==== Front J Fungi (Basel) J Fungi (Basel) jof Journal of Fungi 2309-608X MDPI 33050545 10.3390/jof6040215 jof-06-00215 Article Insights into the Multi-Azole Resistance Profile in Candida haemulonii Species Complex https://orcid.org/0000-0003-3469-4672Silva Laura Nunes 1 Ramos Lívia de Souza 1 Oliveira Simone Santiago Carvalho 1 Magalhães Lucas Barros 1 Squizani Eamim Daidrê 2 Kmetzsch Lívia 2 https://orcid.org/0000-0002-3914-2300Vainstein Marilene Henning 2 https://orcid.org/0000-0002-9752-8148Branquinha Marta Helena 1 https://orcid.org/0000-0003-0821-8592dos Santos André Luis Souza 13* 1 Laboratório de Estudos Avançados de Microrganismos Emergentes e Resistentes (LEAMER), Departamento de Microbiologia Geral, Instituto de Microbiologia Paulo de Góes (IMPG), Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro 21941-901, Brazil; lauransilva@gmail.com (L.N.S.); liviaramos2@yahoo.com.br (L.d.S.R.); simonesantiagorj@yahoo.com.br (S.S.C.O.); lbarrosmagalhaes@gmail.com (L.B.M.); mbranquinha@micro.ufrj.br (M.H.B.) 2 Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, Rio Grande do Sul 91540-000, Brazil; eamimsquizani@gmail.com (E.D.S.); liviak@cbiot.ufrgs.br (L.K.); mhv@cbiot.ufrgs.br (M.H.V.) 3 Programa de Pós-Graduação em Bioquímica (PPGBq), Instituto de Química (IQ), Universidade Federal do Rio de Janeiro (UFRJ), Rio de Janeiro 21941-909, Brazil * Correspondence: andre@micro.ufrj.br; Tel.: +55-21-3938-0366 11 10 2020 12 2020 6 4 21515 9 2020 08 10 2020 © 2020 by the authors.2020Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).The Candida haemulonii complex (C. duobushaemulonii, C. haemulonii, and C. haemulonii var. vulnera) is composed of emerging, opportunistic human fungal pathogens able to cause invasive infections with high rates of clinical treatment failure. This fungal complex typically demonstrates resistance to first-line antifungals, including fluconazole. In the present work, we have investigated the azole resistance mechanisms expressed in Brazilian clinical isolates forming the C. haemulonii complex. Initially, 12 isolates were subjected to an antifungal susceptibility test, and azole cross-resistance was detected in almost all isolates (91.7%). In order to understand the azole resistance mechanistic basis, the efflux pump activity was assessed by rhodamine-6G. The C. haemulonii complex exhibited a significantly higher rhodamine-6G efflux than the other non-albicans Candida species tested (C. tropicalis, C. krusei, and C. lusitaneae). Notably, the efflux pump inhibitors (Phe-Arg and FK506) reversed the fluconazole and voricolazole resistance phenotypes in the C. haemulonii species complex. Expression analysis indicated that the efflux pump (ChCDR1, ChCDR2, and ChMDR1) and ERG11 genes were not modulated by either fluconazole or voriconazole treatments. Further, ERG11 gene sequencing revealed several mutations, some of which culminated in amino acid polymorphisms, as previously reported in azole-resistant Candida spp. Collectively, these data point out the relevance of drug efflux pumps in mediating azole resistance in the C. haemulonii complex, and mutations in ERG11p may contribute to this resistance profile. azole resistanceefflux pumpsfluconazolelanosterol 14α-demethylasenon-albicans Candida speciesvoriconazole ==== Body 1. Introduction The recently described Candida haemulonii clade has caused deep concerns in hospital environments worldwide, since its members are able to cause life-threatening infections presenting high rates of clinical treatment failures [1]. The C. haemulonii clade is composed of emerging, opportunistic, and multidrug-resistant species formed by C. auris, C. duobushaemulonii, C. haemulonii sensu stricto, C. haemulonii var. vulnera, C. pseudohaemulonii, and C. vulturna [1,2]. Candida duobushaemulonii, C. haemulonii, and C. haemulonii var. vulnera, which form the C. haemulonii complex, have been identified in different geographic regions in the globe, prominently in Latin American (e.g., Brazil) and Asian (e.g., India and China) countries. However, not surprisingly Coles et al. [3] highlighted the possible emergence of these fungal pathogens also in the United States of America. This fungal complex is often associated with bloodstream infections, onychomycosis, vaginal infections, catheter-related fungemia, and outbreaks in neonatal intensive care units [3,4,5,6,7,8,9]. In Brazil, most of the studies reported candidemia by the C. haemulonii species complex, associated with high antifungal resistance profiles [10,11,12,13]. Since phenotypic identification methods cannot accurately distinguish among these species, the prevalence of C. haemulonii species complex in hospital settings may be underestimated. In this sense, a 10.5-year analysis conducted between 1997 and 2007 by the ARTEMIS DISK Global Antifungal Surveillance Study demonstrated that infections caused by C. haemulonii were rare (less than 0.01%) at that moment [14]. In 2012, C. haemulonii was identified as the third cause of candidemia in a hospital in New Delhi, India, corresponding to 15.5% of the cases [15]. Lately, Xiao et al. [16] reported surveillance results on candidemia from 77 Chinese hospitals, where the prevalence of C. haemulonii rose from 0.6% to 0.9% in the 3-year investigation period (2015–2017). Additionally, a recent study from Brazil demonstrated an increased prevalence of the C. haemulonii species complex from 0.9% in the first period of the analysis (2008-2013) to 1.7% in the second period (2014-2019) [17]. The C. haemulonii species complex typically demonstrates resistance to amphotericin B (AMB) and fluconazole as well as a variable susceptibility to the novel azoles (e.g., voriconazole, posaconazole, and isavuconazole) and echinocandins (e.g., caspofungin, micafungin, and anidulafungin) [18,19,20]. Recently, our research group described primary evidence suggesting that resistance to AMB is due to multifactorial events displayed by the species belonging to the C. haemulonii complex, including reduced ergosterol content located in the plasma membrane, mitochondrial dysfunction, resistance to oxidative stressors, and the upregulation of the antioxidant machinery [21]. Fluconazole is the most widely used antifungal agent in hospital settings for both treatment and prophylaxis approaches. However, fluconazole resistance is particularly prominent in the C. haemulonii species complex, with most of the clinical isolates presenting a typical resistant profile to this triazole antifungal [18,20]. The main mechanism of action of azole antifungals involves the blockage of the ergosterol synthesis pathway in fungal cells, specifically by inhibiting the lanosterol 14α-demethylase, an enzyme encoded by the ERG11 gene. The lanosterol 14α-demethylase (ERG11p) inhibition leads to the accumulation of aberrant sterol intermediates at the plasma membrane, inducing severe toxic effects that culminate in the interruption of fungal growth. Mutations in the ERG11 gene are one of the most important mechanisms described for azole resistance in Candida spp. [22]. Nevertheless, it is well known that a fungus can orchestrate more than one mechanism of action in order to become resistant to azoles, including the upregulation of the ERG11 gene and the overexpression of efflux pumps mainly encoded by multidrug-resistance (MDR) and candida drug resistance (CDR) genes [22]. Although recent studies have suggested that mutations in the ERG11 gene lead to the production of altered ERG11p in C. auris [23,24], an analysis of the genomic and transcriptomic data of C. haemulonii clade also impute the upregulation of the CDR1 gene as an important mechanism explaining azole resistance [23,24,25]. Thus far, no C. auris, C. pseudohaemulonii, and C. vulturna isolates has been described in Brazil. Since many reports have suggested intrinsic resistance to fluconazole and in vitro multidrug-resistance to azoles, we have examined the above-mentioned resistance mechanisms among 12 Brazilian clinical isolates of the C. haemulonii species complex. To accomplish this, we have evaluated the (i) in vitro susceptibility to different azoles; (ii) the efflux pump activity; (iii) the expression level of ERG11, MDR-like, and CDR-like genes; and (iv) mutations in the ERG11 gene, which support the alterations in ERG11p that is the azoles’ target. 2. Materials and Methods 2.1. Fungal Isolates and Culture Conditions Twelve clinical isolates of the C. haemulonii complex were used in this study: C. haemulonii (LIPCh2, LIPCh3, LIPCh4, LIPCh7, and LIPCh12), C. duobushaemulonii (LIPCh1, LIPCh6, LIPCh8, and LIPCh10), and C. haemulonii var. vulnera (LIPCh5, LIPCh9, and LIPCh11), identified by ITS gene sequencing, as previously described by our research group [10]. For a comparative purpose, three reference non-albicans Candida species were also used: C. tropicalis (ATCC 750), C. krusei (ATCC 6258), and C. lusitaniae (ATCC 200950). In all experiments, Sabouraud-dextrose medium was used to culture the fungal isolates at 37 °C for 48 h under constant agitation (200 rpm). Yeast cells were counted using a Neubauer chamber. 2.2. Antifungal Susceptibility Assay Antifungal susceptibility testing was performed according to the standardized broth microdilution technique described by the Clinical and Laboratory Standards Institute (CLSI) in document M27-A3 and interpreted according to document M27-A3 [26]. The tested antifungal drugs include fluconazole (FLC), itraconazole (ITC), ketoconazole (KTC), posaconazole (PSC), and voriconazole (VRC) (Sigma-Aldrich, USA). The minimum inhibitory concentration (MIC), modal MIC, geometric mean (GM)-MIC, MIC50, MIC90, median, and antifungal concentration range were calculated using Prism version 8 (GraphPad Software, USA). Until now, no species-specific clinical breakpoints are established for rare species regarding azole susceptibility both in CLSI and EUCAST. In this sense, the manuscripts focused on this fungal complex usually base their results on the CLSI breakpoints established for the Candida genus (CLSI document M27-A3) in order to have a minimum (even not precisely) parameter to interpret these data. The clinical breakpoints defined for Candida spp. were used for the interpretation of the MIC data as follows: susceptible (S) ≤8 mg/L, susceptible-dose dependent (S-DD) 16–32 mg/L, resistant (R) ≥64 mg/L for FLC; S ≤0.125 mg/L, S-DD 0.25–0.5 mg/L, R ≥1 mg/L for ITC; S ≤1 mg/L, S-DD 2 mg/L, R ≥4 mg/L for VRC. For PSC, the susceptibility breakpoint was considered 0.06 mg/L, determined by EUCAST for Candida spp. No interpretive criteria for KTC are available in either the CLSI or EUCAST documents. 2.3. Efflux Pump Activity To assess the ABC-type drug transporter activity of fungal cells, we evaluated the glucose-induced efflux of rhodamine 6G (R6G) (Sigma-Aldrich, USA) assay, as previously described [6,27]. Yeasts (107 cells/mL) were incubated with R6G (10 µM) to enable uptake under carbon source-depleted conditions for 60 min. Cells were washed in phosphate-buffered saline (PBS), and tubes with glucose-free PBS (control) and PBS supplemented with 100 mM of glucose were prepared to start R6G efflux. Finally, after 1 and 3 h of incubation with glucose at 37 °C, the cells were quantified in a flow cytometer (FACSCalibur, BD Bioscience, USA) and analyzed at 527 nm. Representative data from the 10,000 events analysis were shown and the results were expressed as the percentage of fluorescent cells (%FC). Fungal cells not stained with R6G were used as a negative control. In parallel, a different group was also pretreated for 1.5 h with FLC (64 mg/L) and VRC (16 mg/L) before the addition of R6G and glucose. 2.4. Chemosensitization Assay Combining Efflux Pump Inhibitors and Azoles The efflux pump inhibitors (EPIs), Phe-L-Arg-β-naphthylamine dihydrochloride (Phe-Arg) and tacrolimus (FK506) (Sigma-Aldrich, USA), were used in combination with FLC or VRC in order to determine if the antifungal activity could be enhanced [28]. MICs were developed in the presence of azole (64 to 0.125 mg/L) with and without the presence of each EPI at a concentration of 64 mg/L. All the systems were incubated for 48 h at 37 °C and the results were expressed as the lowest azole concentration that resulted in the total inhibition of visible fungal growth. 2.5. RNA Extraction After initial culture conditions (item 2.1), C. haemulonii isolate LIPCh4 (a pan-azole C. haemulonii sensu strictu isolate) was diluted to an initial inoculum of 107 cells/mL in fresh Sabouraud (20 mL) and then exposed to FLC at 64 mg/L or VRC at 16 mg/L for 1.5 h with shaking. Following drug exposure, the fungal cells were harvested for RNA isolation as previously described [29]. Complementary DNA (cDNA) was synthesized with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, Thermo Scientific, USA). 2.6. Quantitative Reverse Transcription-Polymerase Chain Reaction (RT-qPCR) RT-qPCR was undertaken to estimate the expression of the ChCDR1, ChCDR2, ChMDR1, and ChERG11 ortholog genes by C. haemulonii complex strains during FLC or VRC exposure (after 1.5 h of exposure). cDNA was analyzed by RT-qPCR with the StepOne™ Real-Time PCR System (Applied Biosystems™, Thermo Scientific, USA) and specific primers (Table 1). Universal SYBR green Supermix was used for PCRs according to the manufacturer’s recommendations. The 2−ΔΔCT method was used for the relative quantification of gene expression [30], and the data were normalized to the ACT1 (actin) gene expression. 2.7. Amplification and Sequencing of the ERG11 Gene The ERG11 gene encoding lanosterol 14α-demethylase was amplified and sequenced with specific primers (Table S1). The BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA) was used for sequencing the reaction, precipitated with ethanol/EDTA/sodium acetate according to the protocol suggested by the manufacturer and sequenced on the ABI3730xl DNA Analyzer platform (Applied Biosystems, USA). DNA sequences and the corresponding amino acid sequences were analyzed with the SeqMan II and Bioedit software packages (Lasergene; DNAStar, USA). Consensus sequences were aligned with different reference ERG11 sequences from Candida spp. For the mutation analysis, the C. albicans strain SC5314 ERG11 gene assembly sequence from Candida Genome Database (http://www.candidagenome.org/) was used [31,32,33]. 2.8. Sequences Accessions The ERG11 gene sequences obtained from clinical isolates belonging to the C. haemulonii species complex studied herein were deposited in GenBank with the following accession numbers: MT860384 to MT860395. 2.9. Statistics All the experiments were performed in triplicate, in three independent experimental sets. The results were analyzed statistically by the Analysis of Variance One-Way ANOVA (comparisons between three or more groups). All the analyses were performed using the program GraphPad Prism8. In all analyses, p values of 0.05 or less were considered statistically significant. 3. Results 3.1. Azoles’ Susceptibility Profiles The MIC values determined for 12 clinical isolates forming the C. haemulonii species complex (C. haemulonii, n = 5 isolates; C. duobushaemulonii, n = 4; and C. haemulonii var. vulnera, n = 3) against five different azoles (FLC, ITC, KTC, PSC, and VRC) were summarized in Table 2 and Table S1. Among the tested azoles, PSC (GM-MIC = 0.62 mg/L) and KTC (GM-MIC = 1.49 mg/L) exhibited potent antifungal activity against all the isolates studied. Notably, all the fungal isolates had MICs of ≥64 mg/L for FLC. For ITC, a modal MIC of ≥16 mg/L was noted, suggesting that all the isolates were resistant to this antifungal. Despite some isolates remaining susceptible to VRC, the MIC distribution exhibited a peak at 16 mg/L, with 66% (n = 8) of isolates being resistant to this azole. Nine isolates (75%) were resistant to at least two different azoles. Six isolates (50%) were considered pan-azole resistant, of which four belong to the species C. haemulonii senso strictu, one belongs to C. duobushaemulonii, and one belongs to C. haemulonii var. vulnera. 3.2. Efflux Pumps Play a Primary Role in Azole Resistance in C. haemulonii Complex In this set of experiments, we firstly assessed the efflux pump activity by the extrusion of RG6. When compared with other non-albicans Candida species (C. tropicalis, C. lusitaniae, and C. krusei), C. haemulonii exhibited a significantly higher R6G efflux after 1 h (Figure 1) (Table S2). Analyzing the glucose-induced R6G efflux in the three different species forming the C. haemulonii complex, we could not observe statistical differences between them over 3 h (Figure 2). Interestingly, the efflux pump activities have been shown to be constitutively expressed within fungal cells, since the treatment with either FLC or VRC did not modulate the glucose-induced efflux of RG6 (Figure 2). Since it seems that efflux pump activities are constitutively present in the C. haemulonii complex, as the FLC and VRC treatment did not modify the R6G extrusion process, we next examined the expression of the genes coding for known azole transporters. In an effort to identify the efflux pump-encoding genes which could participate in the clinical azole resistance in the C. haemulonii species complex, CDR1-like, CDR2-like, and MDR1-like genes were identified by the BLAST approach using the recently updated genome of C. haemulonii (strain B11899), which presented the highest degree of homology genes to C. albicans. The C. haemulonii genes with the highest degree of homology to the C. albicans CDR1 and CDR2 genes were XM_025483931.1 and XM_025488660.1, here referred to as ChCDR1 and ChCDR2 (Table S2), respectively; the C. haemulonii gene with a greater degree of homology with the C. albicans MDR1 gene was XM_025488295.1, here referred to as ChMDR1 (Table S3). Our data showed that the ChCDR1, ChCDR2, and ChMDR1 genes were not modulated by the azole treatment (Figure 3). A similar result was observed considering the expression of the ERG11 gene (Figure 3). We then assessed the contribution of these transporters to azole sensitivity by blocking them with classical EPIs (Table 3). When the isolates were grown in the presence of a combination of an azole (FLC or VRC) plus an EPI (Phe-Arg or FK506), we can observe that the MIC decreased in a 4- to more than 64-fold range. Remarkably, all the tested fungal isolates reversed their resistance phenotypes with the addition of EPIs. 3.3. ERG11 Mutations and Gene Expression Analysis A phylogenetic tree of ERG11 genes and their putative orthologs in Candida spp. was built by the MEGAX program using the “Maximum likelihood” method, with the intent to identify their phylogenetic relationships (Figure 4). The tree based on a concatenated alignment of ERG11 genes places C. auris, C. haemulonii, C. duobushaemulonii, and C. pseudohaemulonii as a single clade, confirming the close relationship among these fungal species. Our phylogenetic analysis strongly supported that C. duobushaemulonii and C. pseudohaemulonii were more closely related and form a sister group of C. haemulonii, which appeared as the most branched species [23]. By comparing the amino acid sequences of ERG11p, 12 amino acid substitutions were identified in our isolates, all of them have been previously listed in the hot spot (HS) regions I, II, and III of ERG11p of C. albicans and C. auris (Figure 5) [23,35,36]. Of the 12 found substitutions in ERG11p, modifications at positions K119S were only present in C. haemulonii sensu stricto and C. haemulonii var. vulnera, whereas changes at positions R267T and A432S were only detected in C. duobushaemulonii isolates. 4. Discussion Drug resistance has become a major public health issue in terms of managing mainly invasive infections, particularly those resulting from pathogenic fungi that present scarce available effective drugs for treatment. Despite still being considered rare, infections by the C. haemulonii species complex have been highlighted by the high capability of developing multidrug-resistance against all clinically available antifungal classes, representing a challenge to the treatment of patients affected by these fungi. The majority of the studies has shown that isolates comprising the C. haemulonii complex demonstrated high MIC values for AMB and also frequently to azoles, all directly associated with clinical treatment failure [18,20]. In general, susceptibility to echinocandins, such as caspofungin and micafungin, in both in vitro and in vivo approaches have been observed [6,37,38]. However, there are already reports of resistance to this “novel” antifungal class in clinical isolates belonging to the C. haemulonii species complex [11,12]. Notably, we remain at the very beginning in understanding the biology of these “rare” fungal opportunistic human pathogens. Among the diversity of molecular mechanisms related to the antifungal resistance machinery orchestrated by fungal cells, the upregulation of the efflux pumps MDR1 and/or CDR1/CDR2 contributes to azole resistance in most clinical isolates of Candida spp. [39]. Our results align with Zhang et al. [24], who observed that the presence or absence of FLC treatment repeatedly demonstrated the upregulation of the multidrug transporter gene CDR1. Additionally, in that study, treatment of the azole-resistant C. haemulonii strains with EPIs partially restored their susceptibility to FLC, confirming the significant contribution of Cdr1p to azole resistance [24]. It is well known that EPIs, such as Phe-Arg and FK506, play a vital role in azole resistance reversal against C. albicans [40], C. glabrata [41], C. tropicalis [42], and C. auris [28]. Consistent with these findings, in the present study, the combination of Phe-Arg or FK506 with FLC or VRC showed synergism against all the resistant isolates forming the C. haemulonii complex. Hence, here we have provided important evidence of efflux pumps ruling the azole resistance phenotype in the C. haemulonii species complex. For many years, the imidazole KTC was the only available oral agent for the treatment of systemic fungal infections. Nevertheless, the side effects associated with KTC therapy as well as the the relatively poor response rates, led to the search for a novel chemical group of azole derivatives, namely the triazoles [43]. Overall, the triazoles demonstrate a broader spectrum of antifungal activity and reduced toxicity when compared with the imidazole derivatives [44]. PSC is a second-generation triazole agent that has been developed mainly to combat the appearance of azoles resistance in yeasts, in particular to FLC. Several in vitro and in vivo studies confirmed that PSC has a broad spectrum of activity against the majority of yeasts, filamentous fungi and azole-resistant Candida. Thus, PSC has a superior activity profile when compared with FLC and ITC [44]. For instance, one way of developing azole resistance is by acquiring mutations on the ERG11 gene. Depending on the position and the nature of the alteration, the reduced susceptibility can cause cross-resistance or just resistance to a subset of derivatives [44]. Although the role of ERG11 gene point mutations in azole resistance is a well-recognized phenomenon in Candida spp. [38], only recently a few studies have characterized the polymorphisms of the ERG11 gene in azole-resistant isolates of the C. hameulonii complex [2,13]. In the study of Gade et al. [2], an increasing azole resistance in isolates of C. haemulonii and C. duobushaemulonii was evidenced in Colombia, Panama, and Venezuela, associated with substitutions in the ERG11 gene, suggesting the existence of an evolutionary pressure for the development of azoles resistance in Latin America. In the present study, eight of the 12 ERG11 gene mutations have been reported to be associated with reduced azole susceptibility in C. albicans—namely, F105L, S110A, D116A, K119S, D153E, R267T, A432S, and F487Y. However, Erg11p substitutions F126L, Y132F, and K143R, which were implicated in reduced susceptibilities to azoles upon heterologous expression in S. cerevisiae [45,46], were not identified in our isolates. Corroborating our data, a recent study by Rodrigues et al. [13] again found that Brazilian resistant isolates of C. haemulonii var. vulnera also lacked these common mutations. Thus, the ERG11 gene mutations by themselves cannot explain the differences between the distinct multi-azole profile in our isolates. ERG11, ERG3, and ERG5 combinatorial alterations in Candida have shown to circumvent this pathway and led to the development of cross-resistance to azoles and AMB [47,48,49,50]. Using multi-omics approaches, Zamith-Miranda et al. [51] showed that a resistant isolate of C. auris displays a significant higher abundance of Erg2p and a lower abundance of Erg3p. As a matter of fact, we have demonstrated by GC-MS that the C. haemulonii species sterol profiles were comparable to those of different Candida species with ERG2, ERG3, ERG6m and ERG11 gene mutations, presenting the same cross-resistance profile [21]. Along with our results, recent literature reports have suggested that azole resistance in C. haemulonii clade can be related to multiple-steps modifications in the ergosterol biosynthesis pathway [45,51]. Azole resistance has also been attributed to fungal cells that have lost mitochondrial function resulting in respiratory deficiency [52,53,54,55]. Precisely, in S. cerevisiae, C. glabrata, and A. fumigatus, mitochondrial dysfunction has displayed multiple effects in fungal cells, and this can enlighten us on the enhanced efflux pumps’ activities [53,56,57]. These fungal cells usually exhibit an altered sterol profile with a unequal amount of ergosterol; still, no changes in the sequence of ERG11 gene or its expression have been detected [57,58]. Our recently published work demonstrated primary evidence that impariment of the mitochondrial function in C. haemulonii species complex intensifies the tolerance to stress and could be related with a rearrangement in the cellular ergosterol content [21]. In this context, growing evidence from recent elegant reports has revealed that there are more complicated and unknown drug resistance mechanisms apart from the mutational modification of the azole target ERG11p in fungal pathogens [59,60,61,62]. 5. Conclusions Indeed, the widespread use of azoles has been considered to be an important risk factor for FLC resistance development primarily in non-albicans Candida species. In this context, an assessment of all possible resistance mechanisms is important for a proper patient treatment outcome. Our data suggest an emergence of azole-resistant clinical isolates belonging to the C. haemulonii species complex recovered from Brazilian patients. This study provides significant evidence that efflux pump activity is implicated in high-level FLC resistance and pan-azole resistance in the C. haemulonii complex. Once there is an increasing azole resistance among C. haemulonii complex isolates, further surveillance is warranted. Acknowledgments The authors would like to thank Denise da Rocha de Souza, who is supported by a FAPERJ fellowship, for technical assistance and Diogo de Azevedo Jurelevicius (Instituto de Microbiologia Paulo de Góes, Universidade Federal do Rio de Janeiro, Brazil) for the help with the sequence analysis. Supplementary Materials The following are available online at https://www.mdpi.com/2309-608X/6/4/215/s1, Table S1: Antifungal susceptibility profiles of the clinical isolates belonging to the Candida haemulonii species complex to different azole agents, Table S2: Antifungal susceptibility profiles of the non-albicans Candida species to different azole agents, Table S3: Homology search results comparing Candida albicans (SC5314) and Candida haemulonii (B11899) genes via BLAST. Click here for additional data file. Author Contributions All the authors conceived and designed the experiments. L.N.S., L.d.S.R., S.S.C.O., L.B.M. and E.D.S. performed the experiments. All the authors analyzed the data. L.K., M.H.V., M.H.B. and A.L.S.d.S. contributed reagents/materials/analysis tools and funding acquisition. All the authors wrote and revised the paper. All authors have read and agreed to the published version of the manuscript. Funding This work was supported by grants from Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ) and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES, Financial code 001). Conflicts of Interest The authors declare no conflict of interest. Figure 1 Flow cytometry analysis of the glucose-induced rhodamine 6G (R6G) efflux. Uptake of fluorochrome was quantified by incubating yeast cells in PBS for 60 min with 10 µM of R6G (red curve). Next, efflux was evaluated by quantifying the residual fluorescence of the cells after the removal of the free dye and with an additional incubation in phosphate-buffered saline (PBS) supplemented with 100 mM of glucose (orange curve). Fungal species: (A) C. tropicalis (ATCC 750), (B) C. krusei (ATCC 6258), (C) C. lusitaniae (ATCC 200950), and (D) C. haemulonii (LIPCh4). Each experiment was performed at least for three independent times with similar results. Figure 2 Flow cytometric efflux of rhodamine 6G (R6G) over time among clinical isolates belonging to the C. haemulonii species complex. Data were expressed as the percentage of fluorescent cells (%FC) after the addition of 100 mM of glucose. Some systems were also pretreated for 1.5 h with fluconazole (FLC at 64 mg/L) and voriconazole (VRC at 16 mg/L) prior to the R6G and glucose supplementation. Fungal species: C. haemulonii LIPCh4 (Ch4), C. duobushaemulonii LIPCh8 (Ch8), and C. haemulonii var. vulnera LIPCh9 (Ch9). The results were expressed as the mean ± standard deviation of three independent experiments, and the symbol (**) represents p values ≤ 0.01 when compared to control (one-way ANOVA, Bonferroni post hoc test). Figure 3 Expression of the CDR1, CDR2, MDR1, and ERG11 genes in C. haemulonii. The expression of target genes was determined by RT-qPCR in the clinical isolate of C. haemulonii LIPCh4. A pre-treatment was conducted 1.5 h earlier with fluconazole (FLC at 64 mg/L) and voriconazole (VRC at 16 mg/L) before the RNA extraction. Actin gene (ACT1) was used as a housekeeping gene. The results were expressed as the mean ± standard deviation of three independent experiments. Figure 4 Phylogenetic tree of the ERG11 gene from different Candida spp. The alignment was generated by the CLUSTAL W program and the phylogram was constructed using the “Maximum likelihood” method using the MEGAX software [34]. ERG11 and its orthologous amino acid sequences (followed by NCBI access numbers in parentheses): Saccharomyces cerevisiae S288C lanosterol 14α-demethylase (NM_001179137.1), Candida glabrata ATCC 90030 lanosterol 14α-demethylase (KR998002.1), Candida parapsilosis ATCC 22019 lanosterol 14α-demethylase (GQ302972.1), Candida albicans SC5314 lanosterol 14α-demethylase (XM_711668.2), Candida tropicalis ATCC 750 lanosterol 14α-demethylase (KR998015.1), Candida lusitaniae CBS 6936 lanosterol 14α-demethylase (EU919443.1), Candida auris B11221 lanosterol 14α-demethylase (XM_029033208.1), Candida duobushaemulonii B09383 hypothetical protein (XM_025482007.1), Candida pseudohaemulonii B12108 hypothetical protein (XM_024860251.1), and Candida haemulonni 14α-demethylase (XM_025486744.1). The lengths of the branches indicate the average number of changes per site. Figure 5 Multiple alignment of the azole drug target ERG11p. Observed amino acid substitutions in C. albicans compared with the clinical isolates of the C. haemulonii species complex. Red boxes indicate the observed azole resistance amino acids substitutions in the three different hotspots (HSI, HSII, and HSIII). Amino acid numbers are based on the C. albicans protein sequence. Previously published by a Muñoz et al. [23] and b Rodrigues et al. [13]. Colored letters are mutations encountered in the sequence alignment. Red boxes are mutation previously described in resistant strains of C. albicans. jof-06-00215-t001_Table 1Table 1 Oligonucleotide sequences used in this study. Oligonucleotides a Sequences (5′ to 3′) Purpose—Accession Number b ERG11_CH_F1 CATTTTCAGGCCTTGCCCAC ERG11 sequencing Candida haemulonii—XM_025486744.1 ERG11_CH_R1 TCTGGGCACGTATCTCTGGA ERG11_CH_F2 ACTGCCTTAACCAAGGAGGC ERG11_CH_R2 AAGCTACCACCTTTGGAGGC ERG11_CH_F3 TTTTGGCCTCCAAAGGTGGT ERG11_CH_R3 CGCATGTCTCCCTCTTCTCC ERG11_CD_F1 CGGTATGCAGCCATACGAGT ERG11 sequencing Candida duobushaemulonii —XM_025482007.1 ERG11_CD_R1 CGCCAATCAACAAGTTGGCA ERG11_CD_F2 TCCAGAGATACGTGCCCAGA ERG11_CD_R2 ACACAGAGAGCACCTCGTTG ERG11_CD_F3 CTGCCTGGTTCTTGTTGCAC ERG11_CD_R3 AGTCAACAGGTGGAAGCGAG ACT1_CH_F1 ACTGCTTTGGCTCCATCCTC ACT1 real-time PCR—XM_025485061.1 ACT1_CH_R1 AGACTCGTCGTACTCCTGCT ERG11_CH_F1 CTGGATCCCATGGTTTGGCT ERG11 real-time PCR—XM_025486744.1 ERG11_CH_R1 GTCAAATGCGAGTAAGCGGC CDR1_CH_F1 ACTTGTCATGCCACGCAAAC CDR1 real-time PCR—XM_025483931.1 CDR1_CH_R1 GGTAGCGCCTCTCGTACTTC CDR2_CH_F1 ATCGAGACCGGTGAGAGTGA CDR2 real-time PCR—XM_025488660.1 CDR2_CH_R1 CACCAGACGCACCCATAAGT MDR1_CH_F1 GTCCCTTCGGTGCAAAAACC MDR1 real-time PCR—XM_025484012.1 MDR1_CH_R1 AGGGCTAGCAAAGAAGCCTG a The letters F and R in the primer names describe the 5′-to-3′ orientations of the primers as follows: F, forward (sense); R, reverse (antisense). b NCBI reference sequence. jof-06-00215-t002_Table 2Table 2 MIC distribution of the C. haemulonii species complex (n = 12 isolates) against five azole agents tested using the CLSI standard method. Azoles 0.016 0.032 0.064 0.125 0.25 0.5 1 2 4 8 16 32 64 Range GM-MIC a MIC50 b MIC90 c FLC 12 - 64 64 64 ITC 1 2 1 3 5 0.25–16 4.23 8 16 VRC 1 2 1 8 0.25–16 4.75 16 16 PSC 3 1 1 2 1 2 2 0.03–16 0.62 0.5 16 KTC 1 2 2 4 2 1 0.125–16 1.49 2 12.4 FLC, fluconazole; ITC, itraconazole; VRC, voriconazole; PSC, posaconazole; KTC, ketaconazole. MIC, minimum inhibitory concentration. a GM-MIC, geometric mean MIC. b MIC50, MIC at which 50% of the test isolates were inhibited. c MIC90, MIC at which 90% of the test isolates were inhibited. Modal MICs are indicated with underlined numbers. jof-06-00215-t003_Table 3Table 3 Effect of the inhibition of efflux pumps (EPIs) on the azole susceptibility in clinical isolates of the C. haemulonii species complex. Isolates Azoles MIC MIC + Phe-Arg Variation MIC + FK506 Variation LIPCh4 FLC >64 2 ≥32× 8 ≥8× VRC >16 0.25 ≥64× 1 ≥16× LIPCh5 FLC 64 2 ≥32× 4 ≥16× VRC 0.5 0.0625 8× 0.125 4× LIPCh6 FLC 64 2 32× 4 16× VRC 1 0.0625 8× 0.25 4× LIPCh7 FLC >64 2 ≥32× 8 ≥8× VRC 16 0.25 64× 1 16× LIPCh8 FLC >64 4 ≥16× 8 4× VRC >16 0.5 ≥32× 2 8× LIPCh9 FLC 64 4 16× 8 8× VRC 16 0.125 64× 0.5 32× MIC, minimum inhibitory concentration; FLC, fluconazole; VRC, voriconazole. Phe-Arg and FK506, efflux pump inhibitors. Yeast species: C. haemulonii LIPCh4, C. haemulonii var. vulnera LIPCh5, C. duobushaemulonii LIPCh6, C. haemulonii LIPCh7, C. duobushaemulonii LIPCh8, and C. haemulonii var. vulnera LIPCh9. ==== Refs References 1. Cendejas-Bueno E. Kolecka A. Alastruey-Izquierdo A. Theelen B. Groenewald M. Kostrzewa M. Cuenca-Estrella M. Gomez-Lopez A. Boekhout T. Reclassification of the Candida haemulonii complex as Candida haemulonii (C. haemulonii group I), C. duobushaemulonii sp. nov. (C. haemulonii group II), and C. haemulonii var. vulnera var. nov.: Three multiresistant human pathogenic yeasts J. Clin. Microbiol. 2012 50 3641 3651 10.1128/JCM.02248-12 22952266 2. Gade L. Muñoz J.F. Sheth M. Wagner D. Berkow E.L. Forsberg K. Jackson B.R. Ramos-Castro R. Escandón P. Dolande M. Understanding the emergence of multidrug-resistant Candida : Using whole-genome sequencing to describe the population structure of Candida haemulonii species complex Front. Genet. 2020 11 554 10.3389/fgene.2020.00554 32587603 3. Coles M. Cox K. Chao A. Candida haemulonii : An emerging opportunistic pathogen in the United States? IDCases 2020 21 e00900 10.1016/j.idcr.2020.e00900 32685371 4. Hou X. Xiao M. Chen S.C. Wang H. Cheng J.W. Chen X.X. Xu Z.P. Fan X. Kong F. Xu Y.C. Identification and antifungal susceptibility profiles of Candida haemulonii species complex clinical isolates from a multicenter study in China J. Clin. Microbiol. 2016 54 2676 2680 10.1128/JCM.01492-16 27535688 5. Kim M.N. Shin J.H. Sung H. Lee K. Kim E.C. Ryoo N. Lee J.S. Jung S.I. Park K.H. Kee S.J. Candida haemulonii and closely related species at 5 university hospitals in Korea: Identification, antifungal susceptibility, and clinical features Clin. Infect. Dis. 2009 48 e57 e61 10.1086/597108 19193113 6. Ben-Ami R. Berman J. Novikov A. Bash E. Shachor-Meyouhas Y. Zakin S. Maor Y. Tarabia J. Schechner V. Adler A. Multidrug-resistant Candida haemulonii and C. auris , Tel Aviv, Israel Emerg. Infect. Dis. 2017 23 195 203 10.3201/eid2302.161486 28098529 7. Frías-De-León M.G. Martínez-Herrera E. Acosta-Altamirano G. Arenas R. Rodríguez-Cerdeira C. Superficial candidosis by Candida duobushaemulonii : An emerging microorganism Infect. Genet. Evol. 2019 75 1 5 10.1016/j.meegid.2019.103960 31325612 8. Fang S.Y. Wei K.C. Chen W.C. Lee S.J. Yang K.C. Wu C.S. Sun P.L. Primary deep cutaneous candidiasis caused by Candida duobushaemulonii in a 68-year-old man: The first case report and literature review Mycoses 2016 10.1111/myc.12540 9. Kumar A. Prakash A. Singh A. Kumar H. Hagen F. Meis J.F. Chowdhary A. Candida haemulonii species complex: An emerging species in India and its genetic diversity assessed with multilocus sequence and amplified fragment-length polymorphism analyses Emerg. Microbes Infect. 2016 5 1 3 10.1038/emi.2016.49 10. Ramos L.S. Figueiredo-Carvalho M.H.G. Barbedo L.S. Ziccardi M. Chaves A.L.S. Zancope-Oliveira R.M. Pinto M.R. Sgarbi D.B.G. Dornelas-Ribeiro M. Branquinha M.H. Candida haemulonii complex: Species identification and antifungal susceptibility profiles of clinical isolates from Brazil J. Antimicrob. Chemother. 2015 70 111 115 10.1093/jac/dku321 25134720 11. De Almeida J.N. Jr. Assy J.G. Levin A.S. Del Negro G.M. Giudice M.C. Tringoni M.P. Thomaz D.Y. Motta A.L. Abdala E. Pierroti L.C. Candida haemulonii complex species, Brazil, January 2010-March 2015 Emerg. Infect. Dis. 2016 22 561 563 10.3201/eid2203.151610 26891028 12. Muro M.D. Motta F.d.A. Burger M. Melo A.S.d.A. Dalla-Costa L.M. Echinocandin resistance in two Candida haemulonii isolates from pediatric patients J. Clin. Microbiol. 2012 50 3783 3785 10.1128/JCM.01136-12 22895037 13. Rodrigues L.S. Gazara R.K. Passarelli-Araujo H. Valengo A.E. Pontes P.V.M. Nunes-da-Fonseca R. de Souza R.F. Venancio T.M. Dalla-Costa L.M. First genome sequences of two multidrug-resistant Candida haemulonii var. vulnera isolates from pediatric patients with candidemia Front. Microbiol. 2020 11 1535 10.3389/fmicb.2020.01535 32719671 14. Pfaller M.A. Diekema D.J. Gibbs D.L. Newell V.A. Ellis D. Tullio V. Rodloff A. Fu W. Ling T.A. Results from the ARTEMIS DISK Global Antifungal Surveillance Study, 1997 to 2007: A 10.5-year analysis of susceptibilities of Candida species to fluconazole and voriconazole as determined by CLSI standardized disk diffusion J. Clin. Microbiol. 2010 48 1366 1377 10.1128/JCM.02117-09 20164282 15. Oberoi J.K. Wattal C. Goel N. Raveendran R. Datta S. Prasad K. Non-albicans Candida species in blood stream infections in a tertiary care hospital at New Delhi, India Indian J. Med. Res. 2012 136 997 1003 23391796 16. Xiao M. Chen S.C. Kong F. Xu X.L. Yan L. Kong H.S. Fan X. Hou X. Cheng J.W. Zhou M.L. Distribution and antifungal susceptibility of Candida species causing candidemia in China: An update from the CHIF-NET study J. Infect. Dis. 2020 221 139 147 10.1093/infdis/jiz573 32176789 17. Lima S.L. Francisco E.C. de Almeida Júnior J.N. Santos D. Carlesse F. Queiroz-Telles F. Melo A.S.A. Colombo A.L. Increasing prevalence of multidrug-resistant Candida haemulonii species complex among all yeast cultures collected by a reference laboratory over the past 11 years J. Fungi 2020 6 110 10.3390/jof6030110 32679832 18. Silva L.N. Mello T.P. Ramos L.S. Branquinha M.H. Santos A.L.S. New and promising chemotherapeutics for emerging infections involving drug-resistant non-albicans Candida species Curr. Top. Med. Chem. 2019 19 1 27 10.2174/1568026619666191025152412 30942145 19. Chaabane F. Graf A. Jequier L. Coste A.T. Review on antifungal resistance mechanisms in the emerging pathogen Candida auris Front. Microbiol. 2019 10 1 8 10.3389/fmicb.2019.02788 30728808 20. Colombo A.L. Junior J.N.A. Guinea J. Emerging multidrug-resistant Candida species Curr. Opin. Infect. Dis. 2017 30 528 538 10.1097/QCO.0000000000000411 29095200 21. Silva L.N. Oliveira S.S.C. Magalhães L.B. Andrade Neto V.V. Torres-Santos E.C. Carvalho M.D.C. Pereira M.D. Branquinha M.H. Santos A.L.S. Unmasking the amphotericin B resistance mechanisms in Candida haemulonii species complex ACS Infect. Dis. 2020 6 1273 1282 10.1021/acsinfecdis.0c00117 32239912 22. Perlin D.S. Rautemaa-Richardson R. Alastruey-Izquierdo A. The global problem of antifungal resistance: Prevalence, mechanisms, and management Lancet Infect. Dis. 2017 17 383 392 10.1016/S1473-3099(17)30316-X 23. Muñoz J.F. Gade L. Chow N.A. Loparev V.N. Juieng P. Berkow E.L. Farrer R.A. Litvintseva A.P. Cuomo C.A. Genomic insights into multidrug-resistance, mating and virulence in Candida auris and related emerging species Nat. Commun. 2018 9 1 13 29317637 24. Zhang H. Niu Y. Tan J. Liu W. Sun M.-A. Yang E. Wang Q. Li R. Wang Y. Liu W. Global screening of genomic and transcriptomic factors associated with phenotype differences between multidrug-resistant and -susceptible Candida haemulonii strains mSystems 2019 4 1 17 10.1128/mSystems.00459-19 25. Rybak J.M. Doorley L.A. Nishimoto A.T. Barker K.S. Palmer G.E. Rogers P.D. Abrogation of triazole resistance upon deletion of CDR1 in a clinical isolate of Candida auris Antimicrob. Agents Chemother. 2019 63 10.1128/AAC.00057-19 26. CLSI (Clinical and Laboratory Standards Institute) M27-A3: Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts 3rd ed. CLSI Wayne, PA, USA 2008 27. Maesaki S. Marichal P. Vanden Bossche H. Sanglard D. Kohno S. Rhodamine 6G efflux for the detection of CDR1 -overexpressing azole-resistant Candida albicans strains J. Antimicrob. Chemother. 1999 44 27 31 10.1093/jac/44.1.27 10459807 28. Kean R. Delaney C. Sherry L. Borman A. Johnson E.M. Richardson M.D. Rautemaa-Richardson R. Williams C. Ramage G. Transcriptome assembly and profiling of Candida auris reveals novel insights into biofilm-mediated resistance mSphere 2018 3 1 14 10.1128/mSphere.00334-18 29. Squizani E.D. Oliveira N.K. Reuwsaat J.C.V. Marques B.M. Lopes W. Gerber A.L. de Vasconcelos A.T.R. Lev S. Djordjevic J.T. Schrank A. Cryptococcal dissemination to the central nervous system requires the vacuolar calcium transporter Pmc1 Cell. Microbiol. 2018 20 1 13 10.1111/cmi.12803 30. Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method Methods 2001 25 402 408 10.1006/meth.2001.1262 11846609 31. Chowdhary A. Prakash A. Sharma C. Kordalewska M. Kumar A. Sarma S. Tarai B. Singh A. Upadhyaya G. Upadhyay S. A multicentre study of antifungal susceptibility patterns among 350 Candida auris isolates (2009-17) in India: Role of the ERG11 and FKS1 genes in azole and echinocandin resistance J. Antimicrob. Chemother. 2018 73 891 899 10.1093/jac/dkx480 29325167 32. Arnaud M.B. Costanzo M.C. Skrzypek M.S. Shah P. Binkley G. Lane C. Miyasato S.R. Sherlock G. Sequence resources at the Candida Genome Database Nucleic Acids Res. 2007 35 452 456 10.1093/nar/gkl899 17090582 33. Morio F. Loge C. Besse B. Hennequin C. Le Pape P. Screening for amino acid substitutions in the Candida albicans Erg11 protein of azole-susceptible and azole-resistant clinical isolates: New substitutions and a review of the literature Diagn. Microbiol. Infect. Dis. 2010 66 373 384 10.1016/j.diagmicrobio.2009.11.006 20226328 34. Kumar S. Stecher G. Li M. Knyaz C. Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing platforms Mol. Biol. Evol. 2018 35 1547 1549 10.1093/molbev/msy096 29722887 35. Flowers S.A. Colón B. Whaley S.G. Schuler M.A. Rogers P.D. Contribution of clinically derived mutations in ERG11 to azole resistance in Candida albicans Antimicrob. Agents Chemother. 2015 59 450 460 10.1128/AAC.03470-14 25385095 36. Lockhart S.R. Etienne K.A. Vallabhaneni S. Farooqi J. Chowdhary A. Govender N.P. Colombo A.L. Calvo B. Cuomo C.A. Desjardins C.A. Simultaneous emergence of multidrug-resistant Candida auris on 3 continents confirmed by whole-genome sequencing and epidemiological analyses Clin. Infect. Dis. 2017 64 134 140 10.1093/cid/ciw691 27988485 37. Silva L.N. Campos-Silva R. Ramos L.S. Trentin D.S. Macedo A.J. Branquinha M.H. Santos A.L.S. Virulence of Candida haemulonii complex in Galleria mellonella and efficacy of classical antifungal drugs: A comparative study with other clinically relevant non-albicans Candida species FEMS Yeast Res. 2018 18 foy082 10.1093/femsyr/foy082 38. Fakhim H. Vaezi A. Dannaoui E. Chowdhary A. Nasiry D. Faeli L. Meis J.F. Badali H. Comparative virulence of Candida auris with Candida haemulonii , Candida glabrata and Candida albicans in a murine model Mycoses 2018 61 377 382 10.1111/myc.12754 29460345 39. Arendrup M.C. Patterson T.F. Multidrug-resistant Candida : Epidemiology, molecular mechanisms, and treatment J. Infect. Dis. 2017 216 S445 S451 10.1093/infdis/jix131 28911043 40. Sun S. Li Y. Guo Q. Shi C. Yu J. Ma L. In vitro interactions between tacrolimus and azoles against Candida albicans determined by different methods Antimicrob. Agents Chemother. 2008 52 409 417 10.1128/AAC.01070-07 18056277 41. Li H. Chen Z. Zhang C. Gao Y. Zhang X. Sun S. Resistance reversal induced by a combination of fluconazole and tacrolimus (FK506) in Candida glabrata J. Med. Microbiol. 2015 64 44 52 10.1099/jmm.0.081760-0 25355935 42. Pandey N. Tripathi M. Gupta M.K. Tilak R. Overexpression of efflux pump transporter genes and mutations in ERG11 pave the way to fluconazole resistance in Candida tropicalis : A study from North India region J. Glob. Antimicrob. Resist. 2020 22 374 378 10.1016/j.jgar.2020.02.010 32084606 43. Maertens J.A. History of the development of azole derivatives Clin. Microbiol. Infect. 2004 10 1 10 10.1111/j.1470-9465.2004.00841.x 14748798 44. Zavrel M. Esquivel B.D. White T.C. The ins and outs of azole antifungal drug resistance: Molecular mechanisms of transport Handbook of Antimicrobial Resistance Berghuis A. Matlashewski G. Wainberg M.A. Sheppard D. Springer New York, NY, USA 2017 423 452 10.1007/978-1-4939-0694-9_29 45. Healey K.R. Kordalewska M. Jiménez Ortigosa C. Singh A. Berrío I. Chowdhary A. Perlin D.S. Limited ERG11 mutations identified in isolates of Candida auris directly contribute to reduced azole susceptibility Antimicrob. Agents Chemother. 2018 62 1 14 10.1128/AAC.01427-18 30082281 46. Xiang M.-J. Liu J.-Y. Ni P.-H. Wang S. Shi C. Wei B. Ni Y.-X. Ge H.-L. Erg11 mutations associated with azole resistance in clinical isolates of Candida albicans FEMS Yeast Res. 2013 13 386 393 10.1111/1567-1364.12042 23480635 47. Sanglard D. Ischer F. Parkinson T. Falconer D. Bille J. Candida albicans mutations in the ergosterol biosynthetic pathway and resistance to several antifungal agents Antimicrob. Agents Chemother. 2003 47 2404 2412 10.1128/AAC.47.8.2404-2412.2003 12878497 48. Hull C.M. Parker J.E. Bader O. Weig M. Gross U. Warrilow A.G.S. Kelly D.E. Kelly S.L. Facultative sterol uptake in an ergosterol-deficient clinical isolate of Candida glabrata harboring a missense mutation in ERG11 and exhibiting cross-resistance to azoles and amphotericin B Antimicrob. Agents Chemother. 2012 56 4223 4232 10.1128/AAC.06253-11 22615281 49. Forastiero A. Mesa-Arango A.C. Alastruey-Izquierdo A. Alcazar-Fuoli L. Bernal-Martinez L. Pelaez T. Lopez J.F. Grimalt J.O. Gomez-Lopez A. Cuesta I. Candida tropicalis antifungal cross-resistance is related to different azole target (Erg11p) modifications Antimicrob. Agents Chemother. 2013 57 4769 4781 10.1128/AAC.00477-13 23877676 50. Martel C.M. Parker J.E. Bader O. Weig M. Gross U. Warrilow A.G.S. Kelly D.E. Kelly S.L. A clinical isolate of Candida albicans with mutations in ERG11 (encoding sterol 14alpha-demethylase) and ERG5 (encoding C22 desaturase) is cross resistant to azoles and amphotericin B Antimicrob. Agents Chemother. 2010 54 3578 3583 10.1128/AAC.00303-10 20547793 51. Zamith-Miranda D. Heyman H.M. Cleare L.G. Couvillion S.P. Clair G.C. Bredeweg E.L. Gacser A. Nimrichter L. Nakayasu E.S. Nosanchuk J.D. Multi-omics signature of Candida auris , an emerging and multidrug-resistant pathogen mSystems 2019 4 1 14 10.1128/mSystems.00257-19 52. Peng Y. Dong D. Jiang C. Yu B. Wang X. Ji Y. Relationship between respiration deficiency and azole resistance in clinical Candida glabrata FEMS Yeast Res. 2012 12 719 727 10.1111/j.1567-1364.2012.00821.x 22713096 53. Ferrari S. Sanguinetti M. De Bernardis F. Torelli R. Posteraro B. Vandeputte P. Sanglard D. Loss of mitochondrial functions associated with azole resistance in Candida glabrata results in enhanced virulence in mice Antimicrob. Agents Chemother. 2011 55 1852 1860 10.1128/AAC.01271-10 21321146 54. Thomas E. Roman E. Claypool S. Manzoor N. Pla J. Panwar S.L. Mitochondria influence CDR1 efflux pump activity, Hog1-mediated oxidative stress pathway, iron homeostasis, and ergosterol levels in Candida albicans Antimicrob. Agents Chemother. 2013 57 5580 5599 10.1128/AAC.00889-13 23979757 55. Brun S. Aubry C. Lima O. Filmon R. Bergès T. Chabasse D. Bouchara J.P. Relationships between respiration and susceptibility to azole antifungals in Candida glabrata Antimicrob. Agents Chemother. 2003 47 847 853 10.1128/AAC.47.3.847-853.2003 12604511 56. Hallstrom T.C. Moye-Rowley W.S. Multiple signals from dysfunctional mitochondria activate the pleiotropic drug resistance pathway in Saccharomyces cerevisiae J. Biol. Chem. 2000 275 37347 37356 10.1074/jbc.M007338200 10980204 57. Sharma C. Nelson-Sathi S. Singh A. Radhakrishna Pillai M. Chowdhary A. Genomic perspective of triazole resistance in clinical and environmental Aspergillus fumigatus isolates without cyp51A mutations Fungal Genet. Biol. 2019 132 103265 10.1016/j.fgb.2019.103265 31465846 58. Brun S. Bergès T. Poupard P. Vauzelle-Moreau C. Renier G. Chabasse D. Bouchara J.P. Mechanisms of azole resistance in petite mutants of Candida glabrata Antimicrob. Agents Chemother. 2004 48 1788 1796 10.1128/AAC.48.5.1788-1796.2004 15105136 59. Hagiwara D. Arai T. Takahashi H. Kusuya Y. Watanabe A. Kamei K. Non-cyp51A azole-resistant Aspergillus fumigatus isolates with mutation in HMG-CoA reductase Emerg. Infect. Dis. 2018 24 1889 1897 10.3201/eid2410.180730 30226177 60. Li Y. Zhang Y. Zhang C. Wang H. Wei X. Chen P. Lu L. Mitochondrial dysfunctions trigger the calcium signaling-dependent fungal multidrug resistance Proc. Natl. Acad. Sci. USA 2020 117 1711 1721 10.1073/pnas.1911560116 31811023 61. Gao J. Wang H. Li Z. Wong A.H.-H. Wang Y.-Z. Guo Y. Lin X. Zeng G. Liu H. Wang Y. Candida albicans gains azole resistance by altering sphingolipid composition Nat. Commun. 2018 9 4495 10.1038/s41467-018-06944-1 30374049 62. Mayr E.M. Ramírez-Zavala B. Krüger I. Morschhäuser J. A zinc cluster transcription factor contributes to the intrinsic fluconazole resistance of Candida auris mSphere 2020 5 e00279-20 10.1128/mSphere.00279-20 32321822