==== Front Biosci Microbiota Food HealthBiosci Microbiota Food HealthBMFHBioscience of Microbiota, Food and Health2186-69532186-3342BMFH Press 17-02110.12938/bmfh.17-021Full PaperStimulation of murine cell-mediated immunity by dietary administration of a cell preparation of Enterococcus faecalis strain KH-2 and its possible activity against tumour development in mice TSUKAHARA Takamitsu 1*NAKAMURA Shin-ichi 1ROMERO-PÈREZ Gustavo A. 1OHWAKI Makoto 3YANAGISAWA Takaharu 4KAN Tatsuhiko 21 Kyoto Institute of Nutrition and Pathology, 7-2 Furuikedani, Ujitawara-cho, Tsuzuki-gun, Kyoto 610-0231, Japan2 Bio-Lab Co., Ltd., 2-1-3 Komagawa, Hidaka-shi, Saitama 350-1249, Japan3 Non-Profit Organisation, The Japanese Association of Clinical Research on Supplements, 1-9-24 Shihogi, Hidaka-shi, Saitama 350-1248, Japan4 Broma Laboratory Ltd., 1-26 Kandasuda-cho, Chiyoda-ku, Tokyo 101-0041, Japan*Corresponding author. Takamitsu Tsukahara (E-mail: tsukahara@kyoto-inp.co.jp)28 3 2018 2018 37 3 49 57 26 10 2017 09 3 2018 ©2018 BMFH Press2018This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (by-nc-nd) License. (CC-BY-NC-ND 4.0: https://creativecommons.org/licenses/by-nc-nd/4.0/)It is well known that dietary lactic acid bacteria (LAB) stimulate cell-mediated immunity such as natural killer (NK) activity in mice. Here, we aimed to assay the immunomodulatory effects of a cell preparation of Enterococcus faecalis strain KH-2 (CPEF). We further evaluated the possibility of antitumour activity caused by CPEF administration, because NK cells actively participate in the prevention of tumour formation. NK cell activity and gene expression of IFN-γ and Perforin 1, which were induced most likely by a synergetic action of their cytotoxic activity, were higher in splenocytes of CPEF-administered mice than they were in control mice. Moreover, unlike those of control mice, the splenocytes of CPEF-administered mice had significantly higher CD28+CD69+/CD4+ and CD28+CD69+/CD8+ ratios that resulted in a survival rate with a tendency toward improvement after 47 days of CPEF administration (p=0.1) in Meth-A fibrosarcoma-bearing mice. In conclusion, we showed that CPEF might be effective in treating Meth-A fibrosarcoma in mice, as it helped increase their survival rate via stimulation of an immune response in splenocytes, which involved systemic cellular immunity processes such as cytotoxic activity, and active T cells. Enterococcus faecalisactivation of cell-mediated immunitymurine modelnatural killer activity ==== Body INTRODUCTION Bacterial strains with probiotic properties including lactic acid bacteria (LAB) can induce protective immune responses by constantly stimulating mucosal surfaces [1], which activates and matures immune cells [2], including natural killer (NK) cells and T cells [3]. For example, it has been shown dietary LAB stimulate the NK activity of splenocytes in both young [4] and elderly mice [5], which results in suppression of tumour growth [6]. More recently, we demonstrated several times in our premises the immunostimulating effects of a cell preparation of Enterococcus faecalis (a species of LAB) not only on lymphoid tissue associated with the gut [7, 8] but also on lymphatic systemic tissue [9, 10]. The immune system plays a critical role in the control of progression of tumours [11]. In an immune response, innate immune cells such as macrophages and NK cells, as well as adaptive immune cells such as B and T cells, can be found within the tumour microenvironment [12, 13]. Previous studies reported that NK cells alone actively participate in the prevention of tumour formation [14] and that cytotoxic T lymphocytes (CTLs) are capable of killing tumours or blocking their growth following a stimulus by a metabolite [15, 16] or other immune cells [17, 18]. This close crosstalk between CTLs and NK cells in the tumour microenvironment [19] seems to enhance the immune response and prolong patient survival, which can result in complete tumour suppression [20]. However, if CTLs and NK cells lose functionality or their activity is not properly orchestrated, immune cell mobilisation can result in induction of growth dormancy [21, 22] or generation of more tumour cells even in immunocompetent individuals [21, 23], as it has been experimentally demonstrated in mice [24, 25]. Sarcomas are rare and heterogeneous malignancies found in bone, muscle, fibrous, or similar tissues and, like epithelial tumours, exhibit formidable acquired and adaptive resistance to drugs [26]. Because of this, aggressive chemotherapy and surgical resection remain the most effective therapeutic approaches to date [26]. Nonetheless, previous studies reporting information on the immunosuppressing effects of beneficial microorganisms on sarcoma have provided valuable insight and warranted further investigation [27, 28]. In the present study, we evaluated whether or not oral administration of a cell preparation of E. faecalis strain KH-2 (CPEF) stimulated cell-mediated immunity such as NK activity in a mouse model. We further aimed to test whether or not oral administration of CPEF was effective for preventing tumour development using Meth-A fibrosarcoma-bearing mice, which represent an in vivo screening model commonly used to evaluate the antitumour activity of functional foods or alternative medicines [29,30,31]. MATERIALS AND METHODS Cell preparation of heat-treated CPEF Enterococcus faecalis strain KH-2 was retrieved from a bacterial library deposited in our premises. E. faecalis strain KH-2 was then inoculated into a culture medium (1 l) containing 50 g of glucose, 20 g of yeast extract, 10 g of peptone, 2 g of monopotassium phosphate, 1 g of magnesium sulfate, 1 g of trisodium citrate, and 0.5 g of glycerin-fatty acid ester, at pH 6.5, and incubated at 37°C for 24 hr. Bacterial cells were harvested with a filter and subsequently pasteurised. The E. faecalis cell density was 5 × 1012 cells/g. CPEF was concocted by suspending the cell fraction in sterile saline and was used for CPEF treatment in all experiments. Tumour cell line culture RPMI-1640 medium (Sigma, Tokyo, Japan) containing 10% fetal bovine serum and 1% Penicillin-Streptomycin solution (10,000 U/ml; Gibco, Tokyo, Japan) was used as the cell culture medium in all experiments. Meth-A, a fibrosarcoma cell line, was kindly donated by the Cell Resource Center for Biomedical Research Institute of Development, Aging and Cancer of Tohoku University (Sendai, Miyagi, Japan). Meth-A cells were cultured in 75 cm2 culture flasks containing 10 ml of RPMI-1640 medium for 3 days at 37°C in a humidified atmosphere (5% CO2). A murine lymph node lymphoma cell line (YAC-1) was purchased from DS Pharma Biomedical (Osaka, Japan) and used as the target cells. YAC-1 cells were cultured and incubated as described above for Meth-A cells. Afterwards, YAC-1 cells (1.0 × 106 cells/ml) were labelled with 10 μM 3,3′-dioctadecyloxacarbocyanine perchlorate (Dioc18; Life Technologies Japan, Tokyo, Japan) and further incubated for 15 min at 37°C [32]. YAC-1 cells were then washed three times with Hank’s Balanced Salts Solution (HBSS, Sigma-Aldrich Japan, Tokyo, Japan), resuspended in RPMI-1640 medium, and counted (TC10 automated cell counter; Bio-Rad, Richmond, CA, USA). Animals Five-week-old female BALB/c mice were used as the animal model in all experiments. All animals in this study were purchased from Japan SLC (Shizuoka, Japan) and fed a commercial AIN-93G diet (LSG, Tokyo, Japan) throughout the study. All animals were maintained in an air-conditioned room (25°C) with a 12-hr light and dark cycle at the Kyoto Institute of Nutrition and Pathology (Kyoto, Japan). Food and water were provided ad libitum in all experiments. Handling of mice and experimentation humane endpoints in Experiments 1 and 2 were carried out in accordance with the guidelines for animal studies of the Kyoto Institute of Nutrition and Pathology. NK activity in ex vivo splenocytes from CPEF-administered mice (Experiment 1) After 7-days of acclimatisation, 50 mice were randomly and equally allocated into five groups as follows: CPEF free, sterile saline (group T10, control group); 0.2 mg of CPEF/kg BW/day (group T10.2); 1 mg of CPEF/kg BW/day (group T11); 2 mg of CPEF/kg BW/day (group T12); and 5 mg of CPEF/kg BW/day (group T15). Mouse groups were housed in separate plastic cages throughout the study. CPEF was suspended in sterile saline and given orally to mice with a commercial disposable feeding needle (Fuchigami, Kyoto, Japan) every day at 10 a.m. for 7 consecutive days (day 0–day 6). Upon completion of the CPEF administration period, all animals were euthanised by exsanguination under overdose anaesthesia with an intraperitoneal injection of sodium pentobarbital (Somnopentyl, Kyoritsu, Tokyo, Japan) and had their spleen aseptically collected. Splenocytes were prepared as previously described [9] with some modifications. Briefly, a single-cell suspension was prepared with HBSS, filtered through a 40-µm cell strainer (BD Biosciences, Bedford, MA, USA), and centrifuged at 800 × g for 3 min at room temperature (RT). After removal of the supernatant, cells were resuspended in ACK lysing buffer (0.5 mol/l NH4Cl, 10 mmol/l KHCO3 and 0.1 nmol/l Na2EDTA; pH 7.2) and incubated at RT for 10 min to remove erythrocytes. The remaining cells, i.e., splenocytes, were further washed twice with HBSS and resuspended in RPMI-1640 medium. Splenocytes were then stained with trypan blue and counted with the automated cell counter (TC10). As an NK activity assay (described below) is a labour-intensive activity, the start of CPEF administration to mice was carried out in stages as follows: day 1, three mice of each group (total: 15 mice); day 2, three mice of each group (total: 15 mice); and day 3, four mice of each group (total: 20 mice). Evaluation of natural killer cell activity The NK activity assay was carried out as previously described [33] with slight modifications. Briefly, splenocytes identified as NK effector cells were adjusted to 5 × 106 cells/ml of RPMI-1640 medium. A 100-µl aliquot of the splenocytes cell solution was inoculated into a 96-well flat-bottom culture plate (AGC Techno Glass, Shizuoka, Japan) and mixed with 100 µl of YAC-1 cells (T) as target cells to achieve NK effector cell/YAC-1 cell (E/T) ratios of 2:1 and 10:1. The mixture was incubated for 4 hr at 37°C in a humidified atmosphere (5% CO2). Two microliters of propidium iodide (PI; 2 mg/ml; Sigma-Aldrich Japan) was then added to each well to stain the dead cells. NK (or cytotoxic activity against Meth-A cells) activity was calculated using the following formula: NK activity (%) =[(killer T cells)–(natural dead T cells)][(maximum dead T cells) – (natural dead T cells)] × 100 Evaluation and confirmation of NK activity of splenocytes were carried out using a BD Accuri™ C6 flow cytometer (BD Bioscience Japan, Tokyo, Japan) following a previously reported method [4]. Experiments using the E/T ratios described above were carried out in duplicate. “Maximum dead T cells” were performed treating 3% saponin solution as described previously [4]. In Experiment 1, the NK activity assay was carried out using only six mice from each group because of YAC-1 cells were not in good condition of the final slaughter day. Measurement of gene expression To determine the mRNA expression associated with NK activity, the remaining splenocytes were immersed in RNA-later (Sigma). Immersed splenocytes were first stored overnight at 4°C and then were stored at −80°C until subsequent RNA extraction. Total RNA extraction and cDNA synthesis were carried out as previously described [34]. Real-time PCR was conducted using a Rotor-Gene 6200 (Qiagen, Tokyo, Japan). The primers and TaqMan probes associated with NK activity and used in this study are listed in Table 1Table 1. Primers and probes used in this study Gene name Primers or probes 5´-3´ Probe number GenBank accession number Granzyme A F ggccatctcttgctactctcc 75* NM_010370.2 R cgtgtctcctccaatgattct Granzyme B F gctgctcactgtgaaggaagt 2* NM_013542.2 R tggggaatgcattttaccat Perforin 1 F gaagaagaaacagcacaaaatgg 31* NM_011073.3 R gacgtgacgctcacggtag Interferon-γ F cagcaacagcaaggcgaa - NM_008337.1 R cggatgagctcattgaatgct P ttgccaagtttgaggtcaacaaccca Glyceraldehyde 3-phosphate dehydrogenase F ggtgtcttcaccaccatgga - NM_008084.2 (GAPDH) R cagaaggggcggagatgat P aaggccggggcccacttgaa *Listed probe numbers indicate the product number of the Universal ProbeLibrary Set (Human and Extension Set) sold by Roche Applied Science. Primers and probes of IFN-g and GAPDH were designed and synthesized by Bioresearch Technologies Japan (Tokyo, Japan). . Optimal primers and probes were designed using freely available online tools (https://www.roche-applied-science.com/) or selected from Bioresearch Technologies Japan (Tokyo, Japan). PCR analysis methods were conducted as previously described [34]. The relative expression levels of the mRNAs were calculated by the comparative Ct method [35]. In addition, the amount of target cells relative to housekeeping mRNA (glyceraldehyde 3-phosphate dehydrogenase; GAPDH) for each sample was calculated and treated as a ΔΔ Ct value. Survival rate of CPEF-administered mice after Meth-A inoculation (Experiment 2) Thirty mice were randomly and equally allocated into three groups and housed as described for Experiment 1. CPEF was given orally to mice every day at 10 a.m. for 47 consecutive days (day 0–day 46). Mice were orally given CPEF as follows: CPEF free, saline inoculation (group T20); 5 mg/kg BW/day (group T25); and 10 mg/kg BW/day (group T210). CPEF was administered in a manner similar to that in Experiment 1. On day 7, Meth-A was intraperitoneally injected into all mice (2.0 × 105 cells/head) to induce fibrosarcoma [36]. Clinical observations and measurement of body weight were carried out on mice twice daily. The humane endpoint was established to be a 20% body weight loss following Meth-A inoculation. The experiment was ended on day 46. Immunostimulation activity of CPEF under Meth-A inoculation conditions (Experiment 3) Twenty mice were randomly and equally divided into two groups and housed as described for Experiment 1. CPEF administration was carried out every day at 10 a.m. for 17 consecutive days (day 0–day 16). CPEF was given orally to mice as follows: CPEF free, saline inoculation (group T30), and 10 mg/kg BW/day (group T310). CPEF was administered in a manner similar to that in Experiment 1. On day 7, Meth-A cells were subcutaneously injected into all mice in the same concentrations as described above. Clinical observations and measurement of body weight were carried out on mice twice daily until study completion on day 17. Subsequently, all mice were euthanised by exsanguination under overdose anaesthesia with an intraperitoneal injection of sodium pentobarbital (Somnopentyl) and their spleen aseptically collected. The NK activity of splenocytes was determined as described for Experiment 1, except that the E/T ratios were 5:1 and 25:1. The cytotoxic activity of splenocytes against the Meth-A cells was also evaluated. The cytotoxic activity of splenocytes against Meth-A cells was determined as for the NK activity described for Experiment 1, except that Meth-A cells were used as the target cells. The CTL subpopulation was measured using fluorescently conjugated antibodies. The splenocytes were stained in triplicate with FITC-labelled anti-Mouse CD3 (TONBO Biosciences, San Diego, CA, USA), PerCP-Cy5.5-labelled anti-Mouse CD4 (TONBO Biosciences) and APC-labelled anti-Mouse CD8a (TONBO Biosciences) antibodies. They were also stained with four other antibodies, namely, PerCP-Cy5.5-labelled anti-Mouse CD4, APC-labelled anti-Mouse CD8a, PE-labelled anti-Mouse CD28 (Abcam, Cambridge, MA, USA), and FITC-labelled anti-Mouse CD69 (Abcam). After incubation with the antibodies at 4°C for 30 min, the cells were washed with PBS and fixed with 1% paraformaldehyde (Wako Pure Chemical Industries, Osaka, Japan) in PBS for 30 min. After fixation, the samples were washed with 0.5% bovine serum albumin (Nacalai Tesque, Kyoto, Japan) in PBS and incubated overnight at 4°C. Afterwards, the samples were analysed using a flow cytometer. Statistical analyses The randomised block design 1-way ANOVA was used to analyse the differences between means in the parameters of Experiment 1. Tukey-Kramer post hoc comparison was used for multiple comparisons when needed. Survival curves were drawn using the Kaplan-Meier method, and the differences compared with group T20 were analysed by a log-rank test in Experiment 2. Depending on the results of the F-test, either the Student’s or Welch’s t-test was used to analyse the differences between means in the parameters of Experiment 3. A difference between means was considered significant at p<0.05, and a tendency was considered to be significant at p≤0.1 in all statistical analyses. All calculations were made using Statcel3 (OMS, Tokyo, Japan) or StatLight 2000 (Yukms Co., Ltd., Tokyo, Japan), as add-in applications for Microsoft Excel® (Microsoft, Seattle, WA, USA). All values are given as the means ± SE. RESULTS NK activation in ex vivo splenocytes from CPEF-administered mice (Experiment 1) The results of dose-dependent stimulation of NK activity by CPEF administration are shown in Fig. 1Fig. 1. Relative values of splenocyte NK activity with or without CPEF administration in Experiment 1. The results shown are representative of an E/T ratio=2:1. Bars with different letters indicate significant differences at p<0.05. Values are means ± SE (n=6). . NK activity in splenocytes of mice given 5 mg/kg BW/day of CPEF was significantly (p<0.05) higher than it was in those of control mice and mice given only 0.2 mg/kg BW/day of CPEF (Fig. 1). Regarding the gene expression associated with NK activity, there was no difference in gene expression of granzyme B between groups (Fig. 2DFig. 2. Relative gene expression associated with NK activity in splenocytes with or without CPEF administration in Experiment 1. (A) Gene expression of IFN-γ. (B) Gene expression of granzyme A. (C) Gene expression of Perforin 1. (D) Gene expression of granzyme B. Bars with different letters indicate significant differences (p<0.05). A dagger indicates a tendency to be different compared with the T10 group (p<0.1). Values are means ± SE (n=10). ). However, there was a tendency (p<0.1) for the gene expression of granzyme A to be higher in mice given 2 mg/kg/day of CPEF when compared with control mice (Fig. 2B). Furthermore, the gene expression of Perforin 1 and gamma interferon (IFN-γ) was significantly (p<0.05) higher in mice given 5 mg/kg/day of CPEF, when compared with control mice (Fig. 2A, 2C), and control mice and mice given only 0.2 mg/kg BW/day of CPEF (Fig. 2C), respectively. Survival curves of CPEF-administered mice after Meth-A fibrosarcoma inoculation (Experiment 2) Figure 3Fig. 3. Survival curves of mice after Meth-A inoculation, with or without CPEF administration in Experiment 2. Open circles indicate T20 group mice. Open triangles indicate T25 group mice. Closed circles indicate T210 group mice. A dagger indicates a tendency to be different compared with the T20 group (p=0.1). shows the survival curves of Meth-A-inoculated mice with or without CPEF administration. Mice given orally 10 mg/kg/day of CPEF tended (p=0.10) to show improved survival (6 mice after 47 days) compared with control mice (2 mice after 47 days). Immunostimulation activity of CPEF under Meth-A inoculation conditions (Experiment 3) Administration of 10 mg/kg/day of CPEF triggered a higher NK activity in Meth-A-inoculated mice than it did in those mice not given CPEF (Fig. 4AFig. 4. Relative values of splenocyte NK and CTL activity with or without CPEF administration in Experiment 3. (A) Splenocyte NK activity. (B) Splenocyte CTL activity. The results shown are representative of an E/T ratio=25:1. Asterisks indicate significant differences at p<0.05. Values are means ± SE (n=10). ). In addition, cytotoxic activity against Meth-A cells in Meth-A-inoculated mice administered 10 mg/kg/day of CPEF was higher than it was in those not given CPEF (Fig. 4B). Separately, immunostaining of splenocytes showed that the CD4+/CD3+ and CD8+/CD3+ ratios in the T30 and T310 groups were not different (Fig. 5Fig. 5. Subpopulation ratios of CD4+ or CD8+ cells in T lymphocyte (CD3+ cells) with or without CPEF administration in Experiment 3. (A) The ratio of CD4+ cells in CD3+ cells in splenocytes. (B) The ratio of CD8+ cells in CD3+ cells in splenocytes. Values are means ± SE (n=10). ). However, when looking at the activity of CD4+ and CD8+ cells in the presence of CD28+ and/or CD69+, although the CD28+/CD4+ ratio showed a tendency to be higher in the T310 group than it did in the T30 group (Fig. 6CFig. 6. Subpopulation ratios of active T lymphocytes with or without CPEF administration in Experiment 3. (A) The ratio of CD28+ cells in CD4+ cells. (B) The ratio of CD28+ cells in CD8+ cells. (C) The ratio of CD69+ cells in CD4+ cells. (D) The ratio of CD69+ cells in CD8+ cells. (E) The ratio of CD28+CD69+ cells in CD4+ cells. (F) The ratio of CD28+CD69+ cells in CD8+ cells. Asterisks indicate significant differences (p<0.05). A dagger indicates a tendency to be different (p<0.1). Values are the means ± SE (n=10). ), other CD4+ or CD8+ ratios did not differ significantly between groups (Fig. 6D, 6F, and 6G). Nonetheless, the double positive CD28+CD69+/CD4+ and CD28+CD69+/CD8+ ratios were found to be remarkably higher in the T310 group than in the T30 group (Fig. 6E and 6H). DISCUSSION In the present study, we observed that an immune response identified by a strong NK activity (Figs. 1 and 4A) was triggered in mice orally given CPEF (5 or 10 mg/kg BW/day) compared with those that were not. This result is in accordance with previous studies at these premises, where we demonstrated that a different E. faecalis strain induced an immune response in gut-associated [7, 8] and systemic [9, 10] lymphoid tissues. Elsewhere, researchers have also shown the immunostimulatory properties of E. faecalis strains, including activation of dendritic cells and interferon-γ production [37] and cytokine production in human peripheral blood mononuclear cells [38]. In addition, we found that although gene expression of granzyme A and B in splenocytes was not affected significantly by CPEF administration, gene expression of IFN-γ and Perforin 1 was stimulated only in splenocytes of mice in the T15 group in Experiment 1 (Fig. 2A and 2C). Furthermore, we observed that CPEF administration (10 mg/kg BW/day) stimulated cytotoxic activity including NK and CTL activity against Meth-A in Experiment 3 (Fig. 4). CTL releases Perforin 1, which facilitates the entry of granzyme B into the cytoplasma of target cells and cause apoptosis [39]. On the other hands, granzyme B expression was not stimulated in this study, so the Perforin/granzyme pathway might not be cascaded by CPEF administration. Another heat-killed LAB induced NK cytotoxicity without Perforin and granzymes upregulation [40], so CPEF might be also stimulated NK activity in a similar approach. CPEF administration (10 mg/kg BW/day) activated NK cells and CTLs in Meth-A bearing mice (Fig. 4), which in turn induced production of IFN-γ [41]. IFN-γ is a primary cytokine in the immune response to pathogens and malignancies [41]. We therefore theorised that an enhanced synergetic activity of IFN-γ and Perforin 1 was essential for CTLs to recognize infected cells following inoculation of Meth-A into mice, which tended to improve (p=0.10) twofold the survival of mice at 45 days and beyond (Fig. 3). To confirm this, in the presence of CD28+CD69+ as an accessory cell, we measured the percentage of active T cells, which showed that administration of CPEF induced proliferation of CD4+ and CD8+ cells among lymphocytes in CPEF-administered mice but not in control mice (Figs. 5 and 6). Clearly, our work showed that administration of E. faecalis to mice induced a significant production of IFN-γ not only by CTLs but also by activation of NK cells, which are its predominant producers [42]. Induction of IFN-γ production by CTLs and NK cells may have been similar to that exerted by interleukin-12 [43]. It is well known that many E. faecalis strains stimulate IL-12 production in murine splenocytes in vitro [44]. The E. faecalis KH-2 used in this study also stimulates IL-12 production in murine splenocytes (Kan et al. unpublished data) and the mechanism of activation of CTLs and NK cells may have been stimulation of IL-12 production as a results of CPEF administration in the present study. Furthermore, Inoue et al. and Nishibayashi et al. [44, 45] suggested that the major active component of E. faecalis is RNA, and we also considered in the present study that the E. faecalis KH2 might have stimulated the immune function caused by bacterial RNA. Interestingly, previous work found that upon stimulation by administration of Lactobacillus johnsonii and L. sakei, IFN-γ production by NK cells was induced in the presence of activated antigen CD69+ but that a CD8+ response was not activated [43], whilst others [46] showed that L. casei promoted IFN-γ production by CD8+ CTLs but not NK cells. This apparent discrepancy between studies may be related to the dependence of immune cell activation on the presence of accessory cells such as CD69+ [43, 47], which is in accordance with our results (Fig. 6). Moreover, LAB strains seem to respond differentially to the type of cells used as experimental models [3], and it is increasingly evident that the immune response level and identity of the immune cells involved depend on the strain itself [4,5,6, 9, 48,49,50,51] and cannot be extrapolated to other strains [52]. It is worth noting that in comparison with single positive (CD28+ or CD69+) cells, double positive (CD28+CD69+) cells developed remarkably as a result of CPEF administration in CD4+ and CD8+ cells in splenocytes of Meth-A bearing mice (Fig. 6). We found no significant differences in the CD4+ and CD8+ cell ratios (Figs. 5 and 6) upon administration of a probiotic such as CPEF, as reported previously by other researchers [53, 54]. Nonetheless, to the best of our knowledge, the present work is the first to report significant differences in double positive CD28+CD69+ cells after administration of CPEF to Meth-A fibrosarcoma-bearing mice (Fig. 6), although the precise role of these double positive cells remains unclear. We hypothesise that CD28+CD69+ cells may play a key role in suppression of tumour development, but further evidence is needed to establish their exact role within the immune response context. Although immune cells such as NK cells and CTLs are capable of killing tumours or blocking their growth [14, 17, 18], certain tumours such as sarcomas show persistence due to a tremendous resistance to treatments [26]. As a result, these tumours recur in approximately 40–60% of patients, and 50% will die of metastases [55]. However, recent applications of bacterial strains with probiotic properties as immunotherapy for induction of antitumour activity, which improves the survival rate of experimental models, have shown very promising results [56, 57]. For example, a previous study reported that at least a fraction of the lipoteichoic acid in cell walls of Enterococcus sp. caused complete regression of Meth-A tumours in mice by inducing strong cytokine activity [51]. In this study, the survival rate under the Meth-A-inoculated condition tended to be improved by administration of 10 mg/kg BW/day of CPEF (Experiment 2), so a possible activity against tumour development might have been observed. This point needs further elucidation. In the present study, we successfully demonstrated that administration of 10 mg/kg BW/day of CPEF as a probiotic treatment in mice induced strong activity in immune cells including CTLs and NK cells that resulted in the survival rate of these animals being twofold that of those not given the CPEF treatment. We also report that although the precise role of double positive cells remains unknown, significant differences in CD28+CD69+/CD4+ and CD28+CD69+/CD8+ ratios were remarkably high in CPEF-administered mice. Based on the present results, it is proposed that oral administration of CPEF might be used to help prevent tumour development in humans via systemic stimulation of NK and CTL activities. The authors would like to thank Dr. Ryo Inoue of Kyoto Prefectural University for his kind advice regarding the flow cytometry analysis in Experiments 1 and 3. In addition, the authors would like to thank Drs. Tsuyoshi Tsuruta and Noriko Matsukawa and Mr. Takahiro Kawase at the Kyoto Institute of Nutrition and Pathology for their technical assistance. ==== Refs REFERENCES 1 Mazmanian SK Kasper DL 2006 The love-hate relationship between bacterial polysaccharides and the host immune system . Nat Rev Immunol 6 : 849 –858 . 17024229 2 Corthésy B Gaskins HR Mercenier A 2007 Cross-talk between probiotic bacteria and the host immune system . J Nutr 137 Suppl 2 : 781S –790S . 17311975 3 Fink LN Zeuthen LH Ferlazzo G Frøkiaer H 2007 Human antigen-presenting cells respond differently to gut-derived probiotic bacteria but mediate similar strain-dependent NK and T cell activation . FEMS Immunol Med Microbiol 51 : 535 –546 . 17903206 4 Gill HS Rutherfurd KJ Prasad J Gopal PK 2000 Enhancement of natural and acquired immunity by Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) . Br J Nutr 83 : 167 –176 . 10743496 5 Hori T Kiyoshima J Yasui H 2003 Effect of an oral administration of Lactobacillus casei strain Shirota on the natural killer activity of blood mononuclear cells in aged mice . Biosci Biotechnol Biochem 67 : 420 –422 . 12729012 6 Akao Y Ebihara T Masuda H Saeki Y Akazawa T Hazeki K Hazeki O Matsumoto M Seya T 2009 Enhancement of antitumor natural killer cell activation by orally administered Spirulina extract in mice . Cancer Sci 100 : 1494 –1501 . 19432881 7 Inoue R Tsukahara T Matsukawa N Watanabe T Bukawa W Nakayama K Ushida K 2013 Rapid induction of an immune response in rat Peyer’s patch after oral administration of Enterococcus faecalis strain EC-12 . Biosci Biotechnol Biochem 77 : 863 –866 . 23563541 8 Ushida K Yoshida Y Tsukahara T Watanabe T Inoue R 2010 Oral administration of Enterococcus faecalis EC-12 cell preparation improves villous atrophy after weaning through enhancement of growth factor expression in mice . Biomed Res 31 : 191 –198 . 20622469 9 Tsuruta T Inoue R Tsushima T Watanabe T Tsukahara T Ushida K 2013 Oral administration of EC-12 increases the baseline gene expression of antiviral cytokine genes, IFN-γ and TNF-α, in splenocytes and mesenteric lymph node cells of weaning piglets . Biosci Microbiota Food Health 32 : 123 –128 . 24936371 10 Yoshikawa T Inoue R Yoshida Y Watanabe T Bukawa W Ushida K 2009 Diverse immune responses to orally administered heat-killed cell preparation of Enterococcus faecalis strain EC-12 in murine immune tissues . Biosci Biotechnol Biochem 73 : 1439 –1442 . 19502756 11 Donson AM Foreman NK 2012 Emerging evidence of anti-tumor immune control in the central nervous system . Oncoimmunology 1 : 1648 –1649 . 23264924 12 Fridman WH Pagès F Sautès-Fridman C Galon J 2012 The immune contexture in human tumours: impact on clinical outcome . Nat Rev Cancer 12 : 298 –306 . 22419253 13 Grivennikov SI Greten FR Karin M 2010 Immunity, inflammation, and cancer . Cell 140 : 883 –899 . 20303878 14 O’Sullivan T Saddawi-Konefka R Vermi W Koebel CM Arthur C White JM Uppaluri R Andrews DM Ngiow SF Teng MWL Smyth MJ Schreiber RD Bui JD 2012 Cancer immunoediting by the innate immune system in the absence of adaptive immunity . J Exp Med 209 : 1869 –1882 . 22927549 15 Choi Y Lee HW Lee J Jeon YH 2013 The combination of ANT2 shRNA and hNIS radioiodine gene therapy increases CTL cytotoxic activity through the phenotypic modulation of cancer cells: combination treatment with ANT2 shRNA and I-131 . BMC Cancer 13 : 143 . 23522027 16 Mallick A Barik S Goswami KK Banerjee S Ghosh S Sarkar K Bose A Baral R 2013 Neem leaf glycoprotein activates CD8+ T cells to promote therapeutic anti-tumor immunity inhibiting the growth of mouse sarcoma . PLoS One 8 : e47434 . 23326300 17 Breart B Lemaître F Celli S Bousso P 2008 Two-photon imaging of intratumoral CD8+ T cell cytotoxic activity during adoptive T cell therapy in mice . J Clin Invest 118 : 1390 –1397 . 18357341 18 Youlin K Li Z Xin G Mingchao X Xiuheng L Xiaodong W 2013 Enhanced function of cytotoxic T lymphocytes induced by dendritic cells modified with truncated PSMA and 4-1BBL . Hum Vaccin Immunother 9 : 766 –772 . 23295983 19 Sconocchia G Eppenberger S Spagnoli GC Tornillo L Droeser R Caratelli S Ferrelli F Coppola A Arriga R Lauro D Iezzi G Terracciano L Ferrone S 2014 NK cells and T cells cooperate during the clinical course of colorectal cancer . Oncoimmunology 3 : e952197 . 25610741 20 Dunn GP Old LJ Schreiber RD 2004 The immunobiology of cancer immunosurveillance and immunoediting . Immunity 21 : 137 –148 . 15308095 21 Shankaran V Ikeda H Bruce AT White JM Swanson PE Old LJ Schreiber RD 2001 IFNgamma and lymphocytes prevent primary tumour development and shape tumour immunogenicity . Nature 410 : 1107 –1111 . 11323675 22 Wu X Peng M Huang B Zhang H Wang H Huang B Xue Z Zhang L Da Y Yang D Yao Z Zhang R 2013 Immune microenvironment profiles of tumor immune equilibrium and immune escape states of mouse sarcoma . Cancer Lett 340 : 124 –133 . 23920127 23 Vesely MD Kershaw MH Schreiber RD Smyth MJ 2011 Natural innate and adaptive immunity to cancer . Annu Rev Immunol 29 : 235 –271 . 21219185 24 Schneckenleithner C Bago-Horvath Z Dolznig H Neugebauer N Kollmann K Kolbe T Decker T Kerjaschki D Wagner KU Müller M Stoiber D Sexl V 2011 Putting the brakes on mammary tumorigenesis: loss of STAT1 predisposes to intraepithelial neoplasias . Oncotarget 2 : 1043 –1054 . 22185785 25 Zhang QB Sun HC Zhang KZ Jia QA Bu Y Wang M Chai ZT Zhang QB Wang WQ Kong LQ Zhu XD Lu L Wu WZ Wang L Tang ZY 2013 Suppression of natural killer cells by sorafenib contributes to prometastatic effects in hepatocellular carcinoma . PLoS One 8 : e55945 . 23409093 26 Taylor BS Barretina J Maki RG Antonescu CR Singer S Ladanyi M 2011 Advances in sarcoma genomics and new therapeutic targets . Nat Rev Cancer 11 : 541 –557 . 21753790 27 Kaklij GS Kelkar SM Shenoy MA Sainis KB 1991 Antitumor activity of Streptococcus thermophilus against fibrosarcoma: role of T-cells . Cancer Lett 56 : 37 –43 . 2004352 28 Kelkar SM Shenoy MA Kaklij GS 1988 Antitumor activity of lactic acid bacteria on a solid fibrosarcoma, sarcoma-180 and Ehrlich ascites carcinoma . Cancer Lett 42 : 73 –77 . 3141041 29 Alshaker HA Qinna NA Qadan F Bustami M Matalka KZ 2011 Eriobotrya japonica hydrophilic extract modulates cytokines in normal tissues, in the tumor of Meth-A-fibrosarcoma bearing mice, and enhances their survival time . BMC Complement Altern Med 11 : 9 . 21294856 30 Matsumoto N Aze Y Akimoto A Fujita T 1997 Restoration of immune responses in tumor-bearing mice by ONO-4007, an antitumor lipid A derivative . Immunopharmacology 36 : 69 –78 . 9129998 31 Seki T Maeda H 2010 Cancer preventive effect of Kumaizasa bamboo leaf extracts administered prior to carcinogenesis or cancer inoculation . Anticancer Res 30 : 111 –118 . 20150624 32 Piriou L Chilmonczyk S Genetet N Albina E 2000 Design of a flow cytometric assay for the determination of natural killer and cytotoxic T-lymphocyte activity in human and in different animal species . Cytometry 41 : 289 –297 . 11084614 33 Romero-Pérez GA Egashira M Harada Y Tsuruta T Oda Y Ueda F Tsukahara T Tsukamoto Y Inoue R 2016 Orally administered Salacia reticulata extract reduces H1N1 influenza clinical symptoms in murine lung tissues putatively due to enhanced natural killer cell activity . Front Immunol 7 : 115 . 27066007 34 Toyoda A Iio W Goto T Koike H Tsukahara T 2014 Differential expression of genes encoding neurotrophic factors and their receptors along the septal-temporal axis of the rat hippocampus . Anim Sci J 85 : 986 –993 . 25185865 35 Nishimura M Ueda N Naito S 2003 Effects of dimethyl sulfoxide on the gene induction of cytochrome P450 isoforms, UGT-dependent glucuronosyl transferase isoforms, and ABCB1 in primary culture of human hepatocytes . Biol Pharm Bull 26 : 1052 –1056 . 12843640 36 Hirakawa N Naka T Yamamoto I Fukuda T Tsuneyoshi M 1996 Overexpression of bcl-2 protein in synovial sarcoma: a comparative study of other soft tissue spindle cell sarcomas and an additional analysis by fluorescence in situ hybridization . Hum Pathol 27 : 1060 –1065 . 8892591 37 Molina MA Díaz AM Hesse C Ginter W Gentilini MV Nuñez GG Canellada AM Sparwasser T Berod L Castro MS Manghi MA 2015 Immunostimulatory effects triggered by Enterococcus faecalis CECT7121 probiotic strain involve activation of dendritic cells and interferon-gamma production . PLoS One 10 : e0127262 . 25978357 38 Sparo M Delpech G Batisttelli S Basualdo JÁ 2014 Immunomodulatory properties of cell wall extract from Enterococcus faecalis CECT7121 . Braz J Infect Dis 18 : 551 –555 . 24907474 39 Thiery J Keefe D Boulant S Boucrot E Walch M Martinvalet D Goping IS Bleackley RC Kirchhausen T Lieberman J 2011 Perforin pores in the endosomal membrane trigger the release of endocytosed granzyme B into the cytosol of target cells . Nat Immunol 12 : 770 –777 . 21685908 40 Cheon S Lee KW Kim KE Park JK Park S Kim CH Kim D Lee HJ Cho D 2011 Heat-killed Lactobacillus acidophilus La205 enhances NK cell cytotoxicity through increased granule exocytosis . Immunol Lett 136 : 171 –176 . 21256158 41 de Araújo-Souza PS Hanschke SCH Viola JPB 2015 Epigenetic control of interferon-gamma expression in CD8 T cells . J Immunol Res 2015 : 849573 . 25973438 42 Komita H Homma S Saotome H Zeniya M Ohno T Toda G 2006 Interferon-gamma produced by interleukin-12-activated tumor infiltrating CD8+T cells directly induces apoptosis of mouse hepatocellular carcinoma . J Hepatol 45 : 662 –672 . 16935390 43 Haller D Blum S Bode C Hammes WP Schiffrin EJ 2000 Activation of human peripheral blood mononuclear cells by nonpathogenic bacteria in vitro: evidence of NK cells as primary targets . Infect Immun 68 : 752 –759 . 10639443 44 Inoue R Nagino T Hoshino G Ushida K 2011 Nucleic acids of Enterococcus faecalis strain EC-12 are potent Toll-like receptor 7 and 9 ligands inducing interleukin-12 production from murine splenocytes and murine macrophage cell line J774.1 . FEMS Immunol Med Microbiol 61 : 94 –102 . 21073545 45 Nishibayashi R Inoue R Harada Y Watanabe T Makioka Y Ushida K 2015 RNA of Enterococcus faecalis strain EC-12 is a major component inducing Interleukin-12 production from human monocytic cells . PLoS One 10 : e0129806 . 26083838 46 Shida K Suzuki T Kiyoshima-Shibata J Shimada S Nanno M 2006 Essential roles of monocytes in stimulating human peripheral blood mononuclear cells with Lactobacillus casei to produce cytokines and augment natural killer cell activity . Clin Vaccine Immunol 13 : 997 –1003 . 16960110 47 Craston R Koh M Mc Dermott A Ray N Prentice HG Lowdell MW 1997 Temporal dynamics of CD69 expression on lymphoid cells . J Immunol Methods 209 : 37 –45 . 9448032 48 Filion MC Lépicier P Morales A Phillips NC 1999 Mycobacterium phlei cell wall complex directly induces apoptosis in human bladder cancer cells . Br J Cancer 79 : 229 –235 . 9888462 49 Kosaka A Yan H Ohashi S Gotoh Y Sato A Tsutsui H Kaisho T Toda T Tsuji NM 2012 Lactococcus lactis subsp. cremoris FC triggers IFN-γ production from NK and T cells via IL-12 and IL-18 . Int Immunopharmacol 14 : 729 –733 . 23102661 50 Sekine K Ohta J Onishi M Tatsuki T Shimokawa Y Toida T Kawashima T Hashimoto Y 1995 Analysis of antitumor properties of effector cells stimulated with a cell wall preparation (WPG) of Bifidobacterium infantis . Biol Pharm Bull 18 : 148 –153 . 7537575 51 Takada H Kawabata Y Arakaki R Kusumoto S Fukase K Suda Y Yoshimura T Kokeguchi S Kato K Komuro T 1995 Molecular and structural requirements of a lipoteichoic acid from Enterococcus hirae ATCC 9790 for cytokine-inducing, antitumor, and antigenic activities . Infect Immun 63 : 57 –65 . 7806384 52 Medina M Izquierdo E Ennahar S Sanz Y 2007 Differential immunomodulatory properties of Bifidobacterium logum strains: relevance to probiotic selection and clinical applications . Clin Exp Immunol 150 : 531 –538 . 17956582 53 Scharek L Guth J Reiter K Weyrauch KD Taras D Schwerk P Schierack P Schmidt MFG Wieler LH Tedin K 2005 Influence of a probiotic Enterococcus faecium strain on development of the immune system of sows and piglets . Vet Immunol Immunopathol 105 : 151 –161 . 15797484 54 Scharek L Altherr BJ Tölke C Schmidt MFG 2007 Influence of the probiotic Bacillus cereus var. toyoi on the intestinal immunity of piglets . Vet Immunol Immunopathol 120 : 136 –147 . 17870185 55 Rutkowski MR Conejo-Garcia JR 2015 Size does not matter: commensal microorganisms forge tumor-promoting inflammation and anti-tumor immunity . Oncoscience 2 : 239 –246 . 25897427 56 Lee JW Shin JG Kim EH Kang HE Yim IB Kim JY Joo HG Woo HJ 2004 Immunomodulatory and antitumor effects in vivo by the cytoplasmic fraction of Lactobacillus casei and Bifidobacterium longum . J Vet Sci 5 : 41 –48 . 15028884 57 Seow SW Cai S Rahmat JN Bay BH Lee YK Chan YH Mahendran R 2010 Lactobacillus rhamnosus GG induces tumor regression in mice bearing orthotopic bladder tumors . Cancer Sci 101 : 751 –758 . 20015287