomorphic F: [M13]CTGCCATTTGCGTCAACACT R: CCTCCTGCTGCCTTCTCTAA (TGTC)5 52.9 MT988411 Aaesti12 polymorphic F: [M13]GGGAGGGAATCCTTTACAACC R: CAACAATTAAGTAATATTGGACCTCTT (ACAT)5 51.5 MT988412 Aaesti14 monomorphic F: [M13]ATGACGCCCTTCAGGGTAG R: TGTAGGACTACAAGCGACGG (AGGT)6 52.9 MT988413 Aaesti15 polymorphic F: [M13]GGTGAATCTCCGTAAACTTGG R: TTGTAACGACGAAGCACATTG (ATAG)5 51.5 MT988414 Aaesti16 polymorphic F: [M13]AACCTGGGAATTTAATGCAAA R: TGCCCTCAATTGTCTGATTT (CAA)6 54.5 MT988415 Aaesti17 monomorphic F: [M13]GGAATTTGACGATCGTTTCC R: TTTGGTTCCATATGGTTCTCACT (TTG)5 54.5 MT988416 Aaesti18 monomorphic F: [M13]GAGACGGATCCACCATCTGT R: CCATGAATAGTGAGCTCTGGC (GTT)5 54.5 MT988417 Aaesti19 polymorphic F: [M13]TCCTCTGCAGACTCTTTACTGG R: CGGAAGGTGAGGTAGCAGTAG (CAA)5 54.5 MT988418 Aaesti20 monomorphic F: [M13]TGTTGCTATAAACCTGGTAACCC R: GTGGAAGCTCCAGCTTGTTT (ACA)5 54.5 MT988419 Aaesti21 polymorphic F: [M13]TGACACCACCTCCATTGAAA R: TGGGCCCAGGTGATTGAT (AGT)5 54.5 MT988420 Aaesti22 polymorphic F: [M13]ACGCGTACGCAATCAATATCT R: GATTGAGGGAAAGAGAGGCA (ACT)5 54.5 MT988421 Aaesti23 monomorphic F: [M13]AAGATTCAAGAGGCCAAGGG R: GCATGCATCTTTATCACCTGTT (AGT)6 52.9 MT988422 Aaesti24 monomorphic F: [M13]TCTCTCCTTGACTAACGCGG R: AGGTTGGTAACGACAAGGCA (CTA)5 54.5 MT988423 Aaesti25 monomorphic F: [M13]TGGTCAAATATTGTTAAGGAAGCC R: TCGTATCTATGTGAATCGCGTC (TAG)6 51.5 MT988424 Aaesti26 polymorphic F: [M13]AGGAGTGGCAGAAGGATTAGG R: TCCACTCGTCCTCCCTCTAA (GTA)5 54.5 MT988425 Aaesti28 polymorphic F: [M13]GACCCAGAGTGAAAGTGGGA R: GCAAGTGTCAAGGGTTGGTT (CTA)5 54.5 MT988426 Aaesti29 monomorphic F: [M13]CGAAGCAAGGCCTCTGAGTA R: AAGGCCCACTCTGAGCTGTA (ACT)5 54.5 MT988427 Aaesti30 monomorphic F: [M13]GCTACACCTTCGCCATTTGT R: GCTCCTCCACAGTCAGCTTC (TGG)5 54.5 MT988428 Aaesti31 monomorphic F: [M13]CCAGACATTTACACCACTTCCA R: AGAACACATTCCCAGGTTGC (CAC)5 51.5 MT988429 Aaesti32 monomorphic F: [M13]AAATTCCGGTTGTTCTTCCC R: GGGTTGGTTTCAAAGTCACG (GTG)5 54.5 MT988430 Aaesti33 monomorphic F: [M13]GTGTCCGCCTACTGATTGCT R: TCTTTCCGAACAGAACCCAT (CCA)5 51.5 MT988431 Aaesti34 monomorphic F: [M13]ATGATTGAATGGCTCCGGT R: TGGAGGCCCTACATTTCTTG (ACC)5 54.5 MT988432 Aaesti35 monomorphic F: [M13]GGGATTCTATACGCGACTTGC R: ACGGTTATGTTCAAACAGAGGAA (GTG)6 54.5 MT988433 Aaesti37 polymorphic F: [M13]TCCTCTAAAGACGTTGGCGT R: GTTCGACGCACTTCTGGAAT (GA)34 54.5 MT988434 Aaesti38 polymorphic F: [M13]CTTATGTAGCACCACCGAGG R: AGCTGTGATTCTGACCTCTCG (GA)29 54.5 MT988435 Aaesti39 polymorphic F: [M13]AAACGGAGCAGCTCATAACG R: TGGTATAAAGCGCAAGACGC (GA)29 59.9 MT988436 Aaesti40 polymorphic F: [M13]GATTGCGGAGAATGTGGG R: TTATCTTCCGGAGCCCTCTT (GA)28 54.5 MT988437 Aaesti41 polymorphic F: [M13]AAATTCAATGGGAATATTGTTTGA R: TTCATCCTGCAACACCAGTC (AT)27 51.5 MT988438 Aaesti47 polymorphic F: [M13]TCTGCTCCTCAACTCCCTGT R: AAGATTCCGTTTGTTGCGTC (AT)23 50.8 MT988439 Aaesti48 polymorphic F: [M13]TTGAGTAATCAGAGAATAGCAGTCAA R: CCCAATCCACGTAAACATGA (AT)23 50.8 MT988440 Aaesti49 polymorphic F: [M13]TCTCCTTGCTGGTCTTCCC R: CACCTTCCAGAAATCGTTTAAGA (TA)23 50.8 MT988441 Aaesti50 polymorphic F: [M13]AGGAGCCGAAGTGAGAAGAA R: GCTCGCTTTACGTTTGGC (TA)23 50.8 MT988442 Aaesti51 polymorphic F: [M13]TCCGTTCGTTCTTATATTACGC R: GGATTTAATTGGCCAGCTGAT (AT)23 50.8 MT988443 Aaesti54 polymorphic F: [M13]TGGAGAGTGTCACATAAAGTCCC R: GGCCTCCCACCAGCTTAAT (AT)23 50.8 MT988444 Aaesti55 polymorphic F: [M13]AAGCGATGGGAGAATGTTGT R: CGTTAATCCCATCCTCCATT (CT)22 54.5 MT988445 Aaesti56 polymorphic F: [M13]CCTACGTTGGCCCAGTAGAAT R: AGTGAGTCCGTTGCAAGGTT (GA)22 54.5 MT988446 Aaesti59 polymorphic F: [M13]GGGATTTATGGGAGACGGAT R: GCTGGAGCATGTTTCAAGGT (AT)22 54.5 MT988447 Aaesti60 monomorphic F: [M13]CTTATTGGCGTCCTTATGCC R: CGAATTACTCTCATCTTAACAGCTTC (AT)22 50.8 MT988448 Aaesti62 polymorphic F: [M13]CATTCAGACTTGGCATTCTTGA R: TCCCGTGTTAATAACTAACCCATC (TA)22 54.5 MT988449 Aaesti63 polymorphic F: [M13]CGGTCTATATGTCCCTAATGGG R: CAGGCTCCTCAAGTTTCTCAA (TA)22 54.5 MT988450 Aaesti64 polymorphic F: [M13]AAAGGGCTATATTATGAAGTCCCA R: AGTTTGACGACCGAACTCGT (TA)22 54.5 MT988451 Aaesti65 polymorphic F: [M13]CATCACAACACTGGAGGCTG R: TTTAGGGATGAATAAGCTCTGAAAT (AT)22 54.5 MT988452 Aaesti66 polymorphic F: [M13]TGCTGATCAACTTGCCAAAC R: GCGTTTAAGACGAAGAGGGA (TC)21 54.5 MT988453 Aaesti67 polymorphic F: [M13]CAATTCTGGAAACGGAATTAGTG R: AAGAACGACCGTACTGTGCC (GA)21 54.5 MT988454 Aaesti69 polymorphic F: [M13]TGAGTGCAACCACTCCAAGT R: CAGCATTACAGAGTCAGTCAATCA (AT)21 54.5 MT988455 Aaesti71 polymorphic F: [M13]TTCCAGACTGCAGAGGTGC R: AATCAAGCATTCGATAGCCG (AT)21 54.5 MT988456 Aaesti72 polymorphic F: [M13]CAAGGTTTAGGAAATTAAGAGCAA R: AATGCATTTCTTTCTGCAGTTT (AT)21 54.5 MT988457 Aaesti73 monomorphic F: [M13]CACTGCATTACAATCCAATAAACA R: AATTCGAATGTTCTTTGACCC (TA)21 50.8 MT988458 Aaesti75 polymorphic F: [M13]CTTTGGTTCAAAGGTGTGGAG R: AAATAGAGGACGGCCCTTAGC (TA)21 54.5 MT988459 Basic summary statistics for each locus (i.e. allele size, number of alleles per locus (Na), number of private alleles, observed (HO) and expected (HE) heterozygosities, as well as tests for Hardy-Weinberg equilibrium (HWE) were calculated in GenAlEx v. 6.503 [21] based on results obtained for two samples collected from Drawa and Gowienica rivers, respectively. Tests for linkage disequilibrium were performed using Genepop v. 4.7.5 [22, 23]. Micro-Checker v. 2.2.3 software was used to examine large allele dropout, stuttering, and null alleles as potential sources of error [24]. The significant values for all diversity tests of significance were corrected by the sequential Bonferroni’s procedure [25]. Results and discussion The advances in high-throughput sequencing technologies enable the rapid and cost-effective development of microsatellite markers for a vast number of different taxa. Currently, Illumina has becomes the first-choice platform used to accomplish microsatellite isolation. In the present study, the A. aestivalis whole-genome library was sequenced using the Illumina MiSeq protocol. Obtained paired-end reads were processed and overlapped into 2,378,426 sequences. A total of 234,634 sequences contained at least one microsatellite. Further analyses revealed among them 34,583 unique sequences contained microsatellites and for 15,049 of them, primer designing was possible. Those sequences contained three pentanucleotide motifs, 43 tetranucleotide motifs, 1030 trinucleotide motifs, and 13984 dinucleotide motifs. Mononucleotide repeats were excluded from analyses. Selected 267 sequences containing microsatellite motifs were used for in silico primer designing. Among them, two contained pentanucleotide repeats, 43—tetranucleotide repeats, 56—trinucleotide repeats, and 166—dinucleotide repeats. For the preliminary screening under laboratory conditions, 75 loci out of these 267 potential microsatellite markers were tested in 14 A. aestivalis individuals collected from different sampling sites. Primers pairs that failed to amplify target loci, as well as primers that amplified regions of unexpected size, or amplified markers showing stuttering patterns during genotyping, were discarded. A final suite of 56 microsatellite loci yielded consistent amplification (Table 2). Sequences containing these markers were deposited in GenBank under accession numbers MT988404-MT988459. Polymorphism of 56 selected microsatellite loci was then analyzed among specimens collected from two populations inhabiting unconnected rivers (Drawa and Gowienica, respectively). Analyses revealed 22 monomorphic loci and 34 loci which were polymorphic and consistently amplifiable. Further analyses of these informative loci showed that the total number of observed alleles per locus ranged from 2 to 21 in separated samples, and from 2 to 22 in the overall sample (Table 3). Private alleles were noticed in all but four loci (not observed at loci Aaesti12, Aaesti15, Aaesti19, and Aaesti22). Observed heterozygosity ranged from 0.000 (at loci Aaesti5 and Aaesti21 only two different homozygotes were observed per each locus among individuals from the Drawa river and similarly, two different homozygotes were noticed at locus Aaesti21 among individuals from Gowienica river) to 0.933 across loci. In turn, expected heterozygosity ranged from 0.064 (Aaesti5 in DR sample and Aaesti21 in both DR and GOW samples) to 0.925 (Aaesti39 in GOW sample). Within the overall sample, the same parameters ranged from 0.000 to 0.898 and from 0.065 to 0.935, respectively. Null alleles were identified in 26 microsatellite loci and that in turn may resulted in a heterozygote deficiency (Table 3) [26]. The test of linkage disequilibrium showed a non-random association among alleles at 7 pairs of identified loci (i.e. Aaesti5-Aaesti28, Aaesti8-Aaesti16, Aaesti8-Aaesti22, Aaesti-16-Aaesti69, Aaesti8-Aaesti72, Aaesti19-Aaesti26, and Aaesti59-Aaesti72). This may be a result of physical linkage (loci may be located on the same chromosome, perhaps in close proximity to each other) or other phenomena (e.g. drift, selection, and/or gene flow). Consequently, one of the two associated markers should be excluded from further population genetic analyses in order to avoid the overstating of population structure [27].Table 3 Characterization of the 34 polymorphic microsatellite loci screened in 60 Aphelocheirus aestivalis individuals collected from Drawa and Gowienica rivers. Locus Allele size (bp) Na Private alleles HO HE HWE-P/significance Null alleles DR GOW Overall DR GOW DR GOW Overall DR GOW Overall DR GOW Overall DR GOW Overall Aaesti5 116-128 2 3 3 – 1 0.000 0.033 0.017 0.064 0.326 0.496 0.000*** 0.000*** 0.003** 0.0605 0.2208 0.3203 Aaesti8 115-131 3 5 5 – 2 0.172 0.300 0.237 0.372 0.602 0.570 0.000*** 0.000*** 0.002** 0.1452 0.1886 0.2121 Aaesti12 222-230 3 3 3 – – 0.300 0.517 0.407 0.316 0.574 0.520 0.227 0.119 0.010* – – – Aaesti15 115-139 4 4 4 – – 0.200 0.310 0.254 0.571 0.571 0.622 0.000* 0.004 0.003** 0.2362 0.1661 0.2266 Aaesti16 178-196 4 4 5 1 1 0.250 0.143 0.196 0.631 0.257 0.678 0.000*** 0.000*** 0.002** 0.2335 0.0908 0.2868 Aaesti19 171-177 3 3 3 – – 0.400 0.333 0.367 0.598 0.523 0.565 0.112 0.035 0.007 0.1238 0.1244 0.1270 Aaesti21 113-128 2 2 3 1 1 0.000 0.000 0.000 0.064 0.064 0.065 0.000*** 0.000*** 0.002** 0.0605 0.0605 0.0610 Aaesti22 168-171 2 2 2 – – 0.233 0.107 0.172 0.375 0.316 0.348 0.039 0.000*** 0.006** – 0.1585 0.1301 Aaesti26 147-153 2 3 3 – 1 0.133 0.167 0.150 0.124 0.155 0.140 0.696 0.970 0.05 – – – Aaesti28 89-95 4 3 4 1 – 0.467 0.533 0.500 0.574 0.496 0.576 0.322 0.609 0.013* – – – Aaesti37 189-223 14 14 16 2 2 0.821 0.571 0.696 0.893 0.895 0.905 0.247 0.000*** 0.003** – 0.1709 0.1097 Aaesti38 190-238 16 21 22 1 6 0.733 0.867 0.800 0.914 0.919 0.928 0.063 0.784 0.005** 0.0946 – 0.0666 Aaesti39 100-158 17 19 21 2 4 0.759 0.750 0.754 0.920 0.925 0.935 0.059 0.005 0.003** 0.0842 0.0908 0.0932 Aaesti40 104-134 12 11 14 3 2 0.786 0.828 0.807 0.876 0.806 0.852 0.008 0.139 0.003** – – – Aaesti41 114-146 14 9 15 6 1 0.367 0.300 0.333 0.805 0.682 0.757 0.000*** 0.000*** 0.002** 0.2428 0.2270 0.2413 Aaesti47 86-136 15 16 20 4 5 0.417 0.241 0.321 0.912 0.904 0.934 0.000*** 0.000*** 0.002** 0.2592 0.3481 0.3169 Aaesti48 112-142 11 12 15 3 4 0.267 0.700 0.483 0.852 0.854 0.864 0.000*** 0.093 0.002** 0.3161 0.0833 0.2044 Aaesti49 137-185 13 14 15 1 2 0.310 0.433 0.373 0.870 0.917 0.912 0.000*** 0.000*** 0.002** 0.2992 0.2524 0.2820 Aaesti50 86-114 13 13 14 1 1 0.300 0.310 0.305 0.874 0.871 0.889 0.000*** 0.000*** 0.002** 0.3065 0.2997 0.3093 Aaesti51 92-152 13 16 18 2 5 0.400 0.600 0.500 0.882 0.922 0.917 0.000*** 0.000*** 0.002** 0.2562 0.1676 0.2173 Aaesti54 124-162 14 15 19 4 5 0.500 0.690 0.600 0.834 0.901 0.900 0.000*** 0.086 0.005** 0.1819 0.1113 0.1578 Aaesti55 143-199 19 17 20 3 2 0.808 0.862 0.836 0.909 0.901 0.916 0.368 0.132 0.017* – – – Aaesti56 88-142 18 16 21 5 3 0.759 0.724 0.741 0.910 0.897 0.928 0.018 0.010 0.004** 0.0794 0.0909 0.0970 Aaesti59 118-168 16 15 22 7 6 0.500 0.414 0.456 0.908 0.883 0.909 0.000*** 0.000*** 0.002** 0.2136 0.2494 0.2372 Aaesti62 105-157 18 17 22 5 4 0.700 0.517 0.610 0.909 0.919 0.935 0.084 0.000* 0.003** 0.1094 0.2092 0.1678 Aaesti63 137-185 13 13 15 2 2 0.621 0.867 0.746 0.881 0.886 0.908 0.000*** 0.486 0.004** 0.1384 – 0.0849 Aaesti64 125-165 14 15 17 2 3 0.933 0.862 0.898 0.891 0.880 0.901 0.404 0.778 0.008** – – – Aaesti65 102-120 2 6 6 – 4 0.111 0.467 0.298 0.168 0.544 0.391 0.078 0.000*** 0.002** – – – Aaesti66 97-141 15 19 20 1 5 0.931 0.862 0.897 0.897 0.920 0.918 0.111 0.273 0.025* – – – Aaesti67 165-219 17 19 22 3 5 0.733 0.667 0.700 0.896 0.931 0.933 0.016 0.003 0.004** 0.0856 0.1367 0.1204 Aaesti69 112-224 13 13 20 7 7 0.207 0.448 0.328 0.734 0.781 0.772 0.000*** 0.000*** 0.002** 0.3038 0.1869 0.2509 Aaesti71 161-193 13 17 17 – 4 0.741 0.897 0.821 0.906 0.912 0.916 0.018 0.108 0.006** 0.0867 – 0.0494 Aaesti72 123-161 10 7 14 7 4 0.172 0.138 0.155 0.489 0.399 0.449 0.000*** 0.000*** 0.001** 0.2125 0.1866 0.2030 Aaesti75 123-169 13 18 19 1 6 0.433 0.655 0.542 0.845 0.923 0.902 0.000*** 0.000*** 0.002** 0.2231 0.1394 0.1893 DR drawa river, GOW gowienica river, Na number of alleles, HO observed heterozygosity, HE expected heterozygosity Loci with significant HWE deviations after Bonferroni correction are labeled with an asterisks *p < 0.05 **p < 0.01 ***p < 0.001 The departures out of Hardy-Weinberg equilibrium after Bonferroni correction were found in all but thirteen microsatellite loci. These deviations were mainly due to a deficit of heterozygotes. Low heterozygosity estimated for most identified polymorphic microsatellite markers may be the effect of small size of selected A. aestivalis populations, inbreeding and minimal or null immigration of new individuals into populations. On the other hand, observed heterozygosities calculated for some loci (e.g. Aaesti40, Aaesti55, and Aaesti64) are relatively high, indicating that tested A. aestivalis populations are not devoid of the intra-population genetic variation. In turn, analyses for connected samples revealed the departures out of Hardy-Weinberg equilibrium after Bonferroni correction only in two identified loci. Microsatellite markers have proven to be crucial in understanding population genetics and ecology of many species, including freshwater insects (e.g. [28]). Within this group, A. aestivalis has a potential as a model organism for the study on the impact of past demographic phenomena, phylogeographic relationships, and infection with endosymbiotic Wolbachia on the genetic diversity of slowly dispersing freshwater insects. In the present study, a set of 56 microsatellite markers have been identified for freshwater A. aestivalis and 34 of them were polymorphic. These markers provide new suitable tools available for the scientific community to study A. aestivalis population dynamics. Finally, the assessment of its genetic diversity and population structure will provide important data, that can be used in population management and conservation efforts, elucidating the broad- and fine-scale population genetic structure of A. aestivalis. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Acknowledgements This work was supported by the National Science Centre, Poland (grant no. DEC-2017/01/X/NZ8/00649). I would like to thank Tomasz Krepski PhD (Department of Hydrobiology and General Zoology, University of Szczecin, Poland) for his involvement in field studies and specimens collection. Funding This work was supported by the National Science Centre, Poland (Grant No. DEC-2017/01/X/NZ8/00649). Data availability Sequences containing developed microsatellite markers were deposited in GenBank under accession numbers MT988404-MT988459. Compliance with ethical standards Conflicts of interest The author discloses no financial or personal relationship with other people or organizations that could inappropriately influence his work. Ethics approval A. aestivalis is not an endangered or a protected species on sampling area. Sampling activities were not performed at locations where specific permission is required. ==== Refs References 1. Nieser N Millan A Two new species of Aphelocheiridae from the Iberian Peninsula (Heteroptera: Naucoridae) Entomol Ber Amsterdam 1989 49 111 117 2. Papácek M On the benthic water bug Aphelocheirus aestivalis (Fabricius 1794) (Heteroptera, Aphelocheiridae): minireview Entomol Austriaca 2012 19 9 19 3. Carbonell JA Abellan P Arribas P The genus Aphelocheirus Westwood, 1833 (Hemiptera: Aphelocheiridae) in the Iberian Peninsula Zootaxa 2011 2771 1 16 10.11646/zootaxa.2771.1.1 4. Zivić I, Protić L, Marković Z (2007) Southernmost finding in Europe of Aphelocheirus aestivalis (Fabricius, 1794) (Hemiptera: Heteroptera: Aphelocheiridae). Zootaxa 63–68 5. Hoffmann HJ Zur verbreitung der grunwanze Aphelocheirus aestivalis (Fabricius, 1794) in deutschland, nebst angaben zur morphologie, biologie, fortpflanzung und ökologie der art und zum fund eines makropteren exemplares (Heteroptera) Entomol Nachr Ber 2008 52 149 180 6. Stoianova D Evtimova V Kenderov L New localities and habitat suitability modelling for the riverine water bug Aphelocheirus aestivalis in Northern and Eastern Bulgaria Acta Zool Bulg 2018 70 415 431 7. Manko P Interesujące stwierdzenia trzech rzadkich i zagrozonych merolimnicznych gatunków owadów na Słowacji Forum Faunistyczne 2011 1 56 62 8. Papacek M Soldan T Structure and development of the reproductive system in Aphelocheirus aestivalis (Hemiptera: Heteroptera: Nepomorpha: Aphelocheiridae) Acta Entomol Musei Natl Pragae 2008 48 299 318 9. Vercauteren T Bosmans R De Smedt S Rivierbodemwants (Aphelocheirus aestivalis ) in provincie Antwerpen (Heteroptera, Aphelocheridae) Antwerpse Koepel voor Natuurstudie Jaarboek 2003 2 81 96 10. Havemann N Gossner MM Hendrich L From water striders to water bugs: the molecular diversity of aquatic Heteroptera (Gerromorpha, Nepomorpha) of Germany based on DNA barcodes PeerJ 2018 6 e4577 10.7717/peerj.4577 29736329 11. Hebsgaard MB Andersen NM Damgaard J Phylogeny of the true water bugs (Nepomorpha: Hemiptera-Heteroptera) based on 16S and 28S rDNA and morphology Syst Entomol 2004 29 488 508 10.1111/j.0307-6970.2004.00254.x 12. Sonnenberg R Nolte AW Tautz D An evaluation of LSU rDNA D1–D2 sequences for their use in species identification Front Zool 2007 4 6 10.1186/1742-9994-4-6 17306026 13. Kaczmarczyk-Ziemba A Krepski T First report on Wolbachia endosymbiosis in freshwater Aphelocheirus aestivalis (Heteroptera: Aphelocheiridae) and its potential impact on genetic diversity of host Entomol Sci 2020 23 44 56 10.1111/ens.12397 14. Selkoe KA Toonen RJ Microsatellites for ecologists: A practical guide to using and evaluating microsatellite markers Ecol Lett 2006 9 615 629 10.1111/j.1461-0248.2006.00889.x 16643306 15. Basoalto A Ramírez CC Lavandero B Population genetic structure of codling moth, Cydia pomonella (L.) (Lepidoptera: Tortricidae), in different localities and host plants in Chile Insects 2020 11 285 10.3390/insects11050285 16. Martin M Cutadapt removes adapter sequences from high-throughput sequencing reads EMBnet J 2011 17 10 12 10.14806/ej.17.1.200 17. Meglécz E Pech N Gilles A QDD version 3.1: a user-friendly computer program for microsatellite selection and primer design revisited: experimental validation of variables determining genotyping success rate Mol Ecol Resour 2014 14 1302 1313 10.1111/1755-0998.12271 24785154 18. Kalendar R Khassenov B Ramankulov Y FastPCR: An in silico tool for fast primer and probe design and advanced sequence analysis Genomics 2017 109 312 319 10.1016/J.YGENO.2017.05.005 28502701 19. Owczarzy R Tataurov AV Wu Y IDT SciTools: a suite for analysis and design of nucleic acid oligomers Nucleic Acids Res 2008 36 W163 W169 10.1093/nar/gkn198 18440976 20. Schuelke M An economic method for the fluorescent labeling of PCR fragments Nat Biotechnol 2000 18 233 234 10.1038/72708 10657137 21. Peakall R Smouse PE Genalex 6.5: Genetic analysis in Excel. Population genetic software for teaching and research-an update Bioinformatics 2012 28 2537 2539 10.1093/bioinformatics/bts460 22820204 22. Raymond M Rousset F GENEPOP (Version 1.2): population genetics software for exact tests and ecumenicism J Hered 1995 86 248 249 10.1093/oxfordjournals.jhered.a111573 23. Rousset F GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux Mol Ecol Resour 2008 8 103 106 10.1111/j.1471-8286.2007.01931.x 21585727 24. Van Oosterhout C Hutchinson WF Wills DPM Shipley P MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data Mol Ecol Notes 2004 4 535 538 10.1111/j.1471-8286.2004.00684.x 25. Rice WR Analyzing tables of statistical tests Evolution (N Y) 1989 43 223 225 10.2307/2409177 26. Kim KS Sappington TW Kantartzi SK Microsatellite Data Analysis for Population Genetics Microsatellites 2013 Methods and Protocols Humana Press, Totowa 271 295 27. Slatkin M Linkage disequilibrium: understanding the genetic past and mapping the medical future Nat Rev Genet 2008 9 477 485 10.1038/nrg2361.Linkage 18427557 28. Inada K Kitade O Morino H Paternity analysis in an egg-carrying aquatic insect Appasus major (Hemiptera: Belostomatidae) using microsatellite DNA markers Entomol Sci 2011 14 43 48 10.1111/j.1479-8298.2010.00420.x