==== Front Indian J Endocrinol MetabIndian J Endocrinol MetabIJEMIndian Journal of Endocrinology and Metabolism2230-82102230-9500Medknow Publications & Media Pvt Ltd India IJEM-22-45710.4103/ijem.IJEM_105_18Original ArticlePTPN22 1858 C/T Exon Polymorphism is not Associated with Graves' Disease in Kashmiri population Shehjar Faheem Dil-Afroze 1Misgar Riaz A. Malik Sajad A. Laway Bashir A. Department of Endocrinology, Sher-i-Kashmir Institute of Medical Sciences (SKIMS), Srinagar, Jammu and Kashmir, India1 Department of Immunology and Molecular Medicine, Sher-i-Kashmir Institute of Medical Sciences (SKIMS), Srinagar, Jammu and Kashmir, IndiaAddress for correspondence: Dr. Bashir A Laway, Department of Endocrinology, Sher-i-Kashmir Institute of Medical Sciences, Srinagar, Jammu and Kashmir, India. E-mail: drlaway@gmail.comJul-Aug 2018 22 4 457 460 Copyright: © 2018 Indian Journal of Endocrinology and Metabolism2018This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to remix, tweak, and build upon the work non-commercially, as long as appropriate credit is given and the new creations are licensed under the identical terms.Background: Graves' disease (GD) is a multifactorial autoimmune disease with contribution from both genetic and epigenetic factors in its causation. Association of genetic factors and GD has been extensively studied. Gene “protein tyrosine phosphatase nonreceptor 22” (PTPN22) is an important immunoregulatory gene preventing hyper responsiveness of T cells by negatively regulating their signal transduction. Association of single-nucleotide polymorphism (SNP) 1858 C/T within PTPN22 with some autoimmune diseases has been described. Methods: We aimed to analyze whether 1858 C/T SNP of PTPN22 gene has any association with GD in Kashmiri population. Polymerase chain reaction-restriction fragment length polymorphism was performed for genotyping 1858 C/T SNP in 135 patients with GD and 150 age- and gender-matched healthy controls. Results: Among the patients with GD, the frequencies of PTPN22 1858 CC, CT, and TT genotypes were 97.7, 2.2, and 0%, respectively, whereas in healthy controls the frequencies of CC, CT genotypes were 100 and 0%, respectively. No significant association was found between PTPN22 1858 C/T SNP and patients with GD. Conclusion: GD is not associated with PTPN22 1858 C/T SNP in Kashmiri population. Furthermore, 1858 C/T SNP in PTPN22 gene could be a part of variation in different ethnic populations across the globe. Keywords: Graves' diseaseprotein tyrosine phosphatase nonreceptor 22restriction fragment length polymorphismsingle-nucleotide polymorphism ==== Body INTRODUCTION Graves' disease (GD) is an autoimmune disorder, clinically presenting as hyperthyroidism, diffuse thyroid enlargement with or without ophthalmopathy and occasionally dermopathy.[1] Cause of GD is multifactorial with contribution of genetic and environmental factors.[234] Protein tyrosine phosphatase nonreceptor 22 (PTPN22) gene helps to prevent hyperresponsiveness of T cells via a protein it encodes [known as lymphoid tyrosine phosphatase (LYP) protein], which causes negative T cell regulation.[5] Among several single-nucleotide polymorphisms (SNPs) in PTPN22 gene, 1858 C/T (Arg620Trp) is an important SNP. Initial studies showed Type 1 diabetes be associated with PTPN22 Arg620Trp SNP, where T allele acted as a risk allele.[6] Later, T allele of this SNP was shown to be associated with many other autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematosus in addition to GD.[78910111213] Ichimura et al. did not find an association between PTPN22 1858 C/T SNP and GD susceptibility in Japanese population, suggesting that it does not play a causal role for its development.[14] Variations in the results from different studies could predominantly be due to distinct ethnicities of the studied populations. It would be useful to study populations having distinct ethnic background. As no study on the role of PTPN22 1858 C/T SNP in GD predisposition has been conducted till date in our population, using a conventional polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) approach, we studied the association between 1858 C/T polymorphism and GD in Kashmiri population. MATERIALS AND METHODS A total of 135 patients with GD (33 men and 102 women) between the age of 14 and 68 years (average = 37.97 years) were enrolled in this study. Diagnosis of GD was established on the basis of clinical parameters of thyrotoxicosis (history of marked weight loss, presence of diffuse goiter, presence of skin or eye changes) that diffusely increased Technetium99m pertechnetate uptake on thyroid scintigraphy and positive thyroid stimulating hormone (TSH) receptor antibody. Information was collected on the patient's age at onset, history of smoking, size of thyroid gland, presence of thyroid eye disease, serum thyroid hormone levels and antibody titers of TSH receptor antibodies. A group of 150 age- and sex-matched healthy volunteers (42 men and 108 women), who were euthyroid and had no personal or family history of Grave's or other autoimmune diseases, served as controls. Informed consent was obtained from each individual who participated in the study. The frequency distribution, demographics, and risk factors in patients with GD and controls are shown in Table 1. Table 1 Frequency distribution of demographic factors, genotypic and allelic frequencies of PTPN22 1858 C/T polymorphism in patients with GD and controls Sample collection and molecular analysis Five milliliters of peripheral blood were collected from GD patients and healthy controls in ethylenediaminetetraacetic acid containing tubes. DNA was isolated using HiPurA™ Blood Genomic DNA Miniprep Purification Kit (HiMedia Laboratories Pvt. Ltd., Mumbai, India). Amplification of the exon 1858 C/T PTPN22 gene PCR amplification was carried out using a single set of the primer pair (Forward = ACTGATAATGTTGCTTCAACGG; Reverse = TCACCAGCTTCCTCAACCAC) that amplified the exonic region PTPN22 gene containing the 1858 C/T polymorphic site. The amplicon size was 218bp. PCR was carried out in a final volume of 25 μl containing 50 ng genomic DNA template, 1X PCR buffer (Biotools, B and M Labs, S.A. Madrid-Spain) with 2 mM MgCl2, 0.4 mM of each primer (Sigma-Aldrich Co. LLC, USA), 50 mM dNTPs (Biotools, B and M Labs, S.A. Madrid-Spain), and 1U DNA polymerase (Biotools, B and M Labs, S.A. Madrid-Spain). For PCR amplification, the standard program was used as follows: one initial denaturation step at 94°C for 5 min, followed by 30 denaturation cycles of 30 s at 94°C, 30 s of annealing at 62°C, and 60 s of extension at 72°C, followed by a final elongation cycle at 72°C for 5 min. Genotypic analysis of PTPN22 1858 C/T polymorphism by RFLP The PCR product of 218bp [Figure 1] containing the 1858 C/T restriction site was digested by enzyme RsaI (Fermentas Thermo Fisher Scientific Inc., Massachusetts, USA). Products were resolved on 3% Agarose gel. PTPN22 1858C allele if present is recognized as a cleavage site by endonuclease RsaI. The 1858T allele is not digested and yields one fragment of 218 bp, while the 1858C allele is digested and yields two fragments of 176 and 46 bp and the heterozygous C/T gives three bands of 218, 176, and 46 bp [Figure 2]. Figure 1 Representative gel picture showing PTPN22 1858 amplicon. Figure 2 Representative gel picture showing RFLP analysis of PTPN22 1858 PCR product Laboratory tests Blood samples were collected from each patient in the fasting state. Serum concentrations of TSH, total T3, and total T4 were measured by commercial chemiluminescent immunoassays (Beckman Coulter Unicel DXI 800 Access Immunoassay System, Brea, California). TSH receptor antibody was measured by enzyme-linked immunosorbent assay (Elisa RSR™ TRAb second-generation kit; RSR, Cardiff, UK). The normal values were as follows: TSH, 0.5–6.5 mIU/ml; total T3, 0.70–2.50 ng/ml; total T4, 4.0–13.0 mcg/dl, and TRAb ≤ 1U/l. Statistical analysis For statistical analysis, the genotype and allelic frequency distributions of polymorphisms in the control and GD patient groups were compared using the χ2-test. When the assumption of the χ2-test was violated (i.e., when one cell had an expected count of <1, or >20% of the cells had an expected count of <5), Fisher's exact test was used. Odds ratios (ORs) with 95% confidence intervals (CIs) were determined for the disease susceptibility of specific genotypes and alleles. Results were considered statistically significant when the probability of findings occurring by chance was <5% (P < 0.05). RESULTS A total of 285 individuals (135 GD cases and 150 healthy controls) were included in this study. The distribution of PTPN22 1858genotypic and allelic frequencies in cases and controls is given in Table 1. Among the patients with GD, the frequencies of PTPN22 1858 CC, CT and TT genotypes were 132 (97.78%), 3 (2.22%), and 0 (0%), respectively, whereas every healthy control had a positive CC genotypes. None among controls was positive for CT and TT genotypes. Statistical analysis indicated that genotypic and allelic frequencies of the PTPN22 1858 polymorphism in cases and controls did not differ significantly (P > 0.05). Furthermore, the association between PTPN22 1858 polymorphism with that of the clinicopathological parameters was also analyzed. No significant association was seen in any of the parameters (P > 0.05) with the said polymorphism [Table 2]. Table 2 Association between PTPN22 1858 C/T polymorphism and various clinical parameters of patients with GD DISCUSSION Apart from Major Histocompatibility Complex, PTPN22 locus is a potent risk factor associated with several autoimmune diseases. LYP protein encoded by PTPN22 gene is expressed exclusively by the cells of immune system.[15] In the coding region of this gene, a single-base change within a polyproline binding motif (from amino acid arginine to tryptophan) has been associated with Type 1 diabetes, rheumatoid arthritis, systemic lupus erythematosis, Hashimoto's thyroiditis, and GD.[16171819202122] In this case–control study, we investigated the association between PTPN22 gene 1858 C>T polymorphism and GD in Kashmiri population. Among patients with GD, the frequencies of PTPN22 1858 CC and CT genotypes were 97.78 and 2.22%, respectively, and TT genotype seen in none. Among healthy controls, PTPN22 1858 CC genotype was seen in all and none had CT and TT genotypes. Genotypic and allelic frequencies of the PTPN22 1858 polymorphism in cases and controls were not significantly different (P > 0.05) [Table 1]. The individuals harboring T allele of the PTPN22 C1858T gene SNP have been shown to be more susceptible to development of GD in British and Polish Caucasians.[11121623] Further, a meta-analysis showed association of PTPN22 1858T allele with rheumatoid arthritis, systemic lupus erythematosus, GD, and type 1 diabetes in Caucasians.[24] It has been proposed that the disease-associated T allele encodes a protein that does not bind to the protein tyrosine kinase Csk and may therefore cause general hyperresponsiveness of T cells.[6] In our study only, 3 out of 135 GD cases had CT genotype, while T allele was completely absent in controls. Our results are consistent with the study in Japanese populations by Ichimura et al.,[14] documenting an absence of the T allele in all the patients and healthy controls. Also, several other reports have shown that PTPN22 T variant is absent in patients with GD, type 1 diabetes, rheumatoid arthritis as was in healthy population,[252627] implying that PTPN22 gene polymorphism shows ethnic differences. The results of the present study suggest that 1858 C/T SNP may be of little importance in our patient population with GD. Limitations Small sample size might be a limitation in our study. We suggest more such studies with a larger sample size to be conducted because of rarity of PTPN22 1858 T allele in Kashmiri population. CONCLUSION PTPN22 1858 C/T polymorphism does not show an association with GD in Kashmiri population. Financial support and sponsorship The study was supported by the research grant received from SKIMS. Conflicts of interest There are no conflict of interest. Acknowledgement We are grateful to the head and Staff of Department of Endocrinology, SKIMS, who helped us in the sample procurement and hormone assays. ==== Refs REFERENCES 1 Weetman AP Graves' disease N Engl J Med 2000 343 1236 48 11071676 2 Brix TH Kyvik KO Christensen K Hegedüs L Evidence for a major role of heredity in Graves' disease: A population-based study of two Danish twin cohorts J Clin Endocrinol Metab 2001 86 930 4 11158069 3 Tomer Y Mechanisms of autoimmune thyroid diseases: From genetics to epigenetics Annu Rev Pathol Mech Dis 2014 9 147 56 4 Brix TH Hegedüs L Twin studies as a model for exploring the aetiology of autoimmune thyroid disease Clin Endocrinol (Oxf) 2012 76 457 64 22168537 5 Burn GL Svensson L Sanchez-Blanco C Saini M Cope AP Why is PTPN22 a good candidate susceptibility gene for autoimmune disease? FEBS Lett 2011 585 3689 98 21515266 6 Bottini N Musumeci L Alonso A Rahmouni S Nika K Rostamkhani M A functional variant of lymphoid tyrosine phosphatase is associated with type I diabetes Nat Genet 2004 36 337 8 15004560 7 Begovich AB Carlton VEH Honigberg LA Schrodi SJ Chokkalingam AP Alexander HC A missense single-nucleotide polymorphism in a gene encoding a protein tyrosine phosphatase (PTPN22) is associated with rheumatoid arthritis Am J Hum Genet 2004 75 330 7 15208781 8 Carlton VEH Hu X Chokkalingam AP Schrodi SJ Brandon R Alexander HC PTPN22 genetic variation: Evidence for multiple variants associated with rheumatoid arthritis Am J Hum Genet 2005 77 567 81 16175503 9 Kyogoku C Ortmann WA Lee A Selby S Carlton VEH Chang M Genetic association of the R620W polymorphism of protein tyrosine phosphatase PTPN22 with human SLE Am J Hum Genet 2004 75 504 7 15273934 10 Orozco G Sánchez E González-Gay MA López-Nevot MA Torres B Cáliz R Association of a functional single-nucleotide polymorphism of PTPN22, encoding lymphoid protein phosphatase, with rheumatoid arthritis and systemic lupus erythematosus Arthritis Rheum 2005 52 219 24 15641066 11 Smyth D Cooper JD Collins JE Heward JM Franklyn JA Howson JMM Replication of an association between the lymphoid tyrosine phosphatase locus (LYP/PTPN22) with type 1 diabetes, and evidence for its role as a general autoimmunity locus Diabetes 2004 53 3020 3 15504986 12 Velaga MR Wilson V Jennings CE Owen CJ Herington S Donaldson PT The codon 620 tryptophan allele of the lymphoid tyrosine phosphatase (LYP) gene is a major determinant of Graves' disease J Clin Endocrinol Metab 2004 89 5862 5 15531553 13 Zhebrun D Kudryashova Y Babenko A Maslyansky A Kunitskaya N Popcova D Association of PTPN22 1858T/T genotype with type 1 diabetes, Graves' disease but not with rheumatoid arthritis in Russian population Aging 2011 3 368 73 21467606 14 Ichimura M Kaku H Fukutani T Koga H Mukai T Miyake I Associations of protein tyrosine phosphatase nonreceptor 22 (PTPN22) gene polymorphisms with susceptibility to Graves' disease in a Japanese population Thyroid 2008 18 625 30 18578611 15 Bottini N Peterson EJ Tyrosine phosphatase PTPN22: Multifunctional regulator of immune signaling, development, and disease Annu Rev Immunol 2014 32 83 119 24364806 16 Heward JM Brand OJ Barrett JC Carr-Smith JD Franklyn JA Gough SC Association of PTPN22 haplotypes with Graves' disease J Clin Endocrinol Metab 2007 92 685 90 17148556 17 Orrú V Tsai SJ Rueda B Fiorillo E Stanford SM Dasgupta J A loss-of-function variant of PTPN22 is associated with reduced risk of systemic lupus erythematosus Hum Mol Genet 2009 18 569 79 18981062 18 Rodríguez-Rodríguez L Taib WRW Topless R Steer S González-Escribano MF Balsa A The PTPN22 R263Q polymorphism is a risk factor for rheumatoid arthritis in Caucasian case-control samples Arthritis Rheum 2011 63 365 72 21279993 19 Steck A Baschal E Jasinski J Boehm B Bottini N Concannon P rs2476601 T allele (R620W) defines high-risk PTPN22 type I diabetes-associated haplotypes with preliminary evidence for an additional protective haplotype Genes Immun 2009 10 S21 6 19956096 20 Wesoly J Hu X Thabet MM Chang M Uh H Allaart CF The 620W allele is the PTPN22 genetic variant conferring susceptibility to RA in a Dutch population Rheumatol Oxf Engl 2007 46 617 21 21 Yu N Rymar O Maximov V Simonova G Zankina M Mustafina S Association of PTPN22 haplotypes with Hashimotos thyroiditis in population of Novosibirsk Clin Exp Thyroidol 2009 5 47 52 22 Zoledziewska M Perra C Orrù V Moi L Frongia P Congia M Further evidence of a primary, causal association of the PTPN22 620W variant with type 1 diabetes Diabetes 2008 57 229 34 17934143 23 Skorka A Bednarczuk T Bar-Andziak E Nauman J Ploski R Lymphoid tyrosine phosphatase (PTPN22/LYP) variant and Graves' disease in a Polish population: Association and gene dose-dependent correlation with age of onset Clin Endocrinol (Oxf) 2005 62 679 82 15943829 24 Lee YH Rho YH Choi SJ Ji JD Song GG Nath SK The PTPN22 C1858T functional polymorphism and autoimmune diseases—a meta-analysis Rheumatology 2007 46 49 56 16760194 25 Ban Y Tozaki T Taniyama M Tomita M Ban Y The codon 620 single nucleotide polymorphism of the protein tyrosine phosphatase-22 gene does not contribute to autoimmune thyroid disease susceptibility in the Japanese Thyroid 2005 15 1115 8 16279843 26 Kawasaki E Awata T Ikegami H Kobayashi T Maruyama T Nakanishi K Systematic search for single nucleotide polymorphisms in a lymphoid tyrosine phosphatase gene (PTPN22): Association between a promoter polymorphism and type 1 diabetes in Asian populations Am J Med Genet A 2006 140A 586 93 27 Ikari K Momohara S Inoue E Tomatsu T Hara M Yamanaka H Haplotype analysis revealed no association between the PTPN22 gene and RA in a Japanese population Rheumatol Oxf Engl 2006 45 1345 8