==== Front Med Sci MonitMed. Sci. MonitMedical Science MonitorMedical Science Monitor : International Medical Journal of Experimental and Clinical Research1234-10101643-3750International Scientific Literature, Inc. 3006669810.12659/MSM.909811909811Clinical ResearchCollagen Type VI Alpha 3 Chain Promotes Epithelial-Mesenchymal Transition in Bladder Cancer Cells via Transforming Growth Factor β (TGF-β)/Smad Pathway Huang Yan ALi Gang BWang Kai CMu Zhongyi DXie Qingpeng CQu Hongchen DLv Hang EHu Bin FDepartment of Urology, Cancer Hospital of China Medical University, Liaoning Cancer Hospital and Institute, Shenyang, Liaoning, P.R. ChinaCorresponding Author: Bin Hu, e-mail: binhu_bhhb0042@163.comA Study Design B Data Collection C Statistical Analysis D Data Interpretation E Manuscript Preparation F Literature Search G Funds Collection 2018 01 8 2018 24 5346 5354 06 3 2018 30 3 2018 © Med Sci Monit, 20182018This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Background Collagen type VI alpha 3 chain (COL6A3) has been proven to be a biomarker in the occurrence and development of bladder cancer, which is the most common malignant tumor in the urinary system. This study aimed to explore the effect and molecular mechanism of COL6A3 on EMT in vitro induced by TGF-β/Smad in bladder carcinoma. Material/Methods There were 42 patients included in the Kaplan-Meier survival analysis. A cell counting kit-8 (CCK-8) assay and an angiogenesis assay were used to measure cell proliferation and tube formation, respectively. Western blot analysis and quantitative reverse transcription-polymerase chain reaction (qPCR) were conducted for the proteins and mRNAs expression. Results COL6A3 was highly expressed in tissues and cells of bladder cancer. COL6A3 silencing could inhibit the cell proliferation and angiopoiesis. In addition, COL6A3 silencing obviously suppressed the levels of matrix metalloproteinase-2 (MMP2), Matrix metalloproteinase-9 (MMP9), and vimentin. On the contrary, the levels of epithelium-specific cell-cell adhesion molecule (E-cadherin) and tumor inhibitor of metalloproteinase-1 (TIMP-1) were significantly increased. Furthermore, we found that COL6A3 silencing reduced the activity of p-Smad2, p-Smad3, and transforming growth factor β (TGF-β). Conclusions COL6A3 could influence the viability and angiogenesis of bladder cancer cells. COL6A3 may have a certain relationship with the TGF-β/Smad-induced EMT process. MeSH Keywords Collagen Type VIEpithelial-Mesenchymal TransitionGallbladder NeoplasmsTransforming Growth Factor beta ==== Body Background Bladder cancer is the one of the most common tumors in the urinary system, and even in the whole body. For urogenital tumors, its incidence ranks first in China [1]. Muscle invasive bladder cancer which is treated through radical cystectomy and adjuvant chemotherapy, still cannot meet the demand of the quality of life and prognosis. The 5-year survival rate is only 45–66% [2]. Therefore, it is very necessary to define the specific target genes and discuss the molecular mechanism of bladder cancer. It has been found that epithelial-mesenchymal transition (EMT) is regarded as the key initiation step in tumor progression, metastasis, and multidrug resistance [3,4]. In the EMT process, epithelial cells lose their epithelial properties (E-cadherin) while obtain mesenchymal character (such as N-cadherin and vimentin). E-cadherin maintains normal intercellular connections and maintains epithelial cell polarity by participating in the regulation of calcium dependent cell adhesion. The reduction or deletion of E-cadherin expression is a landmark characteristic of the epithelial transformation of the tumor cells [5]. Matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) are reported to play a vital role in the development of tumor [6,7]. Moreover, MMP2 and MMP9 are overexpressed in transitional cell carcinoma of the bladder [8], and MMP9 may improve the invasion of tumor cells by induction of EMT [9]. Recently, massive studies have proved that the EMT process was induced by TGF-β via multiple pathways [10–14]. TGF-β is an interesting cytokine. It has been reported to be associated with the phenotypic regulation of cancer and the change of tumor microenvironment [15]. Smad proteins can be phosphorylated and activated by TGF-β signals, and then are translocated into the nucleus to induce the transcriptional activation of downstream genes [16–18]. Aberrant TGF-β/Samd signaling may lead to tumor metastasis, EMT, and DNA damage response [19–21]. In bladder cancer, highly phosphorylated Smad2 (intermediate molecule in TGF-β signaling) is highly correlated with the recurrence of highly invasive bladder cancer and leads to a sharp decline in survival [22]. TGF-β signaling pathway is involved in all aspects of psychological and physiological processes, including the progression of bladder cancer [23,24]. Moreover, the level of TGF-β1 secretion is shown to be associated with the active phenotype of bladder cancer cell lines [25]. COL6A3, which is involved in tumor grade, participates in cell anchoring and remodeling of the extracellular matrix (ECM). Stromal COL6A3 is reported to be involved in Hippo and Wnt signaling pathway to affect the tumor growth [26]. In addition, COL6A3 is found to be significantly upregulated in pancreatic ductal adenocarcinoma (PDA) [27,28]. In total, these results indicated that COL6A3 might have a specific function in human cancer. However, its function and regulation mechanism in bladder cancer has not been investigated. The current study aimed to identify the function of COL6A3 in the bladder cancer cells and explore the relationship between COL6A3 and TGF-β/Smad-induced EMT. Material and Methods Patient tissues We collected 42 cases of bladder cancer tissues which were surgically resected and pathologically confirmed. Each case selected as the experimental groups had tissue specimens from: normal bladder mucosa away from the tumor site 5 cm, adjacent cancer tissue 1 cm away from the cancer site, and cancer tissue center. Chemotherapy and immunotherapy were not accepted before operation. Each specimen was stored in the refrigerator at −80°C. Informed consents were acquired from each patient, and this study was performed with the agreement of the Ethics Committee of Liaoning Cancer Hospital and Institute. Cell culture The SV-40 immortalized human uroepithelial cell line (SV-HUC-1) was purchased from the American Type Culture Collection (ATCC, Wiltshire, USA). T24 and 5637, the human bladder cancer cell lines, were obtained from Chinese Academy of Sciences Cell Bank (Shanghai, China). T24 as well as SV-HUC-1 cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS) while 5637 cells were grown in (RPMI) 1640 medium with 10% FBS, and then cells were cultured in an incubator with 5% CO2 at 37°C. All reagents were from Thermo Fisher Scientific, Waltham, MA, USA. Cell transfection Cells were seeded in 6-well plates at a density of 4×105 cells per well. The medium was replaced by Opti-MEM (Invitrogen) after 24 hours of culture. And 2 μg plasmid was transfected according to the Lipofectamine 2000 protocol (Invitrogen, Grand Island, NY, USA). After incubation for 48 hours, the cells were used for further study. Small interference RNAs (COL6A3-siRNA) and empty vector were purchased from Genepharma (Shanghai, China). Angiogenesis assays Matrigel (BD Biosciences, San Jose, CA, USA) was placed in a 4°C refrigerator for 12 hours for liquefaction, and then was added to each well of a 24-well plate and solidified in an incubator for 30 min. The T24 cells transfected by COL6A3-siRNA and empty vector were cultured at a concentration of 4×104/well in triplicates with control group. After 12 hours of culturing, the results were observed. Cell counting kit-8 (CCK-8) assay Cell viability was detected by a cell counting kit-8 (CCK-8) (Beyotime, Shanghai, China) assays. Cells in each group were plated in 96-well plates at a density of 3000 cells/well, followed by incubation on the new media for 12, 24, and 48 hours, respectively. CCK-8 was added and incubated for 4 hours. The absorbance was measured at 450 nm, 3 times in each group. Quantitative reverse transcription-polymerase chain reaction (qPCR) Total RNA was isolated according to the manufacturer’s instructions (Thermo Fisher Scientific), followed by the detection of purity and concentration. The amplification reactions were performed using the ABI 7900 system (Applied Biosystems, Carlsbad, CA, USA) with the following conditions: 95°C for 30 sec, 40 cycles at 95°C for 5 sec, and 60°C for 1 min. All primers were compared with BLAST, which were presented in Table 1. The data were analyzed using the 2−ΔΔCt method. Each reaction was performed 3 times. Western blot Tissues and cells were lysed in the lysis buffer (Beyotime, Beijing). Total proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA) after separation by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Membranes were probed with rabbit monoclonal antibodies against TGF-β, Smad2/3, phospho-Smad2/3 (p-Smad2/3), vimentin, E-cadherin, MMP2, MMP-9, TIMP-1 (1: 1,000), and COL6A3 (1: 200, Abcam, Cambridge, MA, USA), and anti-bodies against GAPDH was used as a control, then with goat anti-rabbit secondary antibody. Blots were detected using a Bio-Rad Bioimaging system (Bio-Rad, Hercules, CA, USA). All experiments were performed 3 times. Statistical analysis All data values are expressed as mean ± standard deviation, and statistical analyses were performed using the SPSS software. Statistical evaluations were analyzed using the Student’s t-test. Multiple group comparisons were performed by ANOVA. A value of P<0.05 had statistical significance. Results COL6A3 was overexpressed in tissues and cells of bladder cancer To ascertain the effect of COL6A3 on bladder cancer, the expression of COL6A3 in tumor tissues and their adjacent tissues was examined by quantitative reverse transcription-polymerase chain reaction (qPCR). The COL6A3 gene was higher expressed in the tumor tissues than that in the adjacent tissues (Figure 1A). Moreover, patients with high COL6A3 expression had low survival rate within 800 days after operation, while those with low COL6A3 expression showed opposite results. The results showed that COL6A3 was involved in cancer metastasis (P=0.1336, which might due to the insufficient sample size; Figure 1B). Furthermore, the expression of COL6A3 in 4 representative tumor tissues and their matched adjacent tissues were analyzed by western blot. And the result confirmed that COL6A3 was involved in bladder cancer (Figure 1C, 1D). The expression levels were also tested in T24 and 5637. The levels of protein expression in the T24 cell line were higher than that in the 5637 cell line (Figure 1E), and the trend of mRNA was the same (Figure 1F), indicating that T24 were the optimal cell lines for further study of bladder cancer. Given these results, COL6A3 was highly expressed in tissues and cells of bladder cancer. Transfection with siRNA inhibit the expression of COL6A3 in bladder cancer cell line To explore the role of COL6A3 in bladder cancer, T24 cells were transfected with a COL6A3-siRNA and empty vector. The results demonstrated that the protein level of COL6A3 in COL6A3-siRNA group decreased to nearly 30% (P<0.01; Figure 2A) while the mRNA levels decreased to approximately 10% (P<0.01; Figure 2B), compared to cells without transfection. COL6A3 enhanced cell proliferation To understand the roles of COL6A3 on cell proliferation, we performed CCK-8 assays. Compared to negative control cells, the cell proliferation ability of the COL6A3-siRNA group decreased after COL6A3 downregulation, and the decline of cell proliferation was more obvious with the extension of time (P<0.05; Figure 2C). Knockdown of COL6A3 suppressed the angiogenesis in vitro In control and empty vector group, T24 cells gradually stretched, and connected each other into cords and network structure, forming luminal structures of various sizes and shapes. Nevertheless, tubes forming in the COL6A3-siRNA group was rare (Figure 2D). Furthermore, silencing COL6A3 notably reduced the number of generated blood vessels (P<0.01; Figure 2E). COL6A3 promoted the EMT process The EMT played a role in bladder carcinoma, so we detected EMT-related molecules by western blot to explore whether COL6A3 could affect EMT in bladder cancer cells. We found that the expression of vimentin was decreased significantly after COL6A3 interference, while the level of E-cadherin was the opposite. Furthermore, downregulation of COL6A3 reduced the levels of MMP2 and MMP-9 and increased TIMP-1 (Figure 3A). And the mRNA expression levels of these EMT-related molecules further verified these results (Figure 3B). COL6A3 regulated the activity of TGFβ/Smad signaling pathway TGF-β receptor kinases could phosphorylate Smad2/3 to form a complex with Smad4, and nuclear translocation occurs to regulate gene expression, leading to the EMT [29]. To further analyze the mechanism of COL6A3 in bladder cancer, the protein levels of TGF-β, Smad2/3, and p-Smad2/3 were detected (Figure 4A). The expression of TGF-β showed a significant decrease with the knockdown of COL6A3 (Figure 4B). Interestingly, the expression levels of Smad2 and Smad3 protein were unchanged regardless of whether the COL6A3 expression interference, while the p-Smad2/3 were inhibited, so the p-Smad2/Smad2 and p-Smad3/Smad3 were appreciably decreased (Figure 4C, 4D). Discussion Bladder cancer is the most common urinary tract neoplasm. Although early radical cystectomy and targeted therapy are used, some concerns, such as high mortality and poor prognoses, still exist. Therefore, new target genes are urgently needed for this neoplasm. It has been reported that COL6 is associated with cell anchoring, and can form a filamentous network with collagen types I and III and ECM remodeling to creates an environment for the tumor to flourish [30–32]. In our study, we confirmed that the expression of COL6A3 were upregulated in bladder cancer tissues. We also confirmed that COL6A3 was almost expressed exclusively in tumors, and could potentially serve as a new tumor marker [33]. In addition, patients with high expression level of COL6A3 had an extremely low survival rate as time passed. The levels of COL6A3 in tumor and adjacent tissues from 4 typical patients further verified that COL6A3 was involved in bladder cancers, which was accordance with a previous study [33]. In bladder cancer cells, we found that COL6A3 displayed a relatively high expression in T24 cells, compared with 5637 cells. When inhibiting the expression of COL6A3, we demonstrated that downregulated COL6A3 expression evidently decreased the proliferative abilities of bladder cancer cells. And this result was similar to that in gastric cancer [34]. Angiogenesis is the premise and foundation for tumor invasion and metastasis [35]. In this study, the number of regenerated vessels sank rapidly after COL6A3 expression was depressed. It has been previously reported that the high serum collagen is the result of high levels of degradation, angiogenesis, and remodeling in the ECM [36,37]. As a result, we speculated that interfered COL6A3 could inhibit the biological activities of bladder cancer cells and prevent cancer progression. To understand the effects of COL6A3 on EMT in bladder cancer, the levels of EMT-related genes were detected. It has been proven that EMT involves the invasion and metastasis process of tumor [38,39], which can improve cell migration and invasion ability [40,41]. EMT is characterized by changes in the expression of adhesion molecules, the most important of which is the downregulation of E-cadherin [42]. E-cadherin is often related to cell migration. In addition, many biomarkers change in the process of EMT, such as the upregulation of N-cadherin, MMP2, MMP9, and vimentin. MMP2 and MMP9 could play a critical role in the metastasis of pancreatic cancer [43–45]. In our current study, COL6A3 silencing suppressed the expression of MMP-2, MMP-9, and vimentin, and then was involved in the inhibition of the EMT process in bladder cancer cells. These results suggested that COL6A3 may regulate the levels of EMT-related proteins to facilitate cell migration and metastasis in bladder cancer. The aforementioned results confirmed that COL6A3 might play a certain role in bladder cancer. Moreover, we considered what mechanisms were regulated by COL6A3. There were many pathways that affect the EMT process of tumor, and TGF-β pathway was one of the core pathways to regulate cell proliferation and EMT process in the process of controlling organ development, tissue fibrosis, and cancer cell development [46]. Recently, the TGF-β/Smad2/3 signaling pathway has been reported to play critical roles in cancer metastasis and progression [47,48]. Therefore, we examined several related molecules and found that COL6A3 had a positive correlation with the expression of TGF-β as well as the p-Smad2/Smad2 and p-Smad3/Smad3 ratio in bladder cancer cells. TGF-β, which could phosphorylate and activate the Smad2/3, is involved in cell proliferation, production of ECM, and apoptosis [49,50]. Therefore, the carcinogenesis of COL6A3 in the bladder may partly be due to its relationship with the TGF-β signaling pathway. In this study, we found that COL6A3 silencing could lead to reduced levels of p-Smad2 and p-Smad3. Recently, the activation of TGF-β signaling has been reported to involve the EMT process and the risk of tumor metastasis [51–53]. These results revealed the possible molecular mechanisms of COL6A3 to promoted cell proliferation and the EMT process in bladder cells. Conclusions In total, our study identified that COL6A3 silencing significantly inhibited the cell proliferation, angiogenesis, and EMT process. In addition, we found that COL6A3 could suppress the molecules involved in TGF-β/Smad signaling pathway. These results may enhance our understanding of COL6A3 functions in bladder cells and encourage studies to explore possible mechanisms of TGF-β/Smad-induced EMT in bladder carcinomas. Source of support: Departmental sources Conflict of interest None. Figure 1 Expression of COL6A3 and survival situation. (A) Detection of the expression of COL6A3 in human bladder cancer tissues and adjacent tissues in 42 patients by qPCR. *** P<0.0001. (B) Using Kaplan-Meier method to show survival situation of patients with high or low level of COL6A3. The log-rank test was used to calculate the P value. Results were presented as mean ± SD from 3 independent experiments. (C) Western blot from 4 representative bladder cancer tumors (T1–T4) and adjacent tissues (A1–A4) showed expression of COL6A3 mainly in the tumors. (D) Protein expression of COL6A3 showed differential expression levels between individual tumors and showed higher levels in the tumor tissue than those in adjacent tissues. ** P<0.01 compared with adjacent tissues. (E) Representative of western blot showed that protein in T24 was higher than that in 5637. ** P<0.01 compared with SV-HUC-1, ## P<0.01 compared with T24. (F) Both cell lines expressed high levels of COL6A3 and T24 express higher levels of COL6A3. ** P<0.01 compared with SV-HUC-1, ## P<0.01 compared with T24. Figure 2 The role of COL6A3 in the biological behavior of bladder cancer cells. After transfection of T24 cells by COL6A3-siRNA, both the protein expression (A) and mRNA expression of COL6A3 (B) were significantly reduced. (C) Cell viability by CCK-8 assay. Interfered COL6A3 could significantly reduce the cell viability. (D) Angiogenesis showed that COL6A3 silencing could inhibit the formation of cable structures and reticular structures. (E) A significant decrease in the number of generated vessels when COL6A3 was downregulated conducted by angiogenesis experiment. * P<0.05, ** P<0.01 compared with control; ## P<0.01 compared with empty vector Figure 3 The effect of COL6A3 on EMT related protein and mRNA. The MMP2, MMP9 and vimentin decreased significantly after COL6A3 interference, while the expression trend of E-cadherin and TIMP-1 is the opposite in the aspects of protein (A) and RNA (B). * P<0.05, ** P<0.01 compared with control; # P<0.05, ## P<0.01 compared with empty vector. Figure 4 The effect of COL6A3 on the protein level of TGF-β/Smad pathway in bladder cancer cells. The expression level of Smad2 and Smad3 protein was similar (A), while the expression of TGF-β was decreased (B) after interference of COL6A3 expression. The phosphorylation of Smad2 (C) and Smad3 (D) faded after reducing the expression of COL6A3. ** P<0.01 compared with control, ## P<0.01 compared with empty vector. Table 1 List of qPCR primers. Gene Forward primer (5′-3′) Reverse primer (5′-3′) COL6A3 TCTCTTAAAATCAGTGCACAACG AACTCTTTCAACAGAGGGAAGC MMP2 ATGACAGCTGCACCACTGAG GCCTCGTATACCGCATCAAT MMP9 TACCGAGAAAGCCTATT CACCTGGTTCAACTCACT TIMP-1 TTCCGACCTCGTCATCAGGG ATTCAGGCTATCTGGGACCGC E-cadherin AACGCATTGCCACATACAC GAGCACCTTCCATGACAGAC Vimentin ACAGGCTTTAGCGAGTTATT GGGCTCCTAGCGGTTTAG GAPDH GGTGAAGGTCGGAGTCAACGG CCTGGAAGATGGTGATGGGATT ==== Refs References 1 Siegel RL Miller KD Jemal A Cancer statistics, 2016 Cancer J Clin 2016 66 1 7 30 2 Leow JJ Martindoyle W Rajagopal PS Adjuvant chemotherapy for invasive bladder cancer: A 2013 updated systematic review and meta-analysis of randomized trials Eur Urol 2014 66 1 42 54 24018020 3 Hanahan D Weinberg RA Hallmarks of cancer: The next generation Cell 2011 144 5 646 47 21376230 4 Acloque H Adams MS Fishwick K Epithelial-mesenchymal transitions: The importance of changing cell state in development and disease J Clin Invest 2009 119 6 1438 49 19487820 5 Onder TT Gupta PB Mani SA Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways Cancer Res 2008 68 10 3645 54 18483246 6 Min KW Kim DH Do SI Expression patterns of stromal MMP-2 and tumoural MMP-2 and -9 are significant prognostic factors in invasive ductal carcinoma of the breast APMIS 2015 122 12 1196 206 7 Vucemilo T Skoko M Sarcević B The level of serum pro-matrix metalloproteinase-2 as a prognostic factor in patients with invasive ductal breast cancer Coll Antropol 2014 38 1 135 40 24851607 8 Hussein AA The role of Matrix metalloproteinase-2 and -9 in situ hybridization in bladder cancer progression Iraqi Journal of Medical Sciences 2011 9 247 54 9 Szarvas T Vom DF Ergün S Rübben H Matrix metalloproteinases and their clinical relevance in urinary bladder cancer Nat Rev Urol 2011 8 5 241 54 21487384 10 Papageorgis P TGFβ signaling in tumor initiation, epithelial-to-mesenchymal transition, and metastasis J Oncol 2015 2015 5 587193 25883652 11 Zavadil J Böttinger EP TGF-|[beta]| and epithelial-to-mesenchymal transitions Oncogene 2005 24 37 5764 74 16123809 12 Nieto MA The ins and outs of the epithelial to mesenchymal transition in health and disease Ann Rev Cell Dev Biol 2011 27 1 347 76 21740232 13 Lamouille S Derynck R Cell size and invasion in TGF-β-induced epithelial to mesenchymal transition is regulated by activation of the mTOR pathway J Cell Biol 2007 178 3 437 51 17646396 14 Thiery JP Sleeman JP Complex networks orchestrate epithelial-mesenchymal transitions Nat Rev Mol Cell Biol 2006 7 2 131 42 16493418 15 Pickup MW Owens P Moses HL TGF-β, bone morphogenetic protein, and activin signaling and the tumor microenvironment Cold Spring Harb Perspect Biol 2017 9 5 pii: a022285 16 Massagué J Blain SW Lo RS TGFbeta signaling in growth control, cancer, and heritable disorders Cell 2000 103 2 295 309 11057902 17 Ikushima H Miyazono K TGFbeta signalling: A complex web in cancer progression Nat Rev Cancer 2010 10 6 415 24 20495575 18 Weiss A Attisano L The TGFbeta superfamily signaling pathway Wiley Interdiscip Rev Dev Biol 2013 2 1 47 63 23799630 19 Barcellos-Hoff MH Cucinotta FA New tricks for an old fox: Impact of TGFβ on the DNA damage response and genomic stability Sci Signal 2014 7 341 re5 25185158 20 Derynck R Muthusamy BP Saeteurn KY Signaling pathway cooperation in TGF-β-induced epithelial-mesenchymal transition Curr Opin Cell Biol 2014 31 31 56 66 25240174 21 Lucia C Aiello FB DNA repair and cytokines: TGF-β, IL-6, and thrombopoietin as different biomarkers of radioresistance Front Oncol 2016 6 10 175 27500125 22 Gupta S Hau AM Al-Ahmadie HA Transforming growth factor-β is an upstream regulator of mammalian target of rapamycin complex 2-dependent bladder cancer cell migration and invasion Am J Pathol 2016 186 5 1351 60 26988652 23 Pei M Chen D Li J Wei L Histone deacetylase 4 promotes TGF-beta1-induced synovium-derived stem cell chondrogenesis but inhibits chondrogenically differentiated stem cell hypertrophy Differentiation 2009 78 5 260 68 19716643 24 Yao R Lemon WJ Wang Y Altered gene expression profile in mouse bladder cancers induced by hydroxybutyl(butyl)nitrosamine Neoplasia 2004 6 5 569 77 15548366 25 Hung TT Wang H Kingsley EA Molecular profiling of bladder cancer: Involvement of the TGF-beta pathway in bladder cancer progression Cancer Lett 2008 265 1 27 38 18477502 26 Martianov I Cler E Duluc I TAF4 inactivation reveals the 3 dimensional growth promoting activities of collagen 6A3 PLoS One 2014 9 2 e87365 24498316 27 Kang CY Wang J Axellhouse D Clinical significance of serum COL6A3 in pancreatic ductal adenocarcinoma J Gastrointest Surg 2014 18 1 7 15 24002763 28 Arafat H Lazar M Salem K Tumor-specific expression and alternative splicing of the COL6A3 gene in pancreatic cancer Surgery 2011 150 2 306 15 21719059 29 Islam SS Mokhtari RB El Hout Y TGF-β1 induces EMT reprogramming of porcine bladder urothelial cells into collagen producing fibroblasts-like cells in a Smad2/Smad3-dependent manner J Cell Commun Signal 2014 8 1 39 58 24338442 30 Lohi J Leivo I Oivula J Extracellular matrix in renal cell carcinomas Histol Histopathol 1998 13 3 785 96 9690136 31 Sethi T Rintoul RC Moore SM Extracellular matrix proteins protect small cell lung cancer cells againstapoptosis: A mechanism for small cell lung cancer growth and drug resistance in vivo Nat Med 1999 5 6 662 68 10371505 32 Sherman-Baust CA Weeraratna AT Rangel LB Remodeling of the extracellular matrix through overexpression of collagen VI contributes to cisplatin resistance in ovarian cancer cells Cancer Cell 2003 3 4 377 86 12726863 33 Thorsen K Sørensen KD Bremseskildsen AS Alternative splicing in colon, bladder, and prostate cancer identified by exon array analysis Mol Cell Proteomics 2008 7 7 1214 24 18353764 34 Ao R Guan L Wang Y Wang JN Silencing of COL1A2, COL6A3 and THBS2 Inhibits Gastric Cancer Cell Proliferation, Migration and Invasion while Promoting Apoptosis through the PI3k-Akt Signaling Pathway J Cell Biochem 2017 [Epub ahead of print] 35 Li Q Wang AY Xu QG In-vitro inhibitory effect of EGFL7-RNAi on endothelial angiogenesis in glioma Int J Clin Exp Pathol 2015 8 10 12234 42 26722408 36 Öhlund D Lundin C Ardnor B Type IV collagen is a tumour stroma-derived biomarker for pancreas cancer Br J Cancer 2009 101 1 91 97 19491897 37 Mazouni C Arun B André F Collagen IV levels are elevated in the serum of patients with primary breast cancer compared to healthy volunteers Br J Cancer 2008 99 1 68 71 18560403 38 Polyak K Weinberg RA Polyak K Weinberg RA Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits Nat Rev Cancer 9 4 265 73 39 Kang Y Massagué J Epithelial-mesenchymal transitions: Twist in development and metastasis Cell 2004 118 3 277 79 15294153 40 Luo M Brooke M Wicha MS Epithelial-mesenchymal plasticity of breast cancer stem cells: Implications for metastasis and therapeutic resistance Curr Pharm Des 2015 21 10 1301 10 25506895 41 Satoh K Hamada S Shimosegawa T Involvement of epithelial to mesenchymal transition in the development of pancreatic ductal adenocarcinoma J Gastroenterol 2015 50 2 140 46 25216997 42 Yu H Shen Y Hong J The contribution of TGF-β in epithelial-mesenchymal transition (EMT): Down-regulation of E-cadherin via snail Neoplasma 2015 62 1 1 15 25563362 43 Tsai JH Yang J Epithelial-mesenchymal plasticity in carcinoma metastasis Genes Dev 2013 27 20 2192 206 24142872 44 Andreolas C Kalogeropoulou M Voulgari A Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells Int J Cancer 122 1745 56 45 Shaul Y Freinkman E Comb W Dihydropyrimidine accumulation is required for the epithelial-mesenchymal transition Cell 2014 158 5 1094 109 25171410 46 TiradoRodriguez B Ortega E SeguraMedina P HuertaYepez S TGF-β: An important mediator of allergic disease and a molecule with dual activity in cancer development J Immunol Res 2014 2014 5 318481 25110717 47 Kim TW Michniewicz M Bergmann DC Wang ZY Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of a MAPK pathway Nature 2012 482 7385 419 22 22307275 48 Zhu H Luo H Shen Z Transforming growth factor-β1 in carcinogenesis, progression, and therapy in cervical cancer Tumour Biol 2016 37 6 7075 83 27010470 49 Kamato D Burch ML Piva TJ Transforming growth factor-β signalling: role and consequences of Smad linker region phosphorylation Cell Signal 2013 25 10 2017 24 23770288 50 Gratchev A TGF-β signalling in tumour associated macrophages Immunobiology 2016 222 1 75 81 26876591 51 Zhao JJ Hao S Wang LL Long non-coding RNA ANRIL promotes the invasion and metastasis of thyroid cancer cells through TGF-β/Smad signaling pathway Oncotarget 2016 7 36 57903 18 27507052 52 Khan Z Marshall JF The role of integrins in TGFβ activation in the tumour stroma Cell Tissue Res 2016 365 3 657 73 27515461 53 Moustakas A Heldin CH Mechanisms of TGFβ-induced epithelial-mesenchymal transition J Clin Med 2016 5 7 pii: E63