==== Front Oxid Med Cell Longev Oxid Med Cell Longev OMCL Oxidative Medicine and Cellular Longevity 1942-0900 1942-0994 Hindawi 10.1155/2020/7697851 Research Article Cornelian Cherry Iridoid-Polyphenolic Extract Improves Mucosal Epithelial Barrier Integrity in Rat Experimental Colitis and Exerts Antimicrobial and Antiadhesive Activities In Vitro https://orcid.org/0000-0002-4571-9452Szandruk-Bender Marta marta.szandruk@umed.wroc.pl 1 https://orcid.org/0000-0002-7733-1241Rutkowska Maria 1 https://orcid.org/0000-0002-4597-0241Merwid-Ląd Anna 1 https://orcid.org/0000-0002-1404-2274Wiatrak Benita 1 https://orcid.org/0000-0001-8104-5267Szeląg Adam 1 https://orcid.org/0000-0001-7203-2392Dzimira Stanisław 2 https://orcid.org/0000-0002-3355-2480Sobieszczańska Beata 3 https://orcid.org/0000-0002-2753-8092Krzystek-Korpacka Małgorzata 4 https://orcid.org/0000-0002-2172-0408Kucharska Alicja Z. 5 https://orcid.org/0000-0003-1082-0793Matuszewska Agnieszka 1 https://orcid.org/0000-0003-0014-6344Nowak Beata 1 https://orcid.org/0000-0002-0256-5510Piórecki Narcyz 6 7 https://orcid.org/0000-0001-8559-1695Duda-Madej Anna 3 https://orcid.org/0000-0002-4344-9882Walczuk Urszula 3 https://orcid.org/0000-0001-7297-3459Turniak Michał 3 https://orcid.org/0000-0001-7244-2017Bednarz-Misa Iwona 4 https://orcid.org/0000-0003-1722-3190Sozański Tomasz 1 1Department of Pharmacology, Wroclaw Medical University, Mikulicza-Radeckiego 2, 50-345 Wrocław, Poland 2Department of Pathology, Wroclaw University of Environmental and Life Sciences, Norwida 31, 50-375 Wrocław, Poland 3Department of Microbiology, Wroclaw Medical University, Chałubińskiego 4, 50-368 Wrocław, Poland 4Department of Medical Biochemistry, Wroclaw Medical University, Chałubińskiego 10, 50-368 Wrocław, Poland 5Department of Fruit, Vegetable and Plant Nutraceutical Technology, Wroclaw University of Environmental and Life Sciences, Chełmońskiego 37, 51-630 Wrocław, Poland 6Bolestraszyce Arboretum and Institute of Physiography, 37-700 Przemyśl, Poland 7Department of Tourism and Recreation, University of Rzeszow, Towarnickiego 3, 35-959 Rzeszów, Poland Academic Editor: Marcos R. de Oliveira 2020 20 11 2020 2020 769785120 7 2020 18 10 2020 1 11 2020 Copyright © 2020 Marta Szandruk-Bender et al.2020This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Background and Aims Inflammatory bowel disease pharmacotherapy, despite substantial progress, is still not satisfactory for both patients and clinicians. In view of the chronic and relapsing disease course and not always effective treatment with adverse effects, attempts to search for new, more efficient, and safer substances are essential and reasonable. This study was designed to elucidate the impact of cornelian cherry iridoid-polyphenolic extract (CE) and loganic acid (LA) on adherent-invasive E. coli growth and adhesion in vitro and to assess the effect of pretreatment with CE or LA on the course of intestinal inflammation in rat experimental colitis compared with sulfasalazine. Methods Antibacterial and antiadhesive activities of CE and LA were assessed using microdilution, Int407 cell adherence, and yeast agglutination assays. The colitis model was induced by 2,4,6-trinitrobenzenesulfonic acid. Studied substances were administered intragastrically for 16 days prior to colitis induction. Body weight loss; colon index; histological injuries; IL-23, IL-17, TNF-α, and chemerin levels; and STAT3, Muc2, and TFF3 mRNA expression were evaluated. Results Only CE exerted antimicrobial and antiadhesive activities in vitro and alleviated colonic symptoms. CE coadministrated with sulfasalazine was more effective than single compounds in reversing increased concentrations of TNF-α, IL-17, and chemerin and decreased Muc2 mRNA expression. Conclusions CE exerted a protective effect against experimental colitis via impaired mucosal epithelial barrier restoration and intestinal inflammatory response attenuation and given concomitantly with sulfasalazine counteracted colitis in a more effective way than sulfasalazine alone, which indicates their synergistic interaction. The beneficial effect of CE may also be due to its bacteriostatic and antiadhesive activities. Grant for Young Scientists from Wroclaw Medical University139 ==== Body 1. Introduction Inflammatory bowel disease (IBD), a group of chronic and recurring intestinal disorders which comprises two main entities, Crohn's disease (CD) and ulcerative colitis (UC), has become a global healthcare problem. IBD affects at least 0.5% of the population in westernized countries with accelerating incidence in newly industrialized regions [1]. IBD decreases patients' quality of life, has a poor prognosis, and leads to lifelong morbidity. Both forms of IBD are differentiated by their location and extent of inflammatory changes in the gastrointestinal tract. CD is characterized by transmural inflammation that may appear in any part of the gastrointestinal tract, whereas UC by inflammation of the colonic mucosa and submucosa. Initially, both CD and UC are associated with low-grade fever, fatigue, bloody diarrhea with mucorrhea, abdominal pain, unintended weight loss with reduced appetite, and anemia. Symptoms range from mild to severe during relapses and may disappear during remissions. The differences between Crohn's disease and ulcerative colitis patients become more evident with the progression of the disease, along with the development of intestinal and extraintestinal complications [2, 3]. The altered immune response is an indisputable factor relevant to the pathogenesis of IBD regardless of the controversy over the type and origin of the antigen. It is presumed that a complex interaction between heritable traits and environmental and microbial factors may lead to enhanced immune response. Even though the etiopathogenesis of IBD remains not completely understood, there is growing evidence that increased infiltration, proliferation, and activation of Th17 cells and increased concentrations of IL-23/Th17 pathway proinflammatory cytokines including, inter alia, tumor necrosis factor α (TNF-α), interleukin 23 (IL-23), interleukin 17 (IL-17), and chemerin play a pivotal role in the development and maintenance of mucosal inflammation and lead to gut tissue damage. It is noteworthy that Th17 cells are firmly dependent on transcription factor STAT3 activation [2, 4]. Inappropriate immune response and intestinal inflammation might be triggered by mucosal epithelial barrier disorders, such as impaired function and reduced number of goblet cells, abnormal mucus production, and decreased mucus layer thickness. The deficiency of mucins and trefoil peptides, especially mucin 2 (Muc2) and trefoil factor-3 (TFF3), secreted by goblet cells, makes intestinal tissues vulnerable to inflammation and impedes mucosal repair and restitution [5]. The reciprocal regulation among the intestinal epithelial cells (IECs), a variety of immune cells, and microbiota is critical for maintaining the integrity of the mucosal barrier. In IBD patients, gut microbiota differs qualitatively and quantitatively compared to that of healthy people [1]. Intestinal microbiome dysbiosis is characterized by an increase in the number of mucosa-associated bacteria (e.g., an enteropathogenic strain of the B2 phylotype E. coli termed AIEC) and a reduction in the overall microbial diversity. AIEC adheres to and invades IECs and can survive and replicate within macrophages, inducing TNF-α secretion and promoting granuloma formation [6, 7]. Regardless of whether the change in the microbiome functioning is the cause or effect of IBD, it is plausible that clinical remission is not accompanied by a restoration in the gut microbial balance, which may lead to future relapses influencing the severity of the disease [8]. Despite meaningful progress in IBD therapy, the current treatment has substantial limitations with regard to safety and efficacy. Aminosalicylates and glucocorticosteroids are the drugs of choice for the treatment of mild to moderate IBD, while immunosuppressants and biological agents are reserved for more severe cases or nonresponsive patients. Such treatment may cause serious adverse effects, especially during long-term administration, and relapse upon drug discontinuation [9, 10]. Thus, there is still an unmet clinical need for the identification of new, more efficient, and safer therapies for IBD. A tempting approach in future therapies might be reinforcement of the mucosal epithelial barrier to achieve long-term remission. The improvement of gut barrier integrity alone might not be sufficient in severe inflammatory diseases but in combination with standard therapy might have additional benefits [11]. Similarly, targeting AIEC colonization via antiadhesive compounds might be another attractive adjuvant strategy to the prevention and treatment of IBD [12]. One of the approaches for the development of future IBD treatments or adjuvant therapy is the appraisal of plant-derived natural compounds that target various inflammation-related molecules and signaling pathways associated with IBD. Several studies based on in vitro and in vivo assays revealed antioxidant, anti-inflammatory, immunomodulatory, antimicrobial, and analgesic activities of cornelian cherry iridoid-polyphenolic extract (CE) and its compounds, especially loganic acid (LA). The bulk of research indicated that the beneficial effects of cornelian cherry fruits on various physiological parameters are due to the presence of polyphenols and iridoids [13–15]. The current study was undertaken to elucidate the impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on pathogenic E. coli strain LF82 growth and adhesion to intestinal epithelial cells in vitro as well as assessing the effect of pretreatment with CE or LA on the course of intestinal inflammation in 2,4,6-trinitrobenzenesulfonic acid (TNBS) experimental colitis in rats. Moreover, this study is aimed at comparing the action of CE and LA with that of sulfasalazine, a well-established drug in IBD, and at elucidating whether CE or LA concomitantly administrated with sulfasalazine might act synergistically with sulfasalazine. 2. Materials and Methods 2.1. Plant Material 2.1.1. Sample Preparation of Cornelian Cherry Iridoid-Polyphenolic Extract and Loganic Acid Cornelian cherry (Cornus mas L.) fruits were collected in the Bolestraszyce Arboretum and Institute of Physiography, Poland. The voucher specimen (BDPA 3967) has been deposited at the Herbarium of the Arboretum in Bolestraszyce, Poland. The investigated cornelian cherry iridoid-polyphenolic extract and loganic acid were prepared from cornelian cherry fruits by the Department of Fruit, Vegetable and Plant Nutraceutical Technology at the Wroclaw University of Environmental and Life Sciences according to the method described by Kucharska et al. and Sozański et al. [16, 17]. CE was obtained after purification on XAD-16 Amberlite resin (Rohm and Haas, France) in a column and then concentrated using a Rotavapor (Unipan, Poland) and lyophilized (Alpha 1-4 LSC, Germany) [16]. LA was fractionated from CE by a polyamide (Macherey-Nagel-CC 6.6, Germany) chromatography column as published earlier [16, 17]. CE and LA were qualitatively and quantitatively characterized by LC-MS and HPLC (Table 1). 2.1.2. Identification of Compounds by LC-MS Compounds were identified with the method described by Kucharska et al. [18] using the Acquity ultraperformance liquid chromatography (UPLC) system coupled with a quadruple time of flight (q-TOF) MS instrument (Waters Corp., USA) with an electrospray ionization (ESI) source. The Acquity BEH C18 column (100mm × 2.1mm i.d., 1.7 μm; Waters Corp., USA) was used. The mobile phase was composed of solvents: A (2.0% aq. formic acid, v/v, Sigma-Aldrich, Germany) and B (100% acetonitrile, POCH, Poland). The instrument was operated in both the positive and negative ion modes, scanning m/z from 100 to 1500. 2.1.3. Quantification of Compounds by HPLC-PDA Iridoids and anthocyanins were assayed using the method described earlier [18] with an HPLC system equipped with the UltiMate 3000 model photodiode array detector (Dionex, Germany). The Cadenza Imtakt column CD-C18 (75 4.6 mm, 5 μm) was used. The mobile phase was composed of solvents: A (4.5% aq. formic acid, v/v, Sigma-Aldrich, Germany) and B (100% acetonitrile, Sigma-Aldrich, Germany). Runs were monitored at wavelengths of 245 nm (iridoids and ellagic acid), 320 nm (phenolic acid), 360 nm (flavonols), and 520 nm (anthocyanins). Iridoids, phenolic acids, and anthocyanins were quantified as loganic acid, 5-caffeoylquinic acid, and cyanidin 3-O-glucoside, respectively. Flavonols were quantified as quercetin 3-O-glucoside and kaempferol 3-O-glucoside (Extrasynthese, France). 2.2. In Vitro Studies 2.2.1. E. coli Strains A prototype AIEC strain LF82 (O83:H1) isolated from a chronic ileal lesion of a patient with Crohn's disease, kindly provided by doctor Arlette Darfeuille-Michaud, Université d'Auvergne, France, and nonpathogenic E. coli strain K-12 C600 as a negative control were used in this study. E. coli strains were routinely cultured in Luria broth (LB) and subcultured on MacConkey agar (MCA) [19]. 2.2.2. Antimicrobial Assay To evaluate the antibacterial activity of cornelian cherry iridoid-polyphenolic extract and loganic acid for both the E. coli LF82 and K-12 C600 strains, conventional microdilution assay based on the Clinical and Laboratory Standards Institute (CLSI) was used [20]. CE and LA at the concentrations of 256 mg/ml were serially twofold diluted in Mueller-Hinton broth (MHB) in a microtiter plate. Midlogarithmic phase (18 hours) E. coli culture in LB was adjusted to 0.5 McFarland standard turbidity in sterile normal saline and inoculated to the diluted CE and LA to the final density 5 × 105 CFU/ml and incubated aerobically for 18 h at 35°C. Positive controls contain MHB with E. coli strains, and negative controls contain MHB with CE and LA, but no bacteria were included for every assay to determine adequate E. coli growth over the course of the incubation period and medium sterility, respectively. Additionally, gentamycin was used as a positive control. Afterward, the MIC and MBC values were determined. The lowest concentration of CE and LA that produced no visible growth (no turbidity) in comparison with control wells was considered the minimal inhibitory concentration (MIC). To determine the minimal bactericidal concentration (MBC) of samples of 50 μl from the last, wells with visible bacterial growth and wells with no visible turbidity were inoculated onto nutrient agar and incubated aerobically overnight at 37°C. The highest dilution of CE and LA that yielded no single bacterial colony on the nutrient agar plates was considered an MBC value. 2.2.3. Adherence Assay All cell culture reagents and media were from Gibco (Thermo Fisher Scientific, Poland). Human intestinal epithelial Int407 cells (ATCC CCL-6™) were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with heat-inactivated 10% fetal bovine serum (FBS) and antibiotic-antimycotic solution (AAS; penicillin 100 U, streptomycin 100 U, and amphotericin B 0.25 μg per ml). For adherence assay, Int407 cells were seeded on 48-well plates at the density 2 × 105 cells per well and cultured until 80% confluence. 24 h before assays, the cells were washed three times with phosphate-buffered saline (PBS; pH 7.2) and treated with serial twofold dilutions of cornelian cherry iridoid-polyphenolic extract and loganic acid in DMEM without antibiotics ranging from 2 to 10 mg/ml. Int407 epithelial cells in DMEM without antibiotics untreated with a water solution of CE and LA served as a negative control. The in vitro adherence assay to Int407 cells was performed according to Cravioto et al. [21]. E. coli strains cultured overnight at 37°C in LB, centrifuged, and resuspended in PBS (pH 7.4) to the optical density OD = 6 × 108 colony-forming units per ml (CFU/ml) were used to infect Int407 cells untreated and treated with a water solution of CE and LA at a multiplicity of infection (MOI) 50 bacteria per one cell. After 3 h of incubation, Int407 cells were washed three times and lysed with 0.1% Triton X-100 in LB for 90 min to release cell-associated bacteria [22]. The 100 μl aliquots of bacterial lysates were taken, and 10-fold dilutions were plated onto MacConkey agar plates to enumerate viable CFU. The adherence assay was carried out in three separate experiments. 2.2.4. Yeast Agglutination Assay To determine the effect of CE and LA on type 1 fimbriae of E. coli, the agglutination of yeasts was performed according to Korhonen [23]. Tested E. coli strains were grown for 48 h in a static tryptic soy broth at 37°C, harvested, and adjusted to OD6006 × 108 CFU/ml. Agglutination was performed on glass slides by mixing 20 μl E. coli with an equal volume of 2% baker's yeast suspension in water with and without an equal volume of CE and LA at the concentration of 128 mg/ml. 2.3. In Vivo Studies 2.3.1. Ethical Considerations The animal care and all experimental procedures were in accordance with the applicable international, national, and institutional guidelines and reviewed and approved by the Local Ethics Committee for Experiments on Animals in Wroclaw (No. 17/2017). 2.3.2. Animals Male Wistar rats (220-260 g) were purchased from the Animal Research Center at Wroclaw Medical University (Wrocław, Poland) and throughout the acclimatization and study periods kept in pairs in polypropylene cages with water ad libitum. Rats were housed in a controlled environment at a temperature of 21-24°C and humidity of 55-60% in 12 h light/dark cycle with free access to standard rodent chow (Agropol, Poland) except for the single procedure of deprivation. 2.3.3. Experimental Design The schedule of studied compound administration (16 days of pretreatment) was chosen in order to assess whether these compounds prevent occurrence or decrease colon damages induced by TNBS administration that resembles the most prevention of exacerbations of IBD after the remission period in humans. After 7 days of the handling period, rats were randomly assigned to 11 groups (7-8 rats in each) as follows: control group receiving distilled water intragastrically (IG) and once saline per rectum (PR), colitis (TNBS) group receiving distilled water IG and once TNBS solution PR, and 9 groups receiving IG: CE (20 or 100 mg/kg) or LA (10 or 50 mg/kg) or sulfasalazine (SA, 100 mg/kg) or CE (20 or 100 mg/kg) with SA (100 mg/kg) or LA (10 or 50 mg/kg) with SA (100 mg/kg) and once TNBS solution PR. Distilled water, CE, LA, and SA were given once daily by a gastric tube (4 ml/kg b.w.) for 16 consecutive days. Normal saline and TNBS solution were given rectally on the 15th day of the experiment, after 24 h of food deprivation. Animals were observed and weighed daily. Forty-eight hours after induction of colitis, rats were sacrificed by cervical dislocation under deep pentobarbital anesthesia (200 mg/kg, Biowet, Poland). The distal 8 cm segment of the colon was excised from each rat, placed on an ice-cold plate, and longitudinally opened, cleaned, weighed, and subjected to macroscopic assessment. Afterward, samples were divided into three pieces. The first piece was fixed in 4% buffered formalin for histopathological examination. The second piece was used to prepare tissue homogenates. After centrifugation at 4000 rpm for 10 min at 4°C, the supernatants were transferred into new tubes and stored at -80°C for biochemical analyses. The third piece was used in gene expression analysis. 2.3.4. Induction of Experimental Colitis Experimental colitis was induced by 2,4,6-trinitrobenzenesulfonic acid (Sigma-Aldrich, Germany) according to the well-established colitis model originally described by Morris et al. [24]. Briefly, rats were anesthetized with ketamine (75 mg/kg, Biowet, Poland) and medetomidine (0.5 mg/kg, Orion Pharma, Poland) and positioned on their right side. Then, TNBS (50 mg/kg) dissolved in 50% ethanol (v/v, ChemPur, Poland) was infused into the colon via a polyethylene catheter (external diameter 2 mm) inserted into the lumen of the colon through the rectum with the tip positioned approximately 8 cm proximal to the anus. For the next 5 min, animals were kept in the Trendelenburg position to prevent leakage of the instilled solution. 2.3.5. Assessment of the Body Weight and Colon Index Throughout the experimental period, animals were weighed once daily. The difference in body weight between the 15th and 17th days of the experiment was determined. For each excised 8 cm long specimen of the colon, colon wet weight was measured. Then, the colon index was calculated as the ratio of colon wet weight to total body weight. 2.3.6. Macro- and Microscopic Assessment of Colon Injury Colon macroscopically visible damage was examined blindly, immediately after resection using a 0-5 scale, which takes into account the area of inflammation and the presence or absence of ulcers [25]. Then, colon sections were collected for the histological examinations. The material was fixed in 4% buffered formalin (ChemPur, Poland), embedded in paraffin, cut into 4 μm thick slices using a rotary microtome (Sakura Accu-Cut SRM, Netherlands), and placed on glass slides. Preparations were stained using three methods: hematoxylin-eosin, Giemsa, and alcian blue for histological assessment of colonic damage, cell infiltration, and mucus content, respectively. Tissue sections were evaluated, and images were taken by standard light microscopy (Olympus CX41 microscope coupled to a DP20 camera, Olympus Soft Imaging Solutions GmbH–cell^D ver. 3.2, Olympus, Germany). Histological damage was assessed in a blinded fashion by the experienced pathologist using the scoring scales, based on the previously presented criteria [26]. In hematoxylin-eosin staining, the result was the sum of points (0-25) scored by evaluation of each criterion. In Giemsa staining, inflammatory cell infiltration was assessed using a 0-4-point scale. Specimens stained with alcian blue were assessed by description considering goblet cell number and size and amount of sialomucins. 2.3.7. Cytokine Quantification by Enzyme-Linked Immunosorbent Assay (ELISA) The concentrations of IL-23, IL-17, TNF-α, and chemerin were measured in obtained supernatants with quantitative enzyme immunoassay rat specific kits: Rat IL-23 ELISA Kit, Rat IL-17 ELISA Kit, Rat TNF-α ELISA Kit, and Rat Chemerin ELISA Kit, respectively (Diaclone, France) following the manufacturer's instructions. All concentrations were expressed as pg/ml. 2.3.8. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction (qPCR) Tissue specimens were soaked in RNAlater (Ambion Inc., USA) and stored at -80°C until RNA isolation. Tissue fragments up to 40 mg were homogenized using FastPrep-24 Homogenizer (MP Biomedical, USA) in lysis buffer (Thermo Fisher Scientific, USA) with the addition of β-mercaptoethanol (Sigma-Aldrich, USA). RNA was isolated using phenol-chloroform extraction and purified using the PureLink™ RNA Mini Kit (Thermo Fisher Scientific). Genomic DNA was removed by on-column treatment of RNA isolates with DNase (PureLink™ DNase Set, Invitrogen™, Thermo Fisher Scientific). The concentration of isolated RNA was quantified using NanoDrop 2000 (Thermo Fisher Scientific) with a concomitant evaluation of RNA purity (ratios of absorbance at 260, 280, and 230 nm). Subsequently, 1 μg of RNA per reaction mixture (20 μl) was reversely transcribed in a C1000 thermocycler (Bio-Rad, Poland) using the iScript™ cDNA Synthesis Kit (Bio-Rad, Poland) and the manufacturer's protocol. All samples were accompanied by matching negative transcription (“no-RT”) controls, devoid of reverse transcriptase, and subsequently tested to assure a lack of contamination with genomic DNA. The quantitative (real-time) PCR (qPCR) reactions were conducted using the CFX96 Real-Time PCR system (Bio-Rad) and SsoFast EvaGreen® Supermix (Bio-Rad). The following cycling conditions were applied: 30 sec activation at 95°C, 5 sec denaturation at 95°C, annealing/extension for 5 sec at 61°C, and 40 cycles, followed by a melting step (60-95°C with fluorescent reading every 0.5°C). The reaction mixture contained 2 μl of cDNA (diluted 1 : 7.5), 10 μl of 2x SsoFast EvaGreen® Supermix, 1 μl of each 10 nM forward and reverse target-specific primer, and water up to 20 μl. Primer specificities were tested by melting curve analysis and electrophoresis in high-resolution agarose (SeaKem LE agarose, Lonza, Switzerland) in TBE with SYBR Green (Lonza) detection. Primers' sequences are presented in Table 2. Primers were synthesized by Genomed (Poland). Prior expression analysis technical replicates were averaged. For each sample, a normalized relative quantity (NRQ) of a given gene transcript was calculated using qBasePlus version 2.4 software (Biogazelle BE, Belgium). The NRQ was calculated as 2^(ΔCq : differencebetweenthegeometricmeanofCqinthewholegroup–sampleCq) normalized to GAPDH, used as an internal control. 2.4. Statistical Analysis All experimental data are presented as meanvalues ± standarddeviation(SD). Statistical differences between studied parameters were analyzed using one-way analysis of variance (ANOVA) and multiple comparisons with Tukey's post hoc test. All statistical analyses were performed with GraphPad Prism version 8.0 (GraphPad Software, USA) with statistical significance set at p value < 0.05. 3. Results 3.1. Cornelian Cherry Iridoid-Polyphenolic Extract but Not Loganic Acid Exerts Antibacterial Activity In Vitro The MIC values of CE against nonpathogenic E. coli K-12 C600 and pathogenic E. coli LF82 were 0.125 mg/ml and 0.0625 mg/ml, respectively, whereas MBC values were higher than MIC values and were the same for both E. coli strains (16 mg/ml). MIC and MBC values of reference gentamycin against both the nonpathogenic and pathogenic strains were 0.25 μg/ml and 0.5 μg/ml, respectively. Antibacterial agents are usually regarded as bactericidal if their MBC is no more than four times the MIC value. Thus, CE showed bacteriostatic rather than bactericidal activity against both E. coli strains as MBC/MIC ratios for E. coli K-12 C600 and E. coli LF82 were 128 and 256, respectively. On the contrary, loganic acid showed no antibacterial activity with MIC and MBC values > 128mg/ml for both E. coli strains. 3.2. Cornelian Cherry Iridoid-Polyphenolic Extract but Not Loganic Acid Inhibits Adherence of Pathogenic E. coli Strain LF82 to Intestinal Epithelial Cells and E. coli Mannose-Sensitive Type 1 Fimbria Function In Vitro For in vitro adherence assay, increasing concentrations of CE and LA, ranging from 2 to 10 mg/ml, were used. Cornelian cherry iridoid-polyphenolic extract in all concentrations significantly inhibited adherence of both the pathogenic and nonpathogenic E. coli strains to intestinal epithelial cells (p < 0.01), and this action was independent of studied CE concentration (Figures 1 and 2). In contrast, loganic acid in all studied concentrations does not affect the adherence to IECs of both E. coli strains (Figure 2). Type 1 pili of E. coli are involved in their adherence to the IECs. Thus, the yeast cell agglutination assay was performed. Similar to the adherence test, only CE significantly reduced the agglutination of yeast cells by fimbriated E. coli. The control agglutination of yeast cells by both fimbriated E. coli strains was very strong and observed within a few seconds. Contrary, when E. coli strains were first mixed with an equal volume of CE, and then with yeast cells, the agglutination appeared after minutes and was much weaker compared to the agglutination of yeast cells without CE (Figure 3). 3.3. Cornelian Cherry Iridoid-Polyphenolic Extract but Not Loganic Acid Prevented the Body Weight Loss in Rats with TNBS-Induced Colitis Significant body weight loss was noticed in the TNBS group in comparison to the control group (p < 0.05), suggesting that TNBS effectively induced colitis. The body weight loss was remarkably improved only in the group pretreated with CE at the high dose (100 mg/kg) when compared to the TNBS group (p < 0.001), and this action was more effective than that provided by sulfasalazine (p < 0.01). The body weight loss in other pretreated groups was repressed, but the effect was not considered statistically significant. No significant differences were observed between studied groups as regards the colon index. A merely insignificant increase in the colon index was noticed in the TNBS group compared to the healthy control rats (Table 3). 3.4. Cornelian Cherry Iridoid-Polyphenolic Extract but Not Loganic Acid Protected from Macro- and Microscopic Pathological Changes in Rats with TNBS-Induced Colitis In TNBS-induced colitis, macroscopic damages (performed on a 0-5-point scale) involved bowel wall thickening, hyperemia, and edema, and when compared to the control group, these changes were significant (p < 0.001). Epithelial damages, inflammatory cell infiltration, and mucosal architecture disorganization were defined as the three main categories with respective subordinate specific criteria described in detail in the legend of Table 4. In a microscopic examination, mucosal hyperemia with significant declines and ulcerations involving not only the epithelial layer but also all intestinal layers in some of the studied specimens was observed (Figure 4). Infiltration of inflammatory cells, including lymphocytes, macrophages, and neutrophils, ranging from mainly focal mucosal localization through the submucosa and the muscularis propria to transmural infiltrates in the most severe cases was found. Pronounced edema of the mucus and submucous membrane along with strong stimulation of the lymphatic apparatus was noticed. Major changes that originally apply to epithelial cell layers included crypt epithelial cell hyperplasia, the loss of goblet cells, cryptitis and crypt abscesses, and erosions. In specimens of TNBS-induced colitis, structural distortion of crypts and desquamated areas or loss of the epithelium was shown (Figures 4 and 5). Intestinal inflammation was linked with goblet cell depletion leading to the decline of the mucus layer of the epithelium. Colons in the TNBS group showed less regular structure of goblet cells, their smaller number, less frequent cell distribution in crypts and villi, and less mucus. At the regions of mucosal damage, goblet cells were damaged, and mucus was present extracellularly within the damaged and swollen submucosa. No goblet cells in the ulcer center, with only a small number of them on the ulceration periphery and normal number only in undamaged mucosa, were found (Figure 6). Scoring of colonic tissue samples from each group indicates that pretreatment with cornelian cherry iridoid-polyphenolic extract at the high dose (100 mg/kg) or with sulfasalazine attenuated the colonic lesions induced by TNBS and thereby reduced macro- and microscopic damages contrasted to the TNBS group (p < 0.05 in all cases). Similarly, coadministration of CE at the dose of 100 mg/kg with sulfasalazine remarkably prevented the macro- and microscopic damages in comparison to the TNBS group (p < 0.01 in all cases), but the action of combined pretreatment was not greater than administration of each one alone (p = NS). In histological examination, rats pretreated with CE or SA alone or CE with SA showed explicit recovery of colon tissues with decreased extent and intensity of ulceration and reduced inflammatory cell infiltration (Figures 4 and 5). Only CE- or CE with SA-pretreated rats revealed an increased amount of goblet cells and restored epithelial cell layers. In these rats, goblet cells were characterized by an abundant amount of mucus, regular structure, almost equal size, and regular distribution in intestinal crypts in both the longitudinal and transverse sections (Figure 6). 3.5. Cornelian Cherry Iridoid-Polyphenolic Extract Counteracted Increased Colonic Levels of Proinflammatory Cytokines in Rats with TNBS-Induced Colitis The concentrations of IL-23, IL-17, TNF-α, and chemerin were significantly increased by TNBS administration as compared to the control group (p < 0.01, p < 0.01, p < 0.001, and p < 0.01, respectively). Pretreatment with CE at the high dose (100 mg/kg) prevented from this increase and normalized all studied cytokine concentrations in colon tissues when compared with the group receiving only TNBS (p < 0.001, p < 0.01, p < 0.01, and p < 0.05, respectively), while the administration of CE at the low dose (20 mg/kg) prevented only from the IL-17 concentration increase (p < 0.05). Pretreatment with cornelian cherry iridoid-polyphenolic extract at the high dose counteracted increased IL-23 and chemerin levels more effectively than sulfasalazine (p < 0.01 and p < 0.05, respectively). Studied extract at the high dose given in combination with sulfasalazine also normalized concentrations of all studied cytokines as compared to the TNBS group (p < 0.05, p < 0.001, p < 0.001, and p < 0.05, respectively), and the effect on IL-17, TNF-α, and chemerin levels was even greater than after sulfasalazine in monotherapy (p < 0.05 in all cases). It indicates that cornelian cherry iridoid-polyphenolic extract not only strongly attenuated inflammatory response in rat colon tissues but also can act synergistically with sulfasalazine. Administration of loganic acid at the high or low dose alone or in combinations with sulfasalazine did not significantly improve the course of experimental colitis, considering almost all studied cytokines. Only pretreatment with LA at the high dose, together with sulfasalazine, significantly protected from the increase of the TNF-α concentration in comparison to the colitis group (p < 0.01), but the action of combined treatment was not greater than the administration of sulfasalazine alone (p = NS; Table 5). 3.6. Cornelian Cherry Iridoid-Polyphenolic Extract and Loganic Acid Regulated Muc2, TFF3, and STAT3 mRNA Expression in Rats with TNBS-Induced Colitis Induction of colitis caused a decrease in intestinal Muc2 and TFF3 mRNA levels and an increase in STAT3 mRNA expression as compared to the control group (p < 0.01, p < 0.05, and p < 0.01, respectively). Pretreatment with CE at the high dose (100 mg/kg) resulted in more than a 3.5-fold increase in the Muc2 mRNA level as compared to the TNBS group (p < 0.05), and this effect was close to that provided by sulfasalazine. Concomitantly administrated CE at the high dose and sulfasalazine elevated the Muc2 mRNA level near 6-fold in comparison to the colitis group (p < 0.001), and the effect of combined treatment was even greater than the administration of CE or sulfasalazine alone (p < 0.05 in both cases). Administration of CE at the high dose resulted in a 4-fold increase in the TFF3 mRNA level as compared to the TNBS group (p < 0.05) in contrast with SA, whose effect was not statistically significant (p = NS). Pretreatment with loganic acid at the high dose (50 mg/kg) elevated TFF3 mRNA expression as compared to TNBS-subjected rats (p < 0.001) in a more efficient way than with SA (p < 0.05). In contrast, for coadministration of LA at the high dose, SA was not more effective than administration of sulfasalazine alone (p = NS). Increased expression of STAT3 mRNA was inhibited only when the group receiving TNBS was pretreated with sulfasalazine (0.56-fold) or CE at the high dose together with sulfasalazine (0.54-fold) (p < 0.05 and p < 0.01, respectively), but the combined treatment gave no additional effect (p = NS; Figure 7). 4. Discussion As stated in Introduction, the research was carried out to evaluate the impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on AIEC strain growth and adhesion to intestinal epithelial cells as well as assessing the influence of CE and LA and the combination of each of these phytocompounds with sulfasalazine on intestinal inflammation in experimental colitis. Despite the accessibility of genetic and spontaneous models that mimic IBD, TNBS-induced colitis remains a valuable implement in the preclinical studying of various natural or chemical compounds in terms of their anti-inflammatory and immunomodulatory effects. Moreover, the TNBS model shares many biochemical and immunological features and symptoms with the disease in humans, especially with human CD, which has a predominant Th1 and Th17 profile [11, 27]. Impaired mucosal epithelial barrier integrity results in a thinner mucus layer due to goblet cell depletion and is associated with both the pathogenesis of IBD and experimental TNBS-induced colitis [27]. The defective mucosal barrier leads to interactions between the luminal contents, such as intestinal microbiota and the underlying immune system triggering the exacerbated intestinal immune response [11]. Microbiota and microbial products can modulate mucin synthesis and secretion by direct activation of diverse signaling cascades or via factors produced by epithelial and lamina propria cells. Normally, the mucus layer is in equilibrium between synthesis and decay by the colonic microbiota. Pathogens circumvent the protective function of the mucus layer by developing specific mechanisms to subvert and penetrate the mucus barrier [28]. AIEC strain LF82 is a good case in point. First, AIEC overcomes the mucus layer owing to Vat-AIEC protease which causes the degradation of mucins and decreases mucus viscosity [29], then strongly adheres to and invades intestinal epithelial cells, and colonizes gut mucosa by binding type 1 pilus mannose-specific adhesins (FimH) to the host carcinoembryonic antigen-related cell adhesion molecules (CEACAM6) [6, 30]. Moreover, AIEC is able to survive and replicate within macrophages, inducing the secretion of TNF-α and promoting granuloma formation [7]. The strain LF82 can colonize intestinal mucosa in the absence of overt disease yet able to induce intestinal inflammation in genetically predisposed individuals [31]. AIEC strains are primarily implicated in the ileal form of CD [19]. However, more recent studies have shown an increased prevalence of AIEC strains in the mucosa not only in CD but also in UC patients compared to healthy subjects [32]. Thus, the bacteriostatic and antiadhesive activities of CE against AIEC strains indicated in this paper suggest a possible therapeutic use of this extract in the treatment of AIEC-colonized IBD patients. In a previous study, Milenković-Andjelković et al. [33] showed that cornelian cherry fruit extract exerted antimicrobial activity against E. coli bacteria with MIC and MBC values 125 and 250 μg/ml, respectively. The MIC value for CE obtained in our study against nonpathogenic E. coli strain was the same as in the study of Milenković, whereas MIC against adherent-invasive E. coli was 62.5 μg/ml. It may give some potential benefits in the prevention of physiological microbiome dysfunction using CE with the action predominantly against pathological bacteria. Differences in MBC values in both studies are difficult to explain and may be caused by, e.g., different solvents and conditions used to prepare extracts. Antimicrobial activity of CE can be attributed to its high phenolic compound content, which has been reported to disintegrate the outer membrane of Gram-negative bacteria, releasing LPS and increasing the permeability of the cytoplasmic ATP [34, 35]. Adhesion of bacteria to host cells is a prerequisite for successful microbial colonization [35, 36]. The antiadhesive effect of CE, similar to other polyphenol-rich sources such as cranberry fruits, most probably was associated with the ability of its compounds to interact with FimH adhesins located at the distal tip of pili and constitutes an important adhesive protein promoting E. coli binding to the host cells [35–37]. The interaction between AIEC type 1 pili and oligomannose glycans on the surface of intestinal epithelial cells plays a key role in enabling AIEC to become established on the intestinal epithelium [30]. Type 1 pili are responsible for mannose-sensitive yeast cell agglutination as D-mannose, and its analogs inhibit this effect [38]. The ability of CE to reduce yeast cell agglutination via type 1 piliated E. coli strongly suggests that the compounds of cornelian cherry iridoid-polyphenolic extract interact with the adhesins. The therapeutic rationale for FimH antagonists in IBD is to prevent bacteria binding to IECs and wash them out of the gut without disruption of the intestinal microbiota. This paper fits in with the trend of searching adhesin antagonists as a treatment approach for IBD. Some efforts have been recently made to identify small-molecule FimH antagonists that target the mannose-binding lectin domain of FimH, inhibiting its function and preventing AIEC binding to mannosylated host cells [39]. In addition to bacteriostatic and antiadhesive properties of the cornelian cherry iridoid-polyphenolic extract, the results found in this study revealed that CE enhanced mucosal epithelial barrier restoration and protected the goblet cells and their content, such as Muc2 and TFF3. Muc2 is the predominant colonic mucus layer mucin that provides essential defense against endo- and exogenous irritants and bacterial adhesion to underlying epithelial cells [28]. The importance of Muc2 for maintenance of mucosal integrity is emphasized in Muc2-deficient mice, which developed spontaneous colitis and were susceptible to experimental colitis induced by dextran sodium sulfate (DSS) [40]. TFF3 interacts with Muc2 to reinforce the structural integrity of the intestinal barrier. Moreover, TFF3 is indispensable to restore the continuity of the epithelium and regeneration of mucosal integrity after injury. The compelling role of TFF3 in resealing the intestinal epithelial barrier is to enable the migration of viable epithelial cells from the injury edge to the denuded area, so-called restitution [41]. Thus, an increase in Muc2 and TFF3 expression should contribute to improving mucosal epithelial barrier architecture and function. This kind of action has been demonstrated in this study, and as far as we know, this work is the first to evaluate the effect of cornelian cherry iridoid-polyphenolic extract and loganic acid and concomitant administration of these phytocompounds with sulfasalazine in rat experimental colitis. Cornelian cherry iridoid-polyphenolic extract restored the expression of proteins involved in epithelial integrity, such as Muc2 and TFF3, which were shown at the mRNA level. In turn, sulfasalazine as a standard drug in IBD treatment was able to increase only Muc2 expression. This is consistent with findings reported by other authors who have shown that sulfasalazine given prior or after induction of inflammation by TNBS increased only Muc2 mRNA expression, whereas polyphenol-rich plant-derived extracts augmented both Muc2 and TFF3 expression [42, 43]. Besides increasing expression of Muc2 and TFF3, polyphenols have also been stated to be able to cross-link mucin, enhancing the viscosity and elasticity of the mucus layer [44], thereby stabilizing the intestinal mucus layer [45]. It is noteworthy that concomitantly administrated CE and SA exerted greater effect than each one alone in regard to Muc2 expression, which suggests that CE acts synergistically with SA. The content of mucin in the mucosa was confirmed by histological evaluation with alcian blue staining which showed the restored mucosal epithelial layer, increased number and size of goblet cells and amount of acid glycoproteins (mainly sialomucins), and improved adherents and tight junctions leading to the appropriate cover of the mucus layer over the intestinal epithelium after CE and CE with SA treatment prior to colitis induction. A more pronounced protective effect exhibited by CE with SA can be explained by the fact that Muc2 and TFF3 together act more effectively in protecting epithelial cells when compared with either one alone [46], which indicates their joint effect in mucosal protection. Interestingly, the expression of TFF3 mRNA was the most upregulated after pretreatment with loganic acid at the high dose (50 mg/kg). The action of LA was significantly greater than the effect of sulfasalazine. It may suggest that loganic acid is a crucial ingredient required to improve TFF3 but not Muc2 expression. Quite possibly, other than LA ingredients from cornelian cherry extract are connected with the Muc2 expression increase and provide synergistic action between SA and CE, i.e., ellagic acid. Rosillo et al. [47] indicated that ellagic acid enhanced mucus production by goblet cells in the colon mucosa in TBNS-induced colitis. Restoration of the mucosal epithelial barrier and thereupon separation of an antigen-rich gut lumen from the lamina propria immune system can contribute to reduce exaggerated antigenic stimulation of nonspecific and specific immune responses and can lead to the inhibition of intestinal wall inflammation characterized by excessive production of proinflammatory cytokines [28]. It is well known that TNF-α is implicated in the initiation and perpetuation of intestinal inflammation in IBD [48]. Recently, an overwhelming number of clinical and experimental observations showed the IL-23/IL-17 axis as an essential mediator involved in IBD [4, 49–51]. IL-23, produced by activated monocytes, macrophages, and dendritic cells, acts on the innate immune system cells, contributes to the inflammatory cytokine production and tissue inflammation, and promotes the expansion and maintenance of Th17 cells, which secrete the proinflammatory cytokine IL-17 involved in neutrophil activation and proinflammatory mediator production from different cells [4, 49]. IL-17 is produced predominantly by Th17 cells but also by γδ T cells and innate lymphoid cells (ILCs) [50]. Th17 differentiation from naive T cells and IL-17 expression firmly depend on transcription factor STAT3 and cytokines such as IL-1β and IL-6 [52]. Contrary, IL-23 is not strictly required for Th17 differentiation but plays a crucial role in maintenance, expansion, and pathogenicity of the Th17 cell phenotype and facilitates the production of IL-17 from Th17 and ILCs, but not γδ T cells [51]. Moreover, IL-23 stimulates Th17 and ILCs to produce TNF-α, granulocyte-macrophage colony-stimulating factor (GM-CSF), and several chemokines leading to immune response induction and inflammatory cell infiltration [49]. Another inflammatory mediator, chemerin, released by colonic epithelial cells, is an attractant for immune cells. Likewise, chemerin contributes to tissue macrophage recruitment, enhances IL-6 and TNF-α secretion in colonic epithelial cells, and suppresses the anti-inflammatory M2 macrophage response, which is most likely associated with the higher release of inflammatory cytokines [53]. TNF-α, IL-23, IL-17, and chemerin levels and gene expression of STAT3 are significantly elevated and positively correlated with the severity of both IBD and experimental colitis [4, 27, 48, 54]. Recently, therapeutic compounds that antagonize inflammatory mediators have been introduced into clinical practice. Monoclonal antibodies against TNF-α are now used and have been proven effective for the treatment of IBD patients [48, 55]. At present, several antibodies acting via IL-23/IL-17 pathway inhibition have been developed and examined in several preclinical and clinical studies [55]. Although phytocompounds studied in this work do not belong to monoclonal antibodies, they are also targeted at blocking proinflammatory cytokines. We have indicated that cornelian cherry iridoid-polyphenolic extract at the high dose (100 mg/kg) significantly reversed the increased colonic level of all studied cytokines but not STAT3 expression caused by TNBS whereas sulfasalazine normalized TNF-α and STAT3 expression. Similarly, results described by da Silva et al. indicating that SA decreased gene expression of STAT3 and the colonic level of TNF-α [56]. While our study was in progress, Süntar et al. [57] reported that extract of cornelian cherry at a very high dose (400 mg/kg) administered for 14 days after TNBS-induced colitis decreased TNF-α and IL-1β levels and the effect was close to that of sulfasalazine given at the same dose as in our study (100 mg/kg). It is worth mentioning that in our study, all tested compounds were used as prevention before colitis induction, while in Süntar et al.'s study, cornelian cherry extract was given after TNBS administration as a colitis treatment. Phenolic compounds are known for their potent ability to modulate crucial inflammatory signaling pathways and gene regulation of several inflammatory enzymes and cytokines [58, 59]. Although several studies demonstrated that polyphenols exhibited a strong attenuating effect against colitis, there are only a few papers concerning the effect of polyphenols on the IL-23/IL-17 axis and STAT3 expression in experimental colitis. Extract from Terminalia catappa containing ellagic acid—a phenolic compound present also in CE—reversed increased IL-23 colonic expression [60]. Cocoa phenolic compounds exhibited an anti-inflammatory effect decreasing the expression of TNF-α, IL-17, and STAT3 in colonic tissues during DSS colitis [61]. Apple polyphenols ameliorated DSS colitis and dampened the expression of proinflammatory transcripts, such as IL-6, IL-17, IL-22, and TNF-α [62]. The impact of polyphenols containing plant extracts [42, 43, 63, 64] or pure phenolic compounds [65, 66] on TNF-α and IL-17 colonic levels was studied by some other research studies. Furthermore, it is noteworthy that in TNBS-subjected rats, one of the polyphenol groups, anthocyanins, especially pelargonidin, not only reversed intestinal inflammation and increased expression of TNF-α and IL-6 but also promoted the anti-inflammatory M2 macrophage expansion, which is inhibited by chemerin [67]. We did not find any previous studies investigating the impact of polyphenolic compounds, including cornelian cherry extract on chemerin tissue levels during TNBS colitis. To our best knowledge, our study is the first to evaluate the effect of concomitantly administered cornelian cherry iridoid-polyphenolic extract and sulfasalazine in experimental colitis in rats, indicating that such combined pretreatment prevented not only the increase in colonic cytokine levels but also the increase in TNBS-induced STAT3 expression. This combined therapy is even more effective than monotherapy with SA in regard to IL-17, TNF-α, and chemerin expression. The strong cytokine level normalization seems to be a crucial anti-inflammatory mechanism common to CE and SA, but the additional greater ability of CE and SA coadministration to decrease colonic cytokine levels may show the synergistic anti-inflammatory action between these compounds. It should be pointed out that besides the high efficacy of blocking IL-23 (e.g., by ustekinumab) as well as the important role of the IL-23/IL-17 axis in IBD pathogenesis and severity [4, 49–51, 68], the IL-17 neutralizing agent, secukinumab, is ineffective in CD patients in RCT [69]. A possible explanation for this negative result of IL-17 blockade may be complex molecular pathways underlying IBD with the same cytokine possessing both the protective and pathogenic effects on mucosal inflammation. As demonstrated by Lee et al. [50], IL-17 can be produced by multiple adaptive and innate cell populations. The source of gut-protective IL-17 was IL-23-independent γδ T cells as opposed to gut-pathogenic IL-17 produced by IL-23-dependent Th17 and ILCs. We believe that the studied extract decreasing the IL-23 level minimizes tissue inflammation, Th17, and ILC activation, whereas leaving the protective IL-17 from IL-23-independent γδ T cells unharmed. Further work needs to be carried out to establish whether CE reduces IL-17 production by γδ cells or Th17 and ILCs. In addition to polyphenolic compounds studied, cornelian cherry extract contains a considerable amount of iridoids. It has been reported that an iridoid-rich fraction of Syringae folium extract possessed an anti-inflammatory effect against TNBS-induced colitis in rats through inhibiting proinflammatory cytokines (TNF-α, IL-6) by downregulating the expression of NF-κB [70]. Cornus officinalis and its isolated iridoids, such as loganin and cornuside, showed anti-inflammatory effects in both the in vitro [71–73] and in vivo models [74, 75]. Sozański et al. [13] demonstrated that loganic acid, iridoid isolated from cornelian cherry fruits, exerted anti-inflammatory effects decreasing TNF-α and IL-6 concentrations during atherosclerosis. The authors also concluded that the main anti-inflammatory effects of the cornelian cherry fruit should be attributed to its iridoid fraction. Therefore, encouraged by these results, we decided to study the effect of not only the whole cornelian cherry extract but also the isolated loganic acid in the rat experimental colitis model. Based on the findings of the aforementioned authors, strong anti-inflammatory loganic acid activity was expected in the currently undertaken study [13, 70–75]. However, our results turned out to be surprising. Contrary to expectations, no activity of loganic acid in regard to inflammatory mediators was demonstrated in the TNBS-induced colitis model except for the TNF-α level decrease by combined LA and SA administration. This may indicate that loganic acid affects other proinflammatory signaling pathways not involved in IBD pathogenesis. Perhaps other iridoids present in cornelian cherry extract, e.g., cornuside, act as anti-inflammatory in colitis [71, 76]. We hypothesize that discrepancy between anti-inflammatory LA actions reported in the paper of Sozański et al. [13] and the current study may result from LA pharmacokinetics and its metabolism. Iridoids are considered well-absorbed compounds [77], which may be the reason for their low concentration in the inflamed colon. On the contrary, polyphenols, as particles of high molecular weight, have low gastrointestinal absorption but may exert a significant local effect in TNBS-induced colitis. It is estimated that approximately 90–95% of total dietary polyphenols reach the colon unabsorbed. Unabsorbed polyphenols are able to interact with the intestinal microbes and gut epithelium and exert their functions within the gut [78]. It cannot be excluded that alterations in the microbiome after TNBS can lead to the formation of inactive metabolites of iridoids resulting in poor anti-inflammatory activity in colitis. It, for sure, requires further research to thoroughly study the pharmacokinetics of loganic acid and microbiome in TNBS-induced colitis. 5. Conclusions The results we found in this study point to the conclusion that cornelian cherry iridoid-polyphenolic extract exerted a protective effect against TNBS-induced colitis in rats via restoration of the damaged mucosal epithelial barrier and attenuation of the intestinal inflammatory response, presumably due to its polyphenolic content. Cornelian cherry iridoid-polyphenolic extract given concomitantly with sulfasalazine counteracted colitis in a more effective way than sulfasalazine alone, indicating a synergistic interaction between CE and SA. The multidirectional effect of CE seems to be beneficial when considering this extract as a candidate for adjuvant IBD therapy. CE could be coadministrated with any drug regardless of its mechanism. Iridoid-polyphenolic extract from the little-known, edible European fruit used in traditional folk medicine may constitute a promising source of phytocompounds to IBD therapy targeted at reinforcement of the mucosal epithelial barrier, modulation of the production of inflammatory mediators, and antiadhesive action. Further studies are needed to confirm that cornelian cherry iridoid-polyphenolic extract could constitute a preventive strategy or adjuvant treatment for patients suffering from IBD and whether an individual compound or rather a complex extract is more potent and promising in IBD attenuation. Acknowledgments The authors are grateful to MSc. Joanna Kwiatkowska for technical assistance in our experimental work and MSc. Julia Freier for support with experiment conduction. We would also like to apologize to colleagues for not mentioning all the papers relevant to this field because of space restrictions. This work was supported by the Grant for Young Scientists from Wroclaw Medical University (Pbmn No. 139). Abbreviations CE:Cornelian cherry iridoid-polyphenolic extract LA:Loganic acid. Data Availability The data underlying this article will be shared on request to the corresponding author. Additional Points Conference Presentation. Szandruk-Bender M., Sozański T., Rutkowska M., Merwid-Ląd A., Kwiatkowska J., Kucharska AZ., Piórecki N., Szeląg A. Effect of cornelian cherry iridoid-polyphenolic fraction and loganic acid on IL-23/IL-17 expression in colitis model in rats. 20th International Congress of the Polish Pharmacological Society, Lublin, Poland, 5-7 June 2019; 134-135. Conflicts of Interest The authors declare no conflicts of interest regarding the publication of this paper. Authors' Contributions MSB and MR conceived the overall project objectives; MSB, MR, AML, BS, and TS designed the experiments; MSB, ADM, UW, MT, and IBM conducted the experiments; MSB and AML interpreted the data and prepared the original draft of the manuscript with contributions from all authors; AS, BW, SD, BS, MKK, AZK, AM, BN, and TS contributed to data interpretation review and editing; AZK and NP were responsible for the plant material; SD was the veterinary pathologist who blindly scored tissues. Figure 1 Adherence of E. coli strains to intestinal epithelial Int407 cells. E. coli strain LF82 in LB (a) and in LB with 2 mg/ml cornelian cherry iridoid-polyphenolic extract (c). E. coli strain K-12 C600 in LB (b) and in LB with 2 mg/kg cornelian cherry iridoid-polyphenolic extract (d). Magnification 100x. Figure 2 Adherence of E. coli LF82 and K-12 C600 to Int407 epithelial cells untreated (LB) and treated with different concentrations of cornelian cherry iridoid-polyphenolic extract (a) and loganic acid (b). Data are presented as meanvalues ± SD. Differences ∗∗p < 0.01 and ∗∗∗p < 0.001 were deemed statistically significant. Figure 3 Yeast agglutination in the presence of cornelian cherry iridoid-polyphenolic extract. Negative controls were cornelian cherry iridoid-polyphenolic extract at the concentration of 128 mg/ml mixed with an equal volume of water (a), cornelian cherry iridoid-polyphenolic extract mixed with E. coli strain K-12 C600 (b), 2% yeast suspension with water (e), and E. coli strain LF82 mixed with cornelian cherry iridoid-polyphenolic extract (f). Positive controls were E. coli strain K-12 C600 mixed with 2% yeast suspension (c) and E. coli strain LF82 mixed with 2% yeast suspension (g). Experimental groups were E. coli strain K-12 C600 with 2% yeast suspension and cornelian cherry iridoid-polyphenolic extract (d) and E. coli strain LF82 mixed with 2% yeast suspension and cornelian cherry iridoid-polyphenolic extract (h). Magnification 20x. Figure 4 Microscopic appearance of colon tissues after hematoxylin-eosin staining demonstrated that cornelian cherry iridoid-polyphenolic extract reduces histological damage. Control group (a); group receiving only TNBS (b); groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively (c, d); group receiving 100 mg/kg sulfasalazine with TNBS (e); groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively (f, g). Magnification 100x. Figure 5 Microscopic appearance of colon tissues after Giemsa staining demonstrated that cornelian cherry iridoid-polyphenolic extract reduces inflammatory cell infiltration. Control group (a); group receiving only TNBS (b); groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively (c, d); group receiving 100 mg/kg sulfasalazine with TNBS (e); groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively (f, g). Magnification 100x. Figure 6 Microscopic appearance of colon tissues after alcian blue staining demonstrated that cornelian cherry iridoid-polyphenolic extract prevents loss of the mucus layer. Control group (a); group receiving only TNBS (b); groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively (c, d); group receiving 100 mg/kg sulfasalazine with TNBS (e); groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively (f, g). Magnification 100x. Figure 7 The impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on the gene expression of transcription factor STAT3 (a), intestinal mucosal barrier protein Muc2 (b), and TFF3 (c) in experimental groups. Control = control group; TNBS = group receiving only TNBS; CE20, CE100 = groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively; LA10, LA50 = groups receiving 10 or 50 mg/kg loganic acid with TNBS, respectively; SA = group receiving 100 mg/kg sulfasalazine with TNBS; CE20+SA, CE100+SA = groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively; and LA10+SA, LA50+SA = groups receiving 10 or 50 mg/kg loganic acid and 100 mg/kg sulfasalazine with TNBS, respectively. Relative expression levels were analyzed by qPCR. Data are presented as meanvalues ± SD. Differences ^p < 0.05 vs. the control group; ^^p < 0.01 vs. the control group; ∗p < 0.05 vs. the TNBS group; ∗∗p < 0.01 vs. the TNBS group; ∗∗∗p < 0.001 vs. the TNBS group; and #p < 0.05 vs. the sulfasalazine group were deemed statistically significant. Table 1 Identification and the content (mg/100 g dry mass) of the main compounds of extract (CE) and loganic acid (LA) fraction from cornelian cherry fruits by LC-MS and HPLC. Compound [M − H]−/[M + H]+ (other ions) (m/z) Content (mg/100 g dry mass) Extract (CE) Loganic acid (LA) fraction Iridoids  Loganic acid 375 (213) 10870.20 ± 15.86 69036.49 ± 1056.58  Cornuside 1 541 (169) 1549.28 ± 3.43 nd  Total iridoids 12419.48 69036.49 Phenolic acids  Caffeoylhexoside 341 (179) 120.28 ± 3.00 nd  p-Coumaroilquinic acid 1 337 (163) 33.91 ± 1.40 nd  Caffeoylquinic acid 353 (191) 471.45 ± 1.42 127.77 ± 0.00  p-Coumaric acid 163 12.40 ± 0.21 nd  p-Coumaroilquinic acid 2 337 (191/163) 279.91 ± 3.50 261.85 ± 0.00  p-Coumaroilquinic acid 3 337 (191/163) 20.91 ± 1.88 nd  Ellagic acid 301 124.21 ± 1.64 nd  Total phenolic acids 1063.07 389.62 Anthocyanins  Delphinidin 3-O-galactoside 463+ (303+) 44.06 ± 1.77 nd  Cyanidin 3-O-galactoside 449+ (287+) 809.70 ± 0.55 nd  Cyanidin 3-O-robinobioside 595+ (287+) 369.94 ± 1.41 nd  Pelargonidin 3-O-galactoside 433+ (271+) 1542.22 ± 0.84 nd  Pelargonidin 3-O-robinobioside 579+ (271+) 297.18 ± 0.44 nd  Cyanidin 287+ 222.98 ± 31.61 nd  Pelargonidin 271+ 396.55 ± 67.49 nd  Total anthocyanins 3682.63 Flavonols  Quercetin 3-O-glucuronide 477 (301) 306.28 ± 22.62 nd  Quercetin 3-O-glucoside 463 (301) 31.64 ± 1.58 nd  Kaempferol 3-O-galactoside 447 (285) 215.45 ± 2.61 nd  Kaempferol 3-O-glucuronide 461 (285) 35.94 ± 1.38 nd  Total flavonols 589.30 Values are means ± SD. nd: not detected. Table 2 Primers' sequences. Symbol Gene name Accession no. Primer sequence 5′ ⟶ 3′ Amp. size (bp) Gapdh Glyceraldehyde-3-phosphate dehydrogenase NM_017008.4 F: tgactctacccacggcaagttcaa 141 R: acgacatactcagcaccagcatca Tff3 Trefoil factor 3 NM_013042.2 F: taaccctgctgctggtcctg 195 R: gtttgaagcaccagggcaca Stat3 Signal transducer and activator of transcription 3 NM_012747.2 F: cgccttggattgagagccaagat 112 R: aggaatcggctatactgctggt Muc2 Mucin 2 XM_017604244.1 F: accaccattaccaccacctcag 119 R: cgatcaccaccattgccattg Primer sequences were retrieved from the literature and validated in silico by BLAST analysis. Forward and reverse primer sequences are denoted by “F” and “R,” respectively. Amp.: amplicon; bp: base pairs. Table 3 The impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on the body weight loss and colon index in experimental groups. Control = control group; TNBS = group receiving only TNBS; CE20, CE100 = groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively; LA10, LA50 = groups receiving 10 or 50 mg/kg loganic acid with TNBS, respectively; SA = group receiving 100 mg/kg sulfasalazine with TNBS; CE20+SA, CE100+SA = groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively; and LA10+SA, LA50+SA = groups receiving 10 or 50 mg/kg loganic acid and 100 mg/kg sulfasalazine with TNBS, respectively. Data are presented as meanvalues ± SD. Differences ^p < 0.05 vs. the control group; ∗∗∗p < 0.001 vs. the TNBS group; and ##p < 0.01 vs. the sulfasalazine group were deemed statistically significant. Group Body weight loss (g) Colon index Control 14.71 ± 5.16 0.005 ± 0.001 TNBS −5.13 ± 4.88^ 0.009 ± 0.003 CE20 6.13 ± 13.24 0.007 ± 0.003 CE100 22.43 ± 6.60∗∗∗## 0.006 ± 0.002 LA10 3.86 ± 6.08 0.007 ± 0.002 LA50 7.25 ± 5.26 0.008 ± 0.002 SA −1.13 ± 20.04 0.006 ± 0.003 CE20+SA 3.75 ± 12.96 0.007 ± 0.001 CE100+SA 3.86 ± 8.67 0.006 ± 0.001 LA10+SA 1.63 ± 9.02 0.008 ± 0.001 LA50+SA 6.75 ± 5.37 0.007 ± 0.002 Table 4 The impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on macroscopic damage of colon tissues and microscopic damage of colon tissues in HE and Giemsa staining in experimental groups. Control = control group; TNBS = group receiving only TNBS; CE20, CE100 = groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively; LA10, LA50 = groups receiving 10 or 50 mg/kg loganic acid with TNBS, respectively; SA = group receiving 100 mg/kg sulfasalazine with TNBS; CE20+SA, CE100+SA = groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively; and LA10+SA, LA50+SA = groups receiving 10 or 50 mg/kg loganic acid and 100 mg/kg sulfasalazine with TNBS, respectively. Scoring scale of macroscopic evaluation of colonic tissue damage: 0 = no damage; 1 = hyperemia, no ulcers; 2 = linear ulcer with no significant inflammation; 3 = linear ulcer with inflammation at one site; 4 = two or more sites of ulceration or inflammation and ulceration or inflammation extending <1 cm; and 5 = two or more major sites of ulceration or inflammation extending >1 cm along the length of the colon. Microscopic evaluation of colonic tissue damage in HE staining: in the mucosal epithelium and lamina propria: ulceration (0–4), mononuclear cell infiltration (0–3), and polymorphonuclear cell infiltration (0–3); in the submucosa: edema (0–3), mononuclear cell infiltration (0–3), and polymorphonuclear cell infiltration (0–3); and in the muscular layer: mononuclear cell infiltration (0–3) and polymorphonuclear cell infiltration (0–3). Scoring scale: 0 = none; 1 = mild; 2 = moderate; 3 = severe; and 4 = full-thickness; maximum score: 25. Microscopic evaluation of colonic tissue damage in Giemsa staining: 0 = no changes; 1 = few inflammatory cells in the lamina propria; 2 = increased number of inflammatory cells including neutrophils in the lamina propria; 3 = accumulation of inflammatory cells reaching the submucosa; and 4 = transmural infiltration of inflammatory cells. Data are presented as meanvalues ± SD. Differences ^^p < 0.01 vs. the control group; ^^^p < 0.001 vs. the control group; ∗p < 0.05 vs. the TNBS group; and ∗∗p < 0.01 vs. the TNBS group were deemed statistically significant. Group Macroscopic damage score (0-5 points) Microscopic damage score, HE staining (0-25 points) Microscopic damage score, Giemsa staining (0-4 points) Control 0 0 0 TNBS 3.38 ± 1.22^^^ 12.88 ± 5.28^^^ 2.50 ± 0.75^^ CE20 2.06 ± 1.12 6.13 ± 3.36 1.75 ± 1.55 CE100 1.29 ± 0.70∗∗ 4.71 ± 2.49∗ 0.64 ± 1.41 LA10 2.38 ± 0.79 8.13 ± 7.57 2.13 ± 1.28 LA50 2.13 ± 1.03 6.25 ± 6.54 1.50 ± 0.89 SA 1.63 ± 1.22∗ 5.00 ± 3.55∗ 1.25 ± 1.11 CE20+SA 2.31 ± 0.92 7.50 ± 3.51 1.75 ± 0.92 CE100+SA 1.43 ± 0.67∗∗ 2.57 ± 2.07∗∗ 1.29 ± 1.28 LA10+SA 2.06 ± 0.56 7.00 ± 6.41 1.38 ± 0.89 LA50+SA 2.13 ± 0.92 6.63 ± 4.60 1.25 ± 0.97 Table 5 The impact of cornelian cherry iridoid-polyphenolic extract and loganic acid on IL-23, IL-17, TNF-α, and chemerin concentrations in colon tissues in experimental groups. Control = control group; TNBS = group receiving only TNBS; CE20, CE100 = groups receiving 20 or 100 mg/kg cornelian cherry extract with TNBS, respectively; LA10, LA50 = groups receiving 10 or 50 mg/kg loganic acid with TNBS, respectively; SA = group receiving 100 mg/kg sulfasalazine with TNBS; CE20+SA, CE100+SA = groups receiving 20 or 100 mg/kg cornelian cherry extract and 100 mg/kg sulfasalazine with TNBS, respectively; and LA10+SA, LA50+SA = groups receiving 10 or 50 mg/kg loganic acid and 100 mg/kg sulfasalazine with TNBS, respectively. Data are presented as meanvalues ± SD. Differences ^^p < 0.01 vs. the control group; ^^^p < 0.001 vs. the control group; ∗p < 0.05 vs. the TNBS group; ∗∗p < 0.01 vs. the TNBS group; ∗∗∗p < 0.001 vs. the TNBS group; #p < 0.05 vs. the sulfasalazine group; and ##p < 0.01 vs. the sulfasalazine group were deemed statistically significant. Group IL-23 (pg/ml) IL-17 (pg/ml) TNF-α (pg/ml) Chemerin (pg/ml) Control 325.3 ± 110.6 55.61 ± 25.66 155.2 ± 84.07 440.1 ± 177.9 TNBS 591.5 ± 149.5^^ 97.88 ± 6.28^^ 304.3 ± 64.21^^^ 687.6 ± 108.7^^ CE20 405.4 ± 214.4 61.63 ± 14.22∗ 200.7 ± 75.64 588.8 ± 177.3 CE100 301.3 ± 115.8∗∗∗## 58.07 ± 34.14∗∗ 167.2 ± 21.28∗∗ 455.5 ± 136.0∗# LA10 541.6 ± 116.7 73.30 ± 16.30 212.4 ± 53.69 628.7 ± 123.3 LA50 492.9 ± 104.7 83.28 ± 16.26 197.6 ± 84.94 539.1 ± 106.5 SA 548.7 ± 131.9 74.00 ± 25.55 201.0 ± 67.18∗ 665.9 ± 119.4 CE20+SA 408.5 ± 80.75 60.82 ± 16.48∗∗ 99.67 ± 20.99∗∗∗ 582.7 ± 46.95 CE100+SA 354.8 ± 57.49∗ 40.33 ± 9.93∗∗∗# 83.62 ± 19.00∗∗∗# 458.3 ± 74.65∗# LA10+SA 420.4 ± 107.9 73.39 ± 9.49 208.6 ± 77.08 664.6 ± 93.43 LA50+SA 391.6 ± 88.95 76.01 ± 11.61 162.8 ± 58.45∗∗ 575.6 ± 48.8 ==== Refs 1 Zuo T. Ng S. C. The gut microbiota in the pathogenesis and therapeutics of inflammatory bowel disease Frontiers in Microbiology 2018 9 p. 2247 10.3389/fmicb.2018.02247 2-s2.0-85055312289 2 Jones-Hall Y. L. Nakatsu C. H. The intersection of TNF, IBD and the microbiome Gut Microbes 2016 7 1 58 62 10.1080/19490976.2015.1121364 2-s2.0-84960463907 26939853 3 Vasovic M. Gajovic N. Brajkovic D. Jovanovic M. Zdravkovaic N. Kanjevac T. The relationship between the immune system and oral manifestations of inflammatory bowel disease: a review Central European Journal of Immunology 2016 3 3 302 310 10.5114/ceji.2016.63131 2-s2.0-84992616456 27833449 4 Raza A. Yousaf W. Giannella R. Shata M. T. Th17 cells: interactions with predisposing factors in the immunopathogenesis of inflammatory bowel disease Expert Review of Clinical Immunology 2014 8 2 161 168 10.1586/eci.11.96 2-s2.0-84856603151 5 Kim Y. S. Ho S. B. Intestinal goblet cells and mucins in health and disease: recent insights and progress Current Gastroenterology Reports 2010 12 5 319 330 10.1007/s11894-010-0131-2 2-s2.0-77958170401 20703838 6 Darfeuille-Michaud A. Adherent-invasive Escherichia coli : a putative new E. coli pathotype associated with Crohn’s disease International Journal of Medical Microbiology 2002 292 3–4 185 193 10.1078/1438-4221-00201 2-s2.0-0036744155 12398209 7 Glasser A. L. Boudeau J. Barnich N. Perruchot M. H. Colombel J. F. Darfeuille-Michaud A. Adherent invasive Escherichia coli strains from patients with Crohn’s disease survive and replicate within macrophages without inducing host cell death Infection and Immunity 2001 69 9 5529 5537 10.1128/IAI.69.9.5529-5537.2001 2-s2.0-0034873344 11500426 8 Magro D. O. Santos A. Guadagnini D. Remission in Crohn’s disease is accompanied by alterations in the gut microbiota and mucins production Scientific Reports 2019 9 1 p. 13263 10.1038/s41598-019-49893-5 2-s2.0-85072210372 31520001 9 Harbord M. Eliakim R. Bettenworth D. Third European evidence-based consensus on diagnosis and management of ulcerative colitis. Part 2: current management Journal of Crohn's and Colitis 2017 11 7 769 784 10.1093/ecco-jcc/jjx009 2-s2.0-85021171913 28513805 10 Gomollón F. Dignass A. Annese V. 3rd European evidence-based consensus on the diagnosis and management of Crohn’s disease 2016: part 1: diagnosis and medical management Journal of Crohn's and Colitis 2016 11 1 3 25 10.1093/ecco-jcc/jjw168 2-s2.0-85016186433 27660341 11 Chelakkot C. Ghim J. Ryu S. H. Mechanisms regulating intestinal barrier integrity and its pathological implications Experimental & Molecular Medicine 2018 50 8 p. 103 10.1038/s12276-018-0126-x 2-s2.0-85060008820 30115904 12 Dorta D. A. Sivignon A. Chalopin T. The antiadhesive strategy in Crohn’s disease: orally active mannosides to decolonize pathogenicescherichia colifrom the gut Chem Bio Chem 2016 17 10 936 952 10.1002/cbic.201600018 2-s2.0-84962905539 26946458 13 Sozański T. Kucharska A. Z. Rapak A. Iridoid–loganic acid versus anthocyanins from the Cornus mas fruits (cornelian cherry): common and different effects on diet-induced atherosclerosis, PPARs expression and inflammation Atherosclerosis 2016 254 151 160 10.1016/j.atherosclerosis.2016.10.001 2-s2.0-84991627556 27744131 14 De Biaggi M. Donno D. Cornus mas (L.) fruit as a potential source of natural health-promoting compounds: physico-chemical characterisation of bioactive components Plant Foods for Human Nutrition 2018 73 2 89 94 10.1007/s11130-018-0663-4 2-s2.0-85045690049 29671173 15 Danielewski M. Matuszewska A. Nowak B. Kucharska A. Z. Sozański T. The effects of natural iridoids and anthocyanins on selected parameters of liver and cardiovascular system functions Oxidative Medicine and Cellular Longevity 2020 2020 12 2735790 10.1155/2020/2735790 32318236 16 Kucharska A. Z. Szumny A. Sokól-Letowska A. Piórecki N. Klymenko S. V. Iridoids and anthocyanins in cornelian cherry (Cornus mas L.) cultivars Journal of Food Composition and Analysis 2015 40 95 102 10.1016/j.jfca.2014.12.016 2-s2.0-84923260917 17 Sozański T. Kucharska A. Z. Wiśniewski J. The iridoid loganic acid and anthocyanins from the cornelian cherry (Cornus mas L.) fruit increase the plasma L-arginine/ADMA ratio and decrease levels of ADMA in rabbits fed a high-cholesterol diet Phytomedicine 2019 52 1 11 10.1016/j.phymed.2018.09.175 2-s2.0-85055714295 30599888 18 Kucharska A. Z. Sokól-Lȩtowska A. Oszmiánski J. Piórecki N. Fecka I. Iridoids, phenolic compounds and antioxidant activity of edible honeysuckle berries (Lonicera caerulea var. kamtschatica Sevast.) Molecules 2017 22 3 p. 405 10.3390/molecules22030405 2-s2.0-85015737795 28273885 19 Darfeuille-Michaud A. Boudeau J. Bulois P. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn’s disease Gastroenterology 2004 127 2 412 421 10.1053/j.gastro.2004.04.061 2-s2.0-4143069158 15300573 20 National Committee for Clinical Laboratory Standards Methods for Antimicrobial Susceptibility Testing of Anaerobic Bacteria 2001 5th Wayne, Pennsylvania, USA Approved standard M11-A5 21 Cravioto A. Tello A. Navarro A. Association of Escherichia coli HEp-2 adherence patterns with type and duration of diarrhoea Lancet 1991 337 8736 262 264 10.1016/0140-6736(91)90868-P 2-s2.0-0025969305 1671111 22 Boll E. J. Struve C. Sander A. Demma Z. Krogfelt K. A. McCormick B. A. Enteroaggregative Escherichia coli promotes transepithelial migration of neutrophils through a conserved 12-lipoxygenase pathway Cellular Microbiology 2012 14 1 120 132 10.1111/j.1462-5822.2011.01706.x 2-s2.0-83855165708 21951973 23 Korhonen T. K. Yeast cell agglutination by purified enterobacterial pili FEMS Microbiology Letters 1979 6 6 421 425 10.1111/j.1574-6968.1979.tb03756.x 2-s2.0-0018564963 24 Morris G. P. Beck P. L. Herridge M. S. Depew W. T. Szewczuk M. R. Wallace J. L. Hapten-induced model of chronic inflammation and ulceration in the rat colon Gastroenterology 1989 96 3 795 803 10.1016/0016-5085(89)90904-9 2-s2.0-85034894992 2914642 25 Gálvez J. Coelho G. Crespo M. E. Intestinal anti-inflammatory activity of morin on chronic experimental colitis in the rat Alimentary Pharmacology & Therapeutics 2001 15 12 2027 2039 10.1046/j.1365-2036.2001.01133.x 2-s2.0-0035659426 11736735 26 Arribas B. Suárez-Pereira E. Mellet C. O. Di-D-fructose dianhydride-enriched caramels: effect on colon microbiota, inflammation, and tissue damage in trinitrobenzenesulfonic acid-induced colitic rats Journal of Agricultural and Food Chemistry 2010 58 10 6476 6484 10.1021/jf100513j 2-s2.0-77952648616 20423151 27 Kiesler P. Fuss I. J. Strober W. Experimental models of inflammatory bowel diseases Cellular and Molecular Gastroenterology and Hepatology 2015 1 2 154 170 10.1016/j.jcmgh.2015.01.006 2-s2.0-84928963727 26000334 28 Liévin-Le M. V. Servin A. L. The front line of enteric host defense against unwelcome intrusion of harmful microorganisms: mucins, antimicrobial peptides, and microbiota Clinical Microbiology Reviews 2006 19 2 315 337 10.1128/CMR.19.2.315-337.2006 2-s2.0-33646265743 16614252 29 Gibold L. Garenaux E. Dalmasso G. The Vat-AIEC protease promotes crossing of the intestinal mucus layer by Crohn’s disease-associated Escherichia coli Cellular Microbiology 2016 18 5 617 631 10.1111/cmi.12539 2-s2.0-84947968846 26499863 30 Barnich N. Carvalho F. A. Glasser A. L. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease The Journal of Clinical Investigation 2007 117 6 1566 1574 10.1172/JCI30504 2-s2.0-34249886868 17525800 31 Agus A. Massier S. Darfeuille-Michaud A. Billard E. Barnich N. Understanding host-adherent-invasive Escherichia coli interaction in Crohn’s disease: opening up new therapeutic strategies BioMed Research International 2014 2014 16 567929 10.1155/2014/567929 2-s2.0-84936877731 25580435 32 Desilets M. Deng X. Rao C. Genome-based definition of an inflammatory bowel disease-associated adherent-invasive Escherichia coli pathovar Inflammatory Bowel Diseases 2016 22 1 1 12 10.1097/MIB.0000000000000574 2-s2.0-84964692112 26444104 33 Milenković-Andjelković A. S. Andjelković M. Z. Radovanović A. N. Radovanović B. C. Nikolić V. Phenol composition, DPPH radical scavenging and antimicrobial activity of cornelian cherry (Cornus mas ) fruit and leaf extracts Chemical Industry 2015 69 4 331 337 10.2298/HEMIND140216046M 2-s2.0-84941337103 34 Nile S. H. Park S. W. Edible berries: bioactive components and their effect on human health Nutrition 2014 30 2 134 144 10.1016/j.nut.2013.04.007 2-s2.0-84891164536 24012283 35 Nohynek L. J. Alakomi H. L. Kähkönen M. P. Berry phenolics: antimicrobial properties and mechanisms of action against severe human pathogens Nutrition and Cancer 2006 54 1 18 32 10.1207/s15327914nc5401_4 2-s2.0-33746571435 16800770 36 Puupponen-Pimiä R. Nohynek L. Alakomi H.-L. Oksman-Caldentey K.-M. The action of berry phenolics against human intestinal pathogens BioFactors 2005 23 4 243 251 10.1002/biof.5520230410 2-s2.0-33144482023 16498212 37 Dumych T. Yamakawa N. Sivignon A. Oligomannose-rich membranes of dying intestinal epithelial cells promote host colonization by adherent-invasive E . coli Frontiers in Microbiology 2018 9 10.3389/fmicb.2018.00742 2-s2.0-85045724186 38 Boudeau J. Barnich N. Darfeuille-Michaud A. Type 1 pili-mediated adherence of Escherichia coli strain LF82 isolated from Crohn’s disease is involved in bacterial invasion of intestinal epithelial cells Molecular Microbiology 2001 39 5 1272 1284 10.1111/j.1365-2958.2001.02315.x 11251843 39 Mydock-McGrane L. K. Hannan T. J. Janetka J. W. Rational design strategies for FimH antagonists: new drugs on the horizon for urinary tract infection and Crohn’s disease Expert Opinion on Drug Discovery 2017 12 7 711 731 10.1080/17460441.2017.1331216 2-s2.0-85020702920 28506090 40 Van der Sluis M. De Koning B. A. E. De Bruijn A. C. J. M. Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection Gastroenterology 2006 131 1 117 129 10.1053/j.gastro.2006.04.020 2-s2.0-33745746660 16831596 41 Aamann L. Vestergaard E. M. Grønbæk H. Trefoil factors in inflammatory bowel disease World Journal of Gastroenterology 2014 20 12 3223 3230 10.3748/wjg.v20.i12.3223 2-s2.0-84896942421 24696606 42 Algieri F. Zorrilla P. Rodriguez-Nogales A. Intestinal anti-inflammatory activity of hydroalcoholic extracts of Phlomis purpurea L. and Phlomis lychnitis L. in the trinitrobenzenesulphonic acid model of rat colitis Journal of Ethnopharmacology 2013 146 3 750 759 10.1016/j.jep.2013.01.041 2-s2.0-84875482287 23395625 43 de Assis P. O. A. Guerra G. C. B. Araújo D. F. S. Intestinal anti-inflammatory activity of xique–xique (Pilosocereus gounellei A. Weber ex K. Schum. Bly. Ex Rowl) juice on acetic acid-induced colitis in rats Food & Function 2019 10 11 7275 7290 10.1039/C9FO00920E 31621721 44 Guri A. Li Y. Corredig M. Interfacial dilational properties of tea polyphenols and milk proteins with gut epithelia and the role of mucus in nutrient adsorption Food & Function 2015 6 12 3642 3651 10.1039/c5fo00654f 2-s2.0-84948822888 26328543 45 Georgiades P. Pudney P. D. A. Rogers S. Thornton D. J. Waigh T. A. Tea derived galloylated polyphenols cross-link purified gastrointestinal mucins PLoS One 2014 9 8, article e105302 10.1371/journal.pone.0105302 2-s2.0-84921001338 25162539 46 Kindon H. Pothoulakis C. Thim L. Lynch-Devaney K. Podolsky D. K. Trefoil peptide protection of intestinal epithelial barrier function: cooperative interaction with mucin glycoprotein Gastroenterology 1995 109 2 516 523 10.1016/0016-5085(95)90340-2 2-s2.0-0029133784 7615201 47 Rosillo M. A. Sanchez-Hidalgo M. Cárdeno A. Alarcón De La Lastra C. Protective effect of ellagic acid, a natural polyphenolic compound, in a murine model of Crohn’s disease Biochemical Pharmacology 2011 82 7 737 745 10.1016/j.bcp.2011.06.043 2-s2.0-80051789298 21763290 48 Zhang C. Shu W. Zhou G. Anti-TNF-α therapy suppresses proinflammatory activities of mucosal neutrophils in inflammatory bowel disease Mediators of Inflammation 2018 2018 12 10.1155/2018/3021863 2-s2.0-85059250970 30595666 49 Gaffen S. L. Jain R. Garg A. V. Cua D. J. The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing Nature Reviews. Immunology 2014 14 9 585 600 10.1038/nri3707 2-s2.0-84906535154 25145755 50 Lee J. S. Tato C. M. Joyce-Shaikh B. Interleukin-23-independent IL-17 production regulates intestinal epithelial permeability Immunity 2015 43 4 727 738 10.1016/j.immuni.2015.09.003 2-s2.0-84944675546 26431948 51 McGeachy M. J. Chen Y. Tato C. M. The interleukin 23 receptor is essential for the terminal differentiation of interleukin 17-producing effector T helper cells in vivo Nature Immunology 2009 10 3 314 324 10.1038/ni.1698 2-s2.0-60749107176 19182808 52 Hirahara K. Ghoreschi K. Laurence A. Yang X. P. Kanno Y. O’Shea J. J. Signal transduction pathways and transcriptional regulation in Th17 cell differentiation Cytokine & Growth Factor Reviews 2010 21 6 425 434 10.1016/j.cytogfr.2010.10.006 2-s2.0-78649689761 21084214 53 Lin Y. Yang X. Yue W. Chemerin aggravates DSS-induced colitis by suppressing M2 macrophage polarization Cellular & Molecular Immunology 2014 11 4 355 366 10.1038/cmi.2014.15 2-s2.0-84905051685 24727542 54 Weigert J. Obermeier F. Neumeier M. Circulating levels of chemerin and adiponectin are higher in ulcerative colitis and chemerin is elevated in Crohn’s disease Inflammatory Bowel Diseases 2010 16 4 630 637 10.1002/ibd.21091 2-s2.0-77949525523 19714754 55 Schreiner P. Neurath M. F. Ng S. C. Mechanism-based treatment strategies for IBD: cytokines, cell adhesion molecules, JAK inhibitors, gut flora, and more Inflammatory Intestinal Diseases 2019 4 3 79 96 10.1159/000500721 31559260 56 da Silva V. de Araújo A. Araújo D. Intestinal anti-inflammatory activity of the aqueous extract from Ipomoea asarifolia in DNBS-induced colitis in rats International Journal of Molecular Sciences 2018 19 12 p. 4016 10.3390/ijms19124016 2-s2.0-85058755188 30545135 57 Süntar I. Cevik C. K. Çeribaşı A. O. Healing effects of Cornus mas L. in experimentally induced ulcerative colitis in rats: from ethnobotany to pharmacology Journal of Ethnopharmacology 2020 248, article 112322 10.1016/j.jep.2019.112322 58 Liu L. Liu Z. Zhang T. Shi L. Zhang W. Zhang Y. Combined therapy with Rheum tanguticum polysaccharide and low-dose 5-ASA ameliorates TNBS-induced colitis in rats by suppression of NF-κ B Planta Medica 2015 81 9 705 712 10.1055/s-0035-1545945 2-s2.0-84934439672 26069953 59 Farzaei M. Rahimi R. Abdollahi M. The role of dietary polyphenols in the management of inflammatory bowel disease Current Pharmaceutical Biotechnology 2015 16 3 196 210 10.2174/1389201016666150118131704 2-s2.0-84930787408 25601607 60 Abiodun O. O. Rodríguez-Nogales A. Algieri F. Antiinflammatory and immunomodulatory activity of an ethanolic extract from the stem bark of Terminalia catappa L. (Combretaceae ): in vitro and in vivo evidences Journal of Ethnopharmacology 2016 192 309 319 10.1016/j.jep.2016.07.056 2-s2.0-84980432356 27452660 61 Saadatdoust Z. Pandurangan A. K. Ananda Sadagopan S. K. Mohd Esa N. Ismail A. Mustafa M. R. Dietary cocoa inhibits colitis associated cancer: a crucial involvement of the IL-6/STAT3 pathway The Journal of Nutritional Biochemistry 2015 26 12 1547 1558 10.1016/j.jnutbio.2015.07.024 2-s2.0-84983108500 26355019 62 Skyberg J. A. Robison A. Golden S. Apple polyphenols require T cells to ameliorate dextran sulfate sodium-induced colitis and dampen proinflammatory cytokine expression Journal of Leukocyte Biology 2011 90 6 1043 1054 10.1189/jlb.0311168 2-s2.0-82555161667 21693591 63 Vezza T. Algieri F. Rodríguez-Nogales A. Immunomodulatory properties ofOlea europaealeaf extract in intestinal inflammation Molecular Nutrition & Food Research 2017 61 10 10.1002/mnfr.201601066 2-s2.0-85030464420 64 Bibi S. De Sousa Moraes L. F. Lebow N. Zhu M. J. Dietary green pea protects against DSS-induced colitis in mice challenged with high-fat diet Nutrients 2017 9 5 p. 509 10.3390/nu9050509 2-s2.0-85019554583 28524086 65 Szandruk M. Merwid-Ląd A. Szeląg A. The impact of mangiferin from Belamcanda chinensis on experimental colitis in rats Inflammopharmacology 2018 26 2 571 581 10.1007/s10787-017-0337-0 2-s2.0-85015821971 28337639 66 Alrafas H. R. Busbee P. B. Nagarkatti M. Nagarkatti P. S. Resveratrol modulates the gut microbiota to prevent murine colitis development through induction of Tregs and suppression of Th17 cells Journal of Leukocyte Biology 2019 106 2 467 480 10.1002/JLB.3A1218-476RR 2-s2.0-85063281010 30897248 67 Biagioli M. Carino A. Fiorucci C. The aryl hydrocarbon receptor (AhR) mediates the counter-regulatory effects of pelargonidins in models of inflammation and metabolic dysfunctions Nutrients 2019 11 8 p. 1820 10.3390/nu11081820 2-s2.0-85071146487 31394746 68 Danese S. Bonovas S. Peyrin-Biroulet L. Positioning ustekinumab in Crohn’s disease: from clinical evidence to clinical practice J Crohn’s Colitis 2017 11 10 1258 1266 10.1093/ecco-jcc/jjx079 2-s2.0-85030784430 28575273 69 Hueber W. Sands B. E. Lewitzky S. Secukinumab, a human anti-IL-17A monoclonal antibody, for moderate to severe Crohn’s disease: unexpected results of a randomised, double-blind placebo-controlled trial Gut 2012 61 12 1693 1700 10.1136/gutjnl-2011-301668 2-s2.0-84868680312 22595313 70 Liu X. Wang J. Anti-inflammatory effects of iridoid glycosides fraction of Folium syringae leaves on TNBS-induced colitis in rats Journal of Ethnopharmacology 2011 133 2 780 787 10.1016/j.jep.2010.11.010 2-s2.0-78651380339 21070844 71 Choi Y. H. Jin G. Y. Li G. Z. Yan G. H. Cornuside suppresses lipopolysaccharide-induced inflammatory mediators by inhibiting nuclear factor-kappa B activation in RAW 264.7 macrophages Biological & Pharmaceutical Bulletin 2011 34 7 959 966 10.1248/bpb.34.959 2-s2.0-79960315345 21719998 72 Kang D. G. Moon M. K. Lee A. S. Kwon T. O. Kim J. S. Lee H. S. Cornuside suppresses cytokine-induced proinflammatory and adhesion molecules in the human umbilical vein endothelial cells Biological & Pharmaceutical Bulletin 2007 30 9 1796 1799 10.1248/bpb.30.1796 2-s2.0-34548602676 17827743 73 Wei S. Chi H. Kodama H. Chen G. Anti-inflammatory effect of three iridoids in human neutrophils Natural Product Research 2013 27 10 911 915 10.1080/14786419.2012.668687 2-s2.0-84879200566 22417122 74 Yamabe N. Noh J. S. Park C. H. Evaluation of loganin, iridoid glycoside from Corni Fructus , on hepatic and renal glucolipotoxicity and inflammation in type 2 diabetic db/db mice European Journal of Pharmacology 2010 648 1–3 179 187 10.1016/j.ejphar.2010.08.044 2-s2.0-77957749279 20826139 75 Park C. H. Noh J. S. Kim J. H. Evaluation of morroniside, iridoid glycoside from corni fructus, on diabetes-induced alterations such as oxidative stress, inflammation, and apoptosis in the liver of type 2 diabetic db/db mice Biological & Pharmaceutical Bulletin 2011 34 10 1559 1565 10.1248/bpb.34.1559 2-s2.0-80053548035 21963495 76 Jiang W. L. Chen X. G. Zhu H. B. Tian J. W. Effect of cornuside on experimental sepsis Planta Medica 2009 75 6 614 619 10.1055/s-0029-1185383 2-s2.0-68949085793 19263342 77 Chen X. Cao G. Jiang J. Comparison of pharmacokinetic behavior of two iridoid glycosides in rat plasma after oral administration of crude Cornus officinals and its jiuzhipin by high performance liquid chromatography triple quadrupole mass spectrometry combined with multiple reactions monitoring mode Pharmacognosy Magazine 2014 10 37 115 121 10.4103/0973-1296.127358 2-s2.0-84924624008 78 Cardona F. Andrés-Lacueva C. Tulipani S. Tinahones F. J. Queipo-Ortuño M. I. Benefits of polyphenols on gut microbiota and implications in human health The Journal of Nutritional Biochemistry 2013 24 8 1415 1422 10.1016/j.jnutbio.2013.05.001 2-s2.0-84892399073 23849454