==== Front Sci Rep Sci Rep Scientific Reports 2045-2322 Nature Publishing Group UK London 78148 10.1038/s41598-020-78148-x Article Structural analysis and insight into effector binding of the niacin-responsive repressor NiaR from Bacillus halodurans Lee Dong Won 1 Park Young Woo 12 Lee Myung Yeon 1 Jeong Kang Hwa 1 Lee Jae Young jylee001@dongguk.edu 1 1 grid.255168.d0000 0001 0671 5021Department of Life Science, Dongguk University-Seoul, Ilsandong-gu, Goyang-si, Gyeonggi-do 10326 Republic of Korea 2 Present Address: Structural Biology Lab, B2SBIO, Yeonsu-gu, Incheon, Republic of Korea 3 12 2020 3 12 2020 2020 10 2103921 8 2020 18 11 2020 © The Author(s) 2020Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.The niacin-responsive repressor, NiaR, is transcriptional repressor of certain nicotinamide adenine dinucleotide (NAD) biosynthetic genes in response to an increase in niacin levels. NAD is a vital molecule involved in various cellular redox reactions as an electron donor or electron acceptor. The NiaR family is conserved broadly in the Bacillus/Clostridium group, as well as in the Fusobacteria and Thermotogales lineages. The NiaR structure consists of two domains: an N-terminal DNA-binding domain, and a C-terminal regulation domain containing a metal-binding site. In this paper, we report the crystal structures of apo and niacin-bound forms of NiaR from Bacillus halodurans (BhNiaR). The analysis of metal-binding and niacin-binding sites through the apo and niacin-bound structures is described. Each N- and C-terminal domain structure of BhNiaR is almost identical with NiaR from Thermotoga maritima, but the overall domain arrangement is quite different. A zinc ion is fully occupied in each subunit with well-conserved residues in the C-terminal domain. Niacin is also located at a hydrophobic pocket near the zinc ion in the C-terminal domain. Subject terms BiochemistryMolecular biologyStructural biologyhttp://dx.doi.org/10.13039/501100003725National Research Foundation of Korea2020R1F1A1072808http://dx.doi.org/10.13039/501100003624Ministry of Agriculture, Food and Rural Affairs710013-03-1-SB120issue-copyright-statement© The Author(s) 2020 ==== Body Introduction Nicotinamide adenine dinucleotide (NAD) is an essential molecule that plays an important role as both electron donor and electron acceptor in cellular metabolism1–3. The NAD molecule participates in many biochemical transformations, including several reactive centers. Nearly 88% of enzymes that rely on NAD are involved in catabolic pathways. Approximately half of these enzymes are related to the use of carbohydrates, and the remaining enzymes contributes to the oxidation of other substrates such as carboxylic acid, amino acid and fatty acid4. In many bacteria, NAD+ is synthesized through two metabolic processes, the de novo and salvage pathways. In the de novo pathway, NAD+ is synthesized from l-aspartate or l-tryptophan by the consecutive action of NadBACDE (l-aspartate oxidase, quinolinate synthetase, quinolinate phosphor-rybosyl-transferase, nicotinate mononucleotide adenylyl-transferase, and NAD synthetase)5. The salvage pathway is a recycling system producing NAD+ from exogenous sources such as niacin (also called nicotinic acid or vitamin B3), nicotinamide, nicotinamide riboside or endogenous breakdown products of NAD+ by NAD+-consuming enzymes1,6. Despite some variations in the early steps of the two pathways, the final step of NAD+ synthesis from nicotinic acid adenine dinucleotide to NAD+ is highly conserved7. Both de novo and salvage pathways for NAD+ biosynthesis are regulated by several transcription factors, the NAD+-dependent repressor (NadR), the Nudix-related transcriptional regulators (NrtR), and the niacin-responsive repressor (NiaR). NadR in Enterobacteria acts as a repressor of certain NAD+ biosynthetic genes responding to NAD+, nicotinic acid phosphoribosyltransferase (pncB) in the salvage pathway and nadBA involved in the de novo pathway4. In addition, NadR has enzymatic activities as nicotinamide riboside kinase and nicotinamide mononucleotide adenylyltransferase, which function in NAD+ synthesis8–11. The NrtR acts as a regulator of NAD+ biosynthesis genes and salvage genes such as, nadBACDE, nicotinamidase (pncA), pncB, and nicotinamide riboside transporter pnuC12,13. NiaR, previously called YrxA, was found mainly in Bacillus/Clostridium species, as well as Fusobacteria and Thermotogales6,14. NiaR represses transcription of certain NAD+ biosynthetic genes in response to elevated niacin levels. NiaR also represses the expression of the transporter for niacin uptake (niaX, niaY, and niaP), pncA and pncB in the salvage pathway, and two operons, cysteine desulfurases (nifS) and nadBCA, sharing a promoter region, in the de novo pathway15. The transcriptomic analysis of Streptococcus pneumoniae NiaR showed that NiaR regulated gene expressions, including niaX, pnuC, and nadC, in response to niacin16. The biochemical and bioinformatic analyses provided the mechanism of NiaR and the metabolism of NAD+ synthesis in Bacillus subtilis6,17. The NiaR regulon constitutes a transcriptional regulation system of NAD+ synthesis in several groups of Gram-positive bacteria6. Previous studies suggested that niacin binds to the 3-histidine domain (3H domain) of NiaR and NiaR belongs to a family of de novo NAD+ synthesis pathway regulators14. The NiaR from Thermotoga maritima (TmNiaR) displayed metal binding and dimeric structure. The NiaR protein is composed of two domains. The N-terminal domain is a DNA-binding domain containing a helix-turn-helix motif and the C-terminal domain is a regulatory 3H domain in which three histidines are well conserved. A nickel ion is occupied in the C-terminal domain of TmNiaR and the function of this domain was assumed to involve binding to small molecules18. The NiaR homologue in Bacillus halodurans (BH1216, BhNiaR) is composed of 179 amino acids, with 54% sequence identity with NiaR in B. subtilis (BsNiaR). Further sequence comparisons of BhNiaR show that it is 37% identical to TmNiaR, 38% identical to S. pneumonia NiaR, and 42% identical to Clostridium symbiosum NiaR (Fig. 1a).Figure 1 Multiple sequence alignment and overall structure of Bacillus halodurans NiaR. (a) Multiple sequence alignment of BhNiaR with other NiaR homologues. The secondary structures of BhNiaR are indicated above the sequence. The highly conserved and partially conserved residues are shaded in black and gray boxes, respectively. The residues involved in metal binding are shown as red triangles at the bottom of the sequence. The residues, which form a hydrophobic pocket, are shown as orange triangles at the bottom of the sequence. BhNiaR, Bacillus halodurans NiaR; TmNiaR, Thermotoga maritima NiaR; BsNiaR, Bacillus subtilis NiaR; SpNiaR, Streptococcus pneumoniae NiaR; CsNiaR, Clostridium symbiosum NiaR. (b) The monomeric structure of apo BhNiaR. BhNiaR is composed of an N-terminal DNA-binding domain (magenta) and a C-terminal 3H domain (blue). A zinc ion is shown in green. (c) The dimeric structure of apo BhNiaR generated by crystallographic symmetry. The figure was generated using the computer program PyMol (Version 2.3.2, Schrödinger, LLC, https://www.pymol.org). We determined the crystal structures of BhNiaR with apo and niacin-bound forms. A zinc ion was included in both the apo and niacin-bound models. The presence of the zinc was confirmed by an inductively coupled plasma mass spectrometer (ICP-MS). The structural data of BhNiaR provides details of metal binding and ligand interaction. DNA binding affinity of BhNiaR depending on niacin or metal ions was assessed by electrophoretic mobility shift assay (EMSA). Results and discussion Model building and quality The apo crystal structure of BhNiaR was refined to 2.0 Å resolution with crystallographic Rwork and Rfree values of 20.18% and 22.78%, respectively. Although the refined model contained a subunit in an asymmetric unit composed of 173 residues with a zinc ion and 129 water molecules, it could be generated to a homo-dimeric structure by a symmetric subunit. The N-terminal domain is composed of residues 7–70 and C-terminal domain is composed of residues 71–179. The N-terminal region (residues 1–6), the linker loop region (residues 68–74) connecting the N- and C-terminal domains, and the internal region (residues 137–147) in the C-terminal domain were poorly ordered due to lack of electron-density maps. The niacin-bound BhNiaR crystals were grown by co-crystallization with 2 mM niacin. The structure of the niacin-bound form was determined at 1.8 Å resolution and refined to crystallographic Rwork and Rfree of 19.43% and 24.26%, respectively. The refined model of niacin-bound BhNiaR also contained a subunit with interpretable residues 7–179 in an asymmetric unit. The N-terminus (residues 1–6), the linker loop region (residues 68–74), and the internal region (residues 137–145) in the C-terminal domain were poorly ordered. A niacin molecule was located near a zinc ion and surrounded by a hydrophobic pocket close to the dimeric interface. All refined models for BhNiaR indicated favored or allowed regions of the Ramachandran plot. The detailed refinement statistics are summarized in Table 1.Table 1 Data collection and refinement statistics. Data set Apo Niacin-bound Data collection statistics Space group P43212 P43212 Unit-cell parameters  a, b, c (Å) 42.37, 42.37, 176.2 42.25, 42.25, 176.0  α, β, γ (°) 90.00, 90.00, 90.00 90.00, 90.00, 90.00 Wavelength (Å) 0.97941 0.97941 Resolution (Å) 50.0–2.00 (2.03–2.00) 50.00–1.80 (1.83–1.80) Number of observations 153,177 111,246 Unique reflections 11,730 15,404 Data completeness (%) 99.9 (100) 97.8 (99.9) Redundancy 13.1 (13.6) 7.2 (7.9) Average I/σ(I) 23.21 (9.60) 20.02 (5.98) Rmerge (%)a 11.1 (40.1) 7.5 (35.2) Refinement statistics Resolution (Å) 20.0–2.00 20.0–1.80 Rwork/Rfree (%) 20.18/22.78 19.43/24.26 No. of non-H atoms 1484 1513  Protein 1354 1354  Ligands 1 (Zn2+) 10 (Zn2+, Niacin)  Water 129 149 rmsd bonds (Å) 0.003 0.003 rmsd angles (°) 0.513 0.592 Average B-factor 34.68 33.64  Protein 34.41 32.58  Ligands 43.95 33.59  Water 37.47 43.34 Ramachandran plot (%)  Favored 98.47 98.84  Allowed 1.74 1.16  Outliers 0 0 Values in parentheses refer to the highest resolution shell. aRmerge = ΣhΣi|I(h)i −  < I(h) >|/ΣhΣiI(h)i, where I(h) is the intensity of reflection h, Σh is the sum over all reflections, and Σi is the sum over i measurements of reflection h. Overall structures of the B. halodurans NiaR Each BhNiaR structure was composed of two domains, an N-terminal DNA-binding domain (residues 1–70) and a C-terminal dimerization/substrate-binding 3H domain (residues 71–179), connected by a flexible loop (residues 66–75) (Fig. 1b). The N-terminal domain contained three α-helices and a pair of anti-parallel β-stands, which form a helix-turn-helix DNA-binding motif. The helix α2 and α3 of the helix-turn-helix motif was generally known as the site of DNA recognition and was well conserved in NiaR homologues. The C-terminal domain contained three α-helices and four anti-parallel β-stands, forming layered α-helices and β-stands of the 3H domain with an order of secondary structural elements in βαββαβα, which is a feature of histidine-containing phosphor-carrier (HPr)-like proteins. Three highly conserved histidines (His83, His150, and His152) and a glutamate (Glu91) form a binding site for the zinc ion and niacin. A dimeric BhNiaR structure was generated by a crystallographic twofold symmetry (Fig. 1c and Fig. S1). The buried surface area of the dimer is about 1990 Å2, approximately 19% of the monomer surface area (PDBePISA protein–protein interaction server: http://www.ebi.ac.uk/msd-srv/prot_int/). The dimeric structure is stabilized by the hydrogen bonds and hydrophobic interactions centered around a faced β5 strand forming an anti-parallel sheet; 22 residues are involved in hydrophobic interactions and 13 residues are involved in hydrogen bonds (PDBsum: http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/Generate.html). The dimer interface is mainly produced by hydrophobic residues, which are highly conserved through NiaR family proteins, such as Val42, Ser48, Leu49, Ala59, Thr60, Ala61, Val78, Val111, Tyr112, Gly113, Ile115, Thr116, Ala117, Ser118, Leu119, Phe130, Met134, Leu141, Val149, Met151, Leu176, and Phe179. Thirteen hydrogen bonds were formed between Glu10 Oε2 and Ser178 Oγ, between Gln41 Nε2 and Thr146 O, between Lys51 Nz and Asp114 Oδ2, between Ala59 N and Asp114 Oδ2, between Ala59 O and Asp114 N, between Tyr64 Oη and Asp108 Oδ2, between Val111 O and Arg133 Nη2, between Asp114 O and Ser118 N, and between Thr116 N and Thr116 O. This finding demonstrated that BhNiaR exists as a functional dimer in solution. A dimer is also consistent with results from size-exclusion chromatography with multi-angle light scattering (SEC-MALS) (Fig. S2). The niacin-bound structure of BhNiaR is almost identical to the apo structure with a root-mean-square deviation (r.m.s.d.) value of 0.2 Å. The most noticeable structural difference was the loop region between the N-terminal and C-terminal domains (Fig. S3). Metal-binding site Previous work suggested Ni2+, Cu2+, or Zn2+ as the most probable metals in the TmNiaR structure based on coordination geometry, anomalous difference Fourier peaks, refinement results, and similar ligating residues in the Metalloprotein Database14,19. A zinc ion fully occupied the metal-binding site in the apo and niacin-bound forms of BhNiaR, which was confirmed by ICP-MS and also was verified by a peak on an omit map at the counter levels even at 9σ (Fig. S4). In addition, a nickel ion was partially occupied with BhNiaR (~ 5%). The zinc ion is located between layered α-helices and a β-sheet of the C-terminal domain. The metal-binding site appeared to be fully occupied, with the temperature factors for a zinc ion being 43.95 Å2 and 22.81 Å2 in the apo and niacin-bound forms, respectively. In the apo structure of TmNiaR, it has been reported that four conserved residues (His79, Glu87, His146, and His148) and a water molecule coordinated with a nickel ion in octahedral geometry14. However, in the apo structure of BhNiaR, three residues (Glu91, His150, and His152), corresponding to TmNiaR residues (Glu87, His146, and His148), and a water molecule coordinated with a zinc ion in tetrahedral geometry: Glu91 Oε1, His150 Nε1, His152 Nε2, and Wat108 O. The His83 residue was not involved directly in metal coordination, with a distance of 3.8 Å. In addition, in the niacin-bound structure, the coordinated water molecule was replaced by a carboxyl oxygen (O2) of the niacin molecule and the His83 residue formed a hydrogen bond with a second carboxyl oxygen (O1) of the niacin molecule (Fig. 2).Figure 2 Metal and niacin-binding sites in Bacillus halodurans NiaR. (a) The metal-binding site of apo BhNiaR. Coordination with the zinc ion (green) and distances between the zinc and the residues (blue) of metal-binding sites are shown in yellow. In addition, a water molecule (red) coordinates with the zinc ion and forms a tetrahedral geometry. In contrast to TmNiaR, the His83 is too distant to coordinate with the zinc ion. The distance between the zinc and His83 is shown in gray. (b) The metal-binding site of niacin-bound BhNiaR. The residues are shown in cyan. The niacin (orange) coordinates with the zinc ion instead of the water molecule and interacts with the His83 residue. (c) The metal-binding site of apo TmNiaR. Residues of the metal-binding site are shown in yellow. His79 coordinates with the nickel ion (light blue) and forms an octahedral geometry. (d) Electrostatic surface diagram of BhNiaR. The blue areas represent positive electrostatic regions and red areas represent negative electrostatic regions. Niacin is bound to the C-terminal domain of BhNiaR. (e) Niacin is surrounded by well-conserved hydrophobic residues (cyan) in the C-terminal domain of BhNiaR. The hydrophobic residues make a hydrophobic pocket and van der Waals attractions with niacin (Met88, Leu92, Phe130, Met134, Leu141, Leu142, and Tyr112′). The symmetry-related Tyr112 is colored gray. The figure was generated using the computer program PyMol (Version 2.3.2, Schrödinger, LLC, https://www.pymol.org). Niacin-binding site A niacin molecule is bound to the C-terminal domain of BhNiaR near the metal-binding site. The pyridine moiety of niacin is buried in a hydrophobic pocket surrounded by highly conserved residues (Met88, Leu92, Val105, Leu119, Phe130, Met134, Leu141, Leu142, and Tyr112′) (Fig. 2d,e). The carboxyl group of niacin is located at the position of the water molecule near the zinc ion in apo form. Therefore, the O1 and O2 atoms of the niacin carboxyl group coordinated with His83 Nε2 and the zinc ion, respectively. Coordination of the carboxyl group with the zinc ion and the hydrogen bond with the His83 residue contributed to the stability of niacin binding, as did van der Waals attractions involving nonpolar residues (Met88, Leu92, Phe130, Met134, Leu141, Leu142, and Tyr112′). DNA binding affinity NiaR binds to the promoter region containing the consensus sequence in the presence of niacin6. The DNA motif of NiaR proteins is classified into two distinct types. Type I contains the consensus sequence, TGT-N4-ACA, characterized in the Fusobacteria lineage and the Bacillus/Clostridium groups. Type II contains consensus sequence, ACA-N5-TGT, found in the Thermotogales lineage. DNA-binding affinities of type I and II DNA motifs have been investigated by EMSA using NiaR proteins from B. subtilis and T. maritima6. To confirm the DNA-binding affinity of BhNiaR with its predicted cognate DNA segments, we performed EMSA using the type I DNA, 34-bp oligonucleotide (5′–CTCATTTACAT ATGTCTTGACATCTATATTTACA–3′) containing the nifS-nadB promoter region. The DNA was mixed with various amount of BhNiaR either in the absence or presence of niacin. BhNiaR bound to its cognate DNA with a dissociation constant (Kd) of ~ 0.5 µM in the presence of niacin, whereas the DNA-binding ability was decreased in the absence of niacin (Fig. 3a). BhNiaR moderately reduced DNA-binding to non-cognate sequences either with or without niacin (Fig. 3b). These results are consistent with homologous NiaR proteins from B. subtilis and T. maritima6.Figure 3 Electrophoretic mobility shift assay (EMSA) of DNA-binding affinity of Bacillus halodurans NiaR. The DNA fragments (80 nM) were incubated with BhNiaR (0–3 µM) for 30 min at 277 K with or without niacin (1 mM). The experiments were repeated twice, and representative results are shown. EMSA was performed with the cognate DNA (a) and non-cognate DNA (b) of BhNiaR. (c) The BhNiaR H152A mutant, in which the metal-binding residue is mutated, was incubated with cognate DNA in the presence or absence of niacin. The absence of a zinc ion in BhNiaR caused a significant decrease in the DNA-binding affinity of BhNiaR. To further assess whether the metal ion affects the DNA-binding affinity of BhNiaR, a BhNiaR H152A mutant was generated by site-directed mutagenesis resulting in metal-free BhNiaR, which was confirmed by an ICP-MS. The BhNiaR H152A mutant showed a severe defect in DNA-binding affinity regardless of the presence or absence of niacin (Fig. 3c). These results indicate that the metal ion, as well as niacin, plays an important role in DNA binding. Structural comparison to other NiaR homologues The structure of BhNiaR was compared with a NiaR homologue (TM1602) in T. maritima (PDB code 1J5Y; r.m.s.d. of 2.2 Å for 108 equivalent Cα positions in residue 63–172 of BhNiaR, a Z-score of 17.7, and a sequence identity of 38%). Although their N- and C-terminal domains were well matched structurally (r.m.s.d. 1.3 Å and 1.2 Å, respectively), the domain arrangements were different. When the C-terminal domains were superimposed, the N-terminal domain of BhNiaR was rotated approximately 170° at the center of the flexible linker region (residues 64–72), compared with that of TmNiaR (Fig. S5). The rotation angle and hinge axes were analyzed using the program Dyndom20. The N-terminal domains of BhNiaR were positioned horizontally with their C-terminal domains and the helix-turn-helix motifs were located in the opposite direction. In addition, the protein–protein interaction of the dimer conformation of BhNiaR was different from TmNiaR. BhNiaR formed a dimer between the C-terminal domains as well as between the N-terminal domain of one subunit and the C-terminal domain of the other subunit, whereas TmNiaR formed a dimer through the C-terminal domains alone. The apo and niacin-bound forms of BhNiaR are almost identical. These structural arrangements made it difficult to bind DNA because the N-terminal DNA-binding domains were located at both sides of the C-terminal domains and the helix-turn-helix motifs were not exposed for binding to DNA. The distance between the recognition helices α3 (at residue Arg38) in the TmNiaR dimer was 40 Å, whereas in BhNiaR (at residue Arg40) the distance was 57 Å (Fig. S6). It seems that both the apo and niacin-bound BhNiaR structures display non-DNA bound conformations because of the crystal packing and interactions between the N- and C-terminal domains of each subunit in the dimer. In order to obtain the biologically relevant structure for BhNiaR, the DNA-bound form is required. Conclusion The crystal structures of the niacin-responsive repressor, BhNiaR, which negatively regulates the expression of genes involved in the NAD+ synthesis pathway, were determined to be the apo and niacin-bound forms. Our results show the coordination of a zinc ion and the binding of the effector molecule, niacin, in the NiaR structure. In the apo form, the zinc ion is coordinated by three residues (Glu91, His150, and His152) conserved in HPr-like proteins with a water molecule in tetrahedral geometry. Another conserved residue, His83, is not involved in zinc ion coordination but is involved in niacin binding. The niacin bound to the C-terminal domain of BhNiaR is located near a zinc ion, His83, and a well-conserved hydrophobic pocket. Both the niacin and the metal ion cooperatively affect DNA-binding affinity of BhNiaR, and the EMSA results show that the absence of a metal ion causes a significant defect in the DNA-binding affinity of BhNiaR. Materials and methods Cloning, expression, and purification The niaR genes were amplified by polymerase chain reaction (PCR) using genomic DNA of B. halodurans as a template. The amplified niaR genes were inserted into the NheI/XhoI-digested expression vector pET-28b(+) (Novagen), resulting in a hexahistidine-containing tag (His-tag) at its N-terminus with a PreScission protease cleavage site. The recombinant niaR genes were transformed in Escherichia coli BL21 (DE3) star pLysS cells (Invitrogen). The transformed cells were grown at 310 K to an OD600 of ~ 0.5 in Luria–Bertani medium and overexpression of BhNiaR protein was induced continuously with 1.0 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 4 h at 303 K. After the cells were collected by centrifugation at 4200g for 10 min at 277 K, the pellets were immediately frozen at 193 K. The frozen pellets were placed in a lysis solution containing buffer A (20 mM Tris–HCl, pH 8.0, 0.5 M NaCl, 10% (v/v) glycerol) and 1 mM phenylmethylsulfonyl fluoride, homogenized by an ultrasonic processor (Sonics Vibra Cell, VCX750) and separated from the insoluble fraction by centrifugation at 31,000g for 60 min at 277 K. The recombinant BhNiaR protein in soluble fraction was loaded on a nickel-charged His-trap immobilized metal affinity chromatography (IMAC) column (GE Healthcare, UK) and eluted with buffer B (20 mM Tris–HCl, pH 8.0, 0.5 M NaCl, 10% (v/v) glycerol, and 300 mM imidazole). Enzymatic removal of the His-tag from the BhNiaR proteins was achieved by overnight incubation with PreScission protease. The uncleaved His-tagged proteins were removed from the native proteins by applying to a nickel-charged His-trap IMAC. The next purification step was size-exclusion chromatography on a Superdex-75 column (GE healthcare) with elution buffer (20 mM Tris–HCl, pH 8.0, 0.2 M NaCl, 5% (v/v) glycerol, 1 mM dithiothreitol and 1 mM MgCl2). The purified BhNiaR protein was concentrated to 15 mg ml−1 using Centricon YM-10 (Millipore). Site-directed mutagenesis Site-directed mutagenesis of BhNiaR was performed by PCR using a recombinant plasmid containing the wild-type niaR gene as a template. Two complementary primers were designed such that the encoded His152 (CAC) was replaced by GCA-encoded alanine (Forward primer: 5′–GTGTTCATATGGCAACGTTAGAAGC–3′, and Reverse primer: 5′–GCTTCTAACGTTGCCATATGAACAC–3′). PCR products were treated with DpnI for digestion of preexisting recombinant plasmids containing the wild-type niaR gene. PCR products were introduced into E. coli DH5α, and then the mutant plasmids were isolated and purified from the cells. The mutated niaR sequence was confirmed by DNA sequencing (Macrogen, Republic of Korea). Crystallization and X-ray data collection Initial crystallization of the BhNiaR protein was performed by the sitting-drop vapor diffusion method using a 96-well crystallization plate (SWISSCI MRC, UK) and commercial screening solution from Hampton Research, Qiagen and Emerald Biosystems at 296 K. Each sitting-drop was prepared by mixing 0.75 μl of the concentrated protein and reservoir solution, respectively. The BhNiaR protein grew as two forms of crystals, apo form and niacin-bound form. Crystals of apo BhNiaR were obtained in 2% (v/v) tacsimate, pH 6.0, 0.1 M Bis–Tris, pH 6.5, and 20% (v/v) PEG 3350 solution and were grown to 0.05 × 0.1 × 0.05 mm within 2 weeks. Crystals of niacin-bound BhNiaR were obtained by co-crystallization with 2 mM niacin and were grown in 0.1 M Tris–HCl, pH 8.5, and 15% (v/v) PEG 6000 solution. Each crystal was transferred into a cryo-protectant solution containing 20% (v/v) glycerol in the reservoir solution and then flash-cooled in liquid nitrogen. X-ray diffraction data of apo and niacin-bound crystals of BhNiaR were collected at 100 K and at the wavelength, 0.97941 Å, using synchrotron radiation of the Pohang Accelerator Laboratory in Korea. Diffraction data were collected with a Pilatus 6 M detector on 11C Micro-MX beamline for the apo form and with an ADSC Q315r CCD detector on 5C-SBII beamline for the niacin-bound form. The crystals were exposed to X-rays for 1.0 s per image, and 270 frames (apo) and 100 frames (niacin-bound) were obtained with each 1.0° oscillation. The data were processed and scaled with DENZO and SCALEPACK of HKL2000 software21,22. Structure determination and refinement The crystal structures of both forms of BhNiaR were solved by molecular replacement using the program PHASER MR from the CCP4 program suite23 using the TmNiaR structure (PDB code 1J5Y) as a search model14. The structures of apo and niacin-bound forms built by COOT24 and were refined by PHENIX. All refined structures of BhNiaR were evaluated by MolProbity25 and have been deposited in the Protein Data Bank. The figure was generated using the computer program PyMol (Version 2.3.2, Schrödinger, LLC, https://www.pymol.org)26. The refinement statistics of BhNiaR are shown in Table 1. Electrophoretic mobility shift assay To confirm the DNA-binding affinity of BhNiaR, 34-bp double-stranded DNA (Forward : 5′–CTCATTTACATATGTCTTGACATCTATATTTACA–3′ and Reverse : 5′–TGTAAATA TAGATGTCAAGACATATGTAAATGAG–3′) containing own promoter region (nifS-nadB) was prepared by Oligo Synthesis (Macrogen, Republic of Korea). The reaction mixture was made by mixing the native BhNiaR (0–3 µM) and the reaction buffer (20 mM Tris, pH 8.0, 100 mM KCl, 1 mM MgCl2, 1 mM dithiothreitol, and 5% (v/v) glycerol with or without 1 mM niacin) prior to mixing the double-stranded DNA (80 nM). All reaction mixtures were incubated for 30 min at room temperature, after which each mixture was loaded on a pre-chilled 6% native polyacrylamide gel in 0.5 X Tris–Borate, pH 8.3. Electrophoresis was performed at 277 K and the gel was visualized using SYBR Green (ThermoFisher Scientific). Size-exclusion chromatography with multi-angle light scattering (SEC-MALS) SEC-MALS experiments were performed using a fast protein liquid chromatography system (GE Healthcare) connected to a Wyatt DAWN Heleos II instrument and a Wyatt Optilab T-Rex differential refractometer. A Superdex-200 10/300 GL (GE Healthcare) gel filtration column pre-equilibrated with 20 mM Tris–HCl (pH 8.0), 200 mM NaCl, and 1 mM DTT was normalized using ovalbumin (40 kDA) as the protein standard. The BhNiaR protein was injected (10–12 mg ml−1, 0.1 ml) at a flow rate of 0.5 ml min−1. The data were evaluated using the Zimm model for static light-scattering data fitting and represented using an EASI graph with a UV peak in the ASTRA V software (Wyatt). Accession numbers Coordinate and structure factors have been deposited in the Protein Data Bank (PDB): apo BhNiaR, PDB ID, 7CV0; Niacin-bound BhNiaR, PDB ID, 7CV2. Supplementary information Supplementary Figures. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. These authors contributed equally: Dong Won Lee and Young Woo Park. Supplementary information is available for this paper at 10.1038/s41598-020-78148-x. Acknowledgements We thank the staff members at the Pohang Accelerator Laboratory beamlines 5C and 11C for their help with data collection; the Korea Basic Science Institute for SEC-MALS and ICP-MS. This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korean Government (2020R1F1A1072808); and the Agriculture Research Center (ARC) program of the Ministry for Agriculture, Food, and Rural Affairs, Korea (710013-03-1-SB120). Author contributions D.W.L., Y.W.P., and J.Y.L. conceived and designed the research. D.W.L. and Y.W.P. contributed equally. M.Y.L. and K.W.J. contributed to data collection and analysis of the results. D.W.L., Y.W.P., and J.Y.L. wrote the manuscript with the help of comments from all authors. Data availability All data are fully available without restriction. Competing interests The authors declare no competing interests. ==== Refs References 1. Begley TP Kinsland C Mehl RA Osterman A Dorrestein P The biosynthesis of nicotinamide adenine dinucleotides in bacteria Vitam. Horm. 2001 61 103 119 10.1016/S0083-6729(01)61003-3 11153263 2. Magni G Amici A Emanuelli M Raffaelli N Ruggieri S Enzymology of NAD+ synthesis Adv. Enzymol. Relat. Areas Mol. Biol. 1999 73 135 182 10218108 3. Belenky P Bogan KL Brenner C NAD+ metabolism in health and disease Trends Biochem. Sci. 2007 32 12 19 10.1016/j.tibs.2006.11.006 17161604 4. Osterman, A. Biogenesis and homeostasis of nicotinamide adenine dinucleotide cofactor. EcoSal Plus. (2009). 10.1128/ecosalplus.3.6.3.10. 5. Teramoto H Suda M Inui M Yukawa H Regulation of the expression of genes involved in NAD de novo biosynthesis in Corynebacterium glutamicum Appl. Environ. Microbiol. 2010 76 5488 5495 10.1128/AEM.00906-10 20601509 6. Rodionov DA Transcriptional regulation of NAD metabolism in bacteria: genomic reconstruction of NiaR (YrxA) regulon Nucleic Acids Res. 2008 36 2032 2046 10.1093/nar/gkn046 18276644 7. Sorci L Nicotinamide mononucleotide synthetase is the key enzyme for an alternative route of NAD biosynthesis in Francisella tularensis Proc. Natl. Acad. Sci. U. S. A. 2009 106 3083 3088 10.1073/pnas.0811718106 19204287 8. Gerasimova AV Gelfand MS Evolution of the NadR regulon in Enterobacteriaceae J. Bioinform. Comput. Biol. 2005 3 1007 1019 10.1142/S0219720005001387 16078372 9. Grose JH Bergthorsson U Roth JR Regulation of NAD synthesis by the Trifunctional NadR Protein of Salmonella enterica J. Bacteriol. 2005 187 2774 2782 10.1128/JB.187.8.2774-2782.2005 15805524 10. Penfound T Foster JW NAD-dependent DNA-binding activity of the bifunctional NadR regulator of Salmonella typhimurium J. Bacteriol. 1999 181 648 655 10.1128/JB.181.2.648-655.1999 9882682 11. Kurnasov OV Ribosylnicotinamide kinase domain of NadR protein: identification and implications in NAD biosynthesis J. Bacteriol. 2003 185 698 698 10.1128/JB.185.2.698.2003 12. Rodionov DA Transcriptional regulation of NAD metabolism in bacteria: NrtR family of Nudix-related regulators Nucleic Acids Res. 2008 36 2047 2059 10.1093/nar/gkn047 18276643 13. Huang N Structure and function of an ADP-ribose-dependent transcriptional regulator of NAD metabolism Structure 2009 17 939 951 10.1016/j.str.2009.05.012 19604474 14. Weekes D Crystal structure of a transcription regulator (TM1602) from Thermotoga maritima 2.3 at resolution Proteins 2007 67 247 252 10.1002/prot.21221 17256761 15. Sun D Setlow P Cloning, nucleotide sequence, and regulation of the Bacillus subtilis nadB gene and a nifS-like gene, both of which are essential for NAD biosynthesis J. Bacteriol. 1993 175 1423 1432 10.1128/JB.175.5.1423-1432.1993 8444804 16. Afzal M Kuipers OP Shafeeq S Niacin-mediated gene expression and role of NiaR as a transcriptional repressor of niaX, nadC, and pnuC in Streptococcus pneumoniae Front. Cell Infect. Microbiol. 2017 7 70 10.3389/fcimb.2017.00070 28337428 17. Rossolillo P Marinoni I Galli E Colosimo A Albertini AM YrxA is the transcriptional regulator that represses de novo NAD biosynthesis in Bacillus subtilis J. Bacteriol. 2005 187 7155 7160 10.1128/JB.187.20.7155-7160.2005 16199587 18. Anantharaman V Koonin EV Aravind L Regulatory potential, phyletic distribution and evolution of ancient, intracellular small-molecule-binding domains J. Mol. Biol. 2001 307 1271 1292 10.1006/jmbi.2001.4508 11292341 19. Castagnetto JM MDB: the metalloprotein database and browser at The Scripps Research Institute Nucleic Acids Res. 2002 30 379 382 10.1093/nar/30.1.379 11752342 20. Lee RA Razaz M Hayward S The DynDom database of protein domain motions Bioinformatics 2003 19 1290 1291 10.1093/bioinformatics/btg137 12835274 21. Otwinowski Z Minor W Processing of X-ray diffraction data collected in oscillation mode Methods Enzymol. 1997 276 307 326 10.1016/S0076-6879(97)76066-X 22. Minor W Cymborowski M Otwinowski Z Chruszcz M HKL-3000: the integration of data reduction and structure solution—from diffraction images to an initial model in minutes Acta Crystallogr. D Biol. Crystallogr. 2006 62 859 866 10.1107/S0907444906019949 16855301 23. McCoy AJ Phaser crystallographic software J. Appl. Crystallogr. 2007 40 658 674 10.1107/S0021889807021206 19461840 24. Emsley P Cowtan K Coot: model-building tools for molecular graphics Acta Crystallogr. D Biol. Crystallogr. 2004 60 2126 2132 10.1107/S0907444904019158 15572765 25. Rosenzweig AC Metallochaperones: bind and deliver Chem. Biol. 2002 9 673 677 10.1016/S1074-5521(02)00156-4 12079778 26. Schrödinger, LLC. The PyMOL Molecular Graphics System. Version1.8 (2015)