==== Front HeliyonHeliyonHeliyon2405-8440Elsevier S2405-8440(17)33342-X10.1016/j.heliyon.2018.e00662e00662ArticleThe impact of photofunctionalized gold nanoparticles on osseointegration Elkhidir Yassir Lai Renfa Feng Zhiqiang 2377615699@qq.com∗Implant Department – Suihua, The First Affiliated Stomatological Hospital of Jinan University, PR China∗ Corresponding author. 2377615699@qq.com24 7 2018 7 2018 24 7 2018 4 7 e006627 11 2017 10 1 2018 18 6 2018 © 2018 Published by Elsevier Ltd.2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Objectives The aims of this study were to create a new surface topography using simulated body fluids (SBF) and Gold Nanoparticles (GNPs) and then to assess the influence of UV Photofunctionalization (PhF) on the osteogenic capacity of these surfaces. Materials and methods Titanium plates were divided into six groups All were acid etched with 67% Sulfuric acid, 4 were immersed in SBF and 2 of these were treated with 10 nm GNPs. Half of the TiO2 plates were photofunctionalized to be compared with the non-PhF ones. Rat's bone marrow stem cells were seeded into the plates and then CCK8 assay, cell viability assay, immunofluorescence, and Scanning electron microscopy (SEM) were done after 24 hours. Gene expression analysis was done using real time quantitative PCR (qPCR) one week later to check for the mRNA expression of Collagen-1, Osteopontin and Osteocalcin. Alkaline phosphatase (ALP) activity was assessed after 2 weeks of cell seeding. Results Our new topography has shown remarkable osteogenic potential. The new surface was the most biocompatible, and the 10 nm GNPs did not show any cytotoxicity. There was a significant increase in bioactivity, enhanced gene expressions and ALP activity. Conclusions GNPs enhances osteogenic differentiation of stem cells and Photofunctionalizing GNPs highly increases this. We have further created a novel highly efficient topography which highly enhances the speed and extent of osseointegration. This may have great potential for improving treatment outcomes for implant, maxillofacial as well as orthopedic patients. Keywords NanotechnologyBiomedical engineeringDentistry ==== Body 1 Introduction Titanium has become the material of choice in many treatment modalities in the dental field [1]. For dental implants, osseointegration (OI) of bone to the implant surface is considered the major criteria of implant's treatment success [2, 3, 4, 5]. Titanium has a high osseointegrative capacity compared to other biomaterials. It can achieve high levels of bone anchorage due to their biocompatibility and excellent mechanical properties, and extensive research has been done to enhance these surface properties. In this study, we combine some of the most recent trends of titanium surface modifications to assess their effect on the OI process. 1.1 Photofunctionalization Although titanium is the most biocompatible and the most clinically used alloy for orthopedic and dental implants, it was found to be subjected to “biological ageing” in which they encounter time-related degradation of their bioactivity leading to a decrease in their osteoconductivity over time [6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24]. One of the approaches that have been done to overcome this issue was Photofunctionalization (PhF), a concept described by Takahiro Ogawa [11] in which he used ultraviolet light to alter the physiochemical properties of titanium surfaces and increase the bone-implant contact (BIC) to almost 100%, a phenomenon termed “Superosseointegration”. Ultraviolet application to titanium surfaces was shown to effectively reverse the ageing process of titanium caused by the deposition of hydrocarbon on its surface. It also restored the surface charge back to positive and remarkably increased the hydrophilicity of the surface. On the molecular level, protein absorption, and osteoblastic function becomes highly enhanced leading to an almost ideal surface contact, and therefore better primary stability and substantial therapeutic significance. Photofunctionalization have shown to decreases morbidity and improves treatment outcome by highly increasing the Bone-implant contact leading to a 3-fold increase in the strength of primary stability. It therefore allows for a quicker loading protocol and a decreased overall treatment time. It also permits the use of shorter and smaller implants in complex cases without compromising the success rate [17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68]. Photofunctionalization resulted in similar effects when applied on other alloys as well as non-alloy materials such as zirconium, opening possibilities to further research applications in the field of dental materials. Moreover, this new technology has been applied with different other surface modification techniques such as nanotechnology and stem cell tissue engineering and has shown promising results [32, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97]. 1.2 Gold nanoparticles (GNPs) The unique physical and chemical properties and the high biocompatibility of Gold nanoparticles (GNPs) have made them highly attractive for the use in different medical fields such as targeted gene and drug delivery, diagnostics as well as tissue engineering research [98, 99, 100, 101, 102, 103, 104]. Cellular uptake of GNPs causes them to bind to cytoplasmic proteins and act as osteogenic agents to enhance bone tissue regeneration [105]. Following cellular endocytosis [106, 107], GNPs act as a mechanical stimuli and lead to activation of the p38 mitogen-activated protein kinase signaling pathway (MAPK) which up-regulates the transcription factor (Runx-2) in the nucleus. Runx-2 is the main gene responsible for directing and enhancing osteogenic differentiation of mesenchymal stem cells into osteoprogenitor cells. It induces the expression of other osteoblastic specific genes such as Osteopontin (OPN), Osteocalcin (OCN) and Collagen type I, alpha 1(Col-1) [108, 109, 110, 111] (Fig. 1).Fig. 1 Endocytosis of GNPs causes them to activate the p38 MAPK pathway which stimulates of the Runx-2 gene leading to osteogenic differentiation. Fig. 1 Previous studies have shown that beside these osteogenic capabilities, GNPs also inhibit osteoclast formation [112] as well as adipogenic differentiation [113]. GNPs can therefore be very useful if it is applied on titanium surfaces as a method of surface modification as it can stimulate bone formation and hence, faster implant osseointegration and better primary stability [75]. One recent study found that 28 nm sized GNPs enhances osteogenic differentiation of Adipose Derived Stem Cells and increases the expression of specific markers related to osseous growth. These concluded that these findings suggested that Titanium-GNP (Ti-GNP) have an increased osteoconductive capabilities [114]. Nevertheless, Others have found that the smaller the size of GNPs, the more significant impact on osteogenic differentiation [115]. In this study, 10 nm diameter spherical GNPs were used in order to assess whether this size will promote more osteogenic differentiation than those previously mentioned in the literature. 1.3 Simulated body fluid (SBF) In order to bond to living bone, it is essential for any biomaterial to form a biomimetic bone-like apatite on the material surface. Simulated body fluid (SBF) is a solution which has an ion concentration close to that found in human blood plasma [116, 117]. The precipitation of calcium and phosphate ions found in SBF causes spontaneous growth of apatite with a similar molecular structure to bone on the surface of biomaterials. Different materials have been immersed in SBF, and it was shown that their in vitro bone bioactivity could be predicted by the extent of resulting apatite formation [118]. Several studies have reported that SBF application on titanium leads to biomimetic deposition of apatite crystals on their surfaces [119, 120, 121]; this formed hydroxyapatite layer highly increases the osteoconductivity of titanium surface and hence, improves the osseointegration process [122, 123]. In our study, we have used SBF alone and with gold nanoparticles and with or without UV light application to assess the extent of tissue growth on the titanium plates. 1.4 Mesenchymal stem cells (MSCs) Stem cells are promising tools in tissue engineering; they are characterised by their ability of self-renewal and their potential to differentiate into various cell lineages from the three germ layers. Mesenchymal stem cells (MSCs) are multipotent cells and have the potential to differentiate into mesodermal cells to form bone, cartilage, skeletal muscles or adipose tissue [124, 125] This process of differentiation is a basic step in promoting regeneration [126]. The abundance of MSCs at the site of bone injury and their ability to suppress the immune response and stimulate bone regeneration [127] makes these cells very influential in the process of osseointegration. The bone marrow contains a considerable population of MSCs capable of differentiating into bone. The differentiation of these cells into osteogenic progenitor cells can be influenced by many factors [128, 129]. In this in vivo study, we have used rat's bone marrow stem cells (rBMSCs) to evaluate the growth of MSCs on different titanium surface treatment modalities. Cellular differentiation was evaluated by the expression of col-1, OPN and OCN as well as the expression of the Alkaline phosphatase (ALP) activity of the cells. 2 Materials and methods 2.1 Experiment outline The objective of this study was to assess the cell growth of mesenchymal stem cells (MSCs) obtained from rat's bone marrow stem cells on the surface of titanium (TiO2) in different conditions. SBF, GNPs and UV PhF were applied to the TiO2 plates. The main outline of the experiment consisted of six groups of titanium plates, each group has a different modification modality. The groups were named 1A, 2A, 3A, 1B, 2B and 3B. Their surface characteristics were prepared as the following (Fig. 2):Group A: 1- (TiO2 + MSCs), 2- (TiO2 + MSCs + SBF), 3- (TiO2 + MSCs + SBF + GNPs) Group B: 1- (TiO2 + MSCs + PhF), 2- (TiO2 + MSCs + SBF + Ph)F, 3- (TiO2 + MSCs + SBF + GNPs + PhF) Fig. 2 TiO2 discs were grouped as follows: 1. MSCs, 2. MSCs and SBF, 3. MSC, SBF and GNPs, A. Non-photofunctionalized group, B. Photofunctionalized group. Fig. 2 2.2 Processing methods Commercially pure (99.7%) Titanium grade 4 disks (20*20 mm, 1.5 mm thickness) were obtained (Baoji Rare Titanium Nickel co, Guangzhou, P.R. China). The sequence of processing was acid etching for 30 minutes, SBF for 24 hours, PhF for 48 hours, GNPs for 24 hours, followed by MSCs application on the TiO2 plates to evaluate their osteogenic differentiation and growth. 2.2.1 Acid etching All titanium plates were sterilized using a regular autoclave, and then acid-etched with 67% Sulfuric acid (H2SO4) at 120 °C for 30 minutes. All plates were then disinfected, washed twice with distilled water and then put into the 6 well cell culture plate. 2.2.2 Photofunctionalization Group B titanium plates were photofunctionalized by closely exposing them to UV light for 48 hours in a dark box using a 15 W bactericidal lamp; (Toshiba, Tokyo, Japan) with a combined peak intensity of 0.05 mW/cm2 (λ = 360 ± 20 nm) and 2 mW/cm2 (λ = 250 ± 20 nm). 2.2.3 Biomimetic hydroxyapatite deposition and characterization Simulated Body Fluids from Beijing LEAGENE Biotechnology Co., Ltd (CZ0400), was prepared to mimic the ion concentrations found in human plasma. Titanium plates in groups 2A, 3A, 2B and 3B were soaked in SBF (pH 7.40) at 37 °C for 24 hours prior to the experiment. The disks were then removed and gently washed three times in distilled water for 30 seconds and then air-dried on a clean bench. Surface morphology was then assessed using scanning electron microscopy (SEM). 2.2.4 Titanium plates preparation TiO2 plates from groups 3A and 3B were immersed in hexane acetone, ethanol and deionized water. They were then ultrasonically cleaned for 15 minutes, dried with nitrogen, soaked in sodium hydroxide solution for 24 hours, washed thoroughly with deionized water and ultrasonically cleaned again. TiO2 plates were then immersed in toluene solution containing 2% MPTPs at 60 °C for 24 hours, disinfected with ethanol, washed with deionized water and dried with nitrogen. Finally, the plates were immersed in 10 nm GNP solution from Shanghai carboxene biopharmaceutical Technology Co., Ltd (Au01002) at 37 °C for 24 hours, thoroughly cleaned with deionized water and then put into the 6-well plate. 2.2.5 Rat bone marrow stem cells (rBMSCs) isolation and culture All procedures employed in this study involving animals and their care were conducted in accordance to the National Institutes of Health guidelines (NIH Publication No. 85–23, revised 1996) and were approved by the Wuhan University Animal Care and Use Committee. 2.2.5.1 Isolation Healthy 6–8 week old Sprague Dawley (SD) rats (4 SPF) were purchased from animal experimental center of Zhongnan Hospital of Wuhan University; L-DMEM medium (Dulbecco's Modified Eagle's medium), fetal bovine serum, trypsin, penicillin and streptomycin from (Procell); 100 mm plastic cell culture dishes from (Corning, USA); Inverted phase contrast microscope from (Olympus, Japan). SD rats anesthetized with 10% chloral hydrate. 75% ethanol disinfection was done for 10 minutes twice and both lower limbs and lower abdominal area were cut with sterile scissors. Lower limb skin was cut. Legs, thighs, thigh muscle and bone were removed. Femur was exposed and hip joint and knee joint were cut. Then the bilateral femur and tibia were removed under sterile conditions, followed by the bone surface muscle and periosteum. Femur and tibia were separated into a sterile petri dish and sterilized by flushing the bone three times with a sterile solution containing 5% PBS penicillin and streptomycin, and 1% mycillin. Washing was repeated by soaking in large 50 ml centrifuge tube. When the liquid was completely soaked the bones, rongeur metaphysis was applied, using a needle pulling 5 ml culture system (L-DMEM medium +100 U/mL penicillin and streptomycin + 2 mML- glutamine + 7.5% NaHCO3 + 10% FBS). Bone marrow was isolated, percussion with pipettes, made into single cell suspension adding PBS at 1600 rpm for 5 min followed by centrifugal elutriation twice. The density gradient centrifugation isolated the cell suspension in a L-DMEM1:5 dilution. Lymphocytes of rats were placed in a separate volume Liquid. The liquid layered Percoll (density 1.073 g/mL), placed in the centrifuge at 1600 r/min for 15 min. A ring with a middle brown cloudy layer of cells (mononuclear cell layer) were formed. It was washed with PBS twice, centrifuged for 10 min at 1600 r/min, supernatant was discarded, and then 10 mL L-DMEM medium was added into a single cell suspension and then inoculated in 100 mm cell culture dish at 37 °C and 5% CO2 hatch. 2.2.5.2 Cell culture Following 48 h of primary culture, the medium was replaced by a fresh medium. Then the cells were covered with the bottom of the culture bottle and they were fused into a single layer. The density of the cells was 70%–80%. Cell passaging was carried out with the ratio of 1:2. Cells where seeded on all titanium plates. MEM- alpha was added to 10 % FBS and 1% Penicillin-Streptomycin Solution. When the cell density reached 80%, the cells were passaged. The culture medium was then discarded and washed with PBS and 1–2 ml 0.25% trypsin. Separation of cells was observed under the microscope till they became rounded indicating complete digestion. Pancreatin was discarded and the cells were put into a single cell suspension and then passaged according to the ratio of 1:3 at 37 °C and 5% CO2 in saturated humidity conditions to expand cultivation. Light microscopy was used to assess proliferation. 2.3 Tests 2.3.1 CCK8 test and spectrophotometry The cell counting kit (CCK-8) was performed to determine the extent of the MSCs viability after 24 hours of cell culture with the different TiO2 modification modalities. Following one day of incubation the absorbance on bare titanium with no modification (1A) was fixed at 100% as a control and spectrophotometry was done. The optical density (OD) of all groups were compared to 1A. Cell counting kit (CCK8) was applied to each well by adding of 300 ml of the solution for 4 h, and then another 100 ul was added to each of the 5 holes in every group of titanium plates. The mortality rate was measured in each hole by OD450 standard enzyme. spectrophotometry was then done do check for the optical density. 2.3.2 Dead/live assay Confocal laser scanning microscopy was used to examine cell viability in hBMSCs seeded onto titanium surfaces. After 24 h of culture, the cells were fixed in 10% formalin and stained using the fluorescent dye calcein-AM (Green) for live cells and Propidium iodide (red) for dead cells. Using fluorescent images, each TiO2 group were assessed for four different plates and they were then averaged together. 2.3.3 Immunofluorescence Morphology and morphometry of cells on TiO2 surfaces of all groups were examined after 24 hours following cell seeding to evaluate the cellular spreading and cytoskeletal arrangement of the cultured cells using confocal laser scanning microscopy. Cells were fixed in 10% formalin and confocal microscopic images of cells stained with 4′,6-diamidino-2-phenylindole (DAPI) to detect the nucleus (keygentec), antivinculin to detect vinculin protein within the cytoplasm (Proteintech), and rhodamine phalloidin for actin filaments (beyotime.inc). 2.3.4 Surface characterization Scanning electron microscope (S2300, Hitachi, Japan) was used after 24 hours of seeding the cells on the plates to examine the surface topographies of the titanium plates as well as the cellular morphology in each group. 1500, 3000 and 5000 magnifications were used for observation. 2.3.5 PCR gene expressions 2.3.5.1 Real time fluorescence quantitative PCR detection mRNA Extraction of RNA was done using TRIzol™ reagent, the excess PBS was washed off, rinsed twice, then 1 ml of TRIzol™ was added to cells followed by to 1.5 ml RNase in the EP tube for 10 min and 200 ul chloroform and mixed thoroughly several times in room temperature for 5 minutes. It was then centrifuged for 15 minutes at 12000 rpm till the RNA was visible under the third phase. The upper aqueous phase (about 400 ul) was transferred into a new 1.5 ml EP tube. 400 ul isopropyl alcohol was added, mixed well, placed at room temperature for 10 min and then centrifuged at 12000 rpm for 10 minutes. The bottom of the tube was seen white due to RNA precipitation. Excess liquid was discarded and RNase of 75% ethanol 1 ml was added, mixed and centrifuged again for 5 minutes at 10000 rpm. The RNA precipitation was air dried for 5–10 minutes and then dissolved and diluted in 20 ul DEPC solution. Optical density (OD) was calculated. The OD260, OD280 and OD260/OD280 values were determined by UV spectrophotometer, and the purity and concentration of RNA were calculated. According to the ratio of OD260/OD280, the quality of RNA was estimated, and the ratio was between 1.8 and 2.0. The absorbance value was calculated according to the following formula the concentration of the sample RNA: Total RNA concentration (ug/ul) = OD260 * 40 * 200 * 10-3. The total RNA was placed in the refrigerator at −80 °C for storage. 2.3.5.2 Reverse transcription into cDNA Reagents: 2.576 ul RNA, 2 ul of Oligo (dT) 15 (10 uM), 2 ul of dNTP (2.5 mM) and up to 14.5 ul of ddH2O (RNase free). Reaction conditions were 70 °C for 5 min, following a brief centrifugation on the ice. All were put in the PCR tube (14.5 ul) and added with 4 ul of 5×RT buffer, 0.5 ul of RNase Inhibitor. 1 ul of M-MLV reverse transcriptase and Up to 20 ul of ddH2O (RNase free). Reaction conditions for this were 42 °C for 60 minutes and 95 °C for 5 minutes. 2.3.5.3 Semi quantitative RT-PCR detection Reagents: 0.5 ul Reference F (10 uM), 0.5 ul Reference R (10 uM), 2 ul dNTP (2.5 mM), 0.25 ul Ex Taq, 2.5 ul 10×Ex Taq E buffer, 1 ul cDNA and Up to 25 ul ddH2O. Reaction condition: 4 minutes at 94 °C; 30 seconds at 94 °C, 30 seconds at 56 °C, 25 seconds at 72 °C, and then 30 cycles for 4 minutes at 72 °C. 2.3.5.4 Real time fluorescent quantitative PCR detection Reagents: 4 ul of cDNA was diluted 10 times, then added to 0.4 ul Forward Primer (100 uM), 0.4 ul Reverse Primer (100 uM), 10 ul SYBR Green/Fluorescein qPCR Master Mix (2×), and 2 ul H2O5. Reaction condition: 0 °C for 2 minutes, 95 °C for 10 minutes; 95 °C for 30 seconds, 60 °C for 30 seconds, 40 cycles. 50 °C minutes, 95 C 10 minute as; 95 °C for seconds 30, 60 °C for 30 seconds. For the dissolution curves, the final data were analyzed by 2−△△Ct. 2.3.5.5 Primer sequence table The primer sequence for different markers is shown in (Table 1).Table 1 Primer sequence for Col-1, OCN and OPN. Table 1Name Primer Sequence Size b-actin Forward 5′- CACGATGGAGGGGCCGGACTCATC -3′ 240 bp Reverse 5′- TAAAGACCTCTATGCCAACACAGT -3 Rat Col I Forward 5′-TGACTGGAAGAGCGGAGAGT -3′ 202 bp Reverse 5′-GAATCCATCGGTCATGCTCT-3 Rat OCN Forward 5′- TCATGTCCAAGCAGGAGGGCAGTAA-3′ 175 bp Reverse 5′- TTGTAGGCGTCCTGGAAGCCAATGT -3 Rat OPN Forward 5′-CCCGATGCCACAGATGAG -3′ 121 bp Reverse 5′-TCCCGTTGCTGTCCTGAT -3 2.3.6 Alkaline phosphatase activity assay Alkaline phosphatase (ALP) activity was assessed after two weeks of cell seeding into the titanium plates and was evaluated as the amount of p-Nitrophenyl Phosphate (PNPP) released by the enzymatic reaction at specific areas in a photo of the titanium plates. It was measured using the use of IPP6.0 software. 2.4 Statistical analysis Graphpad prism 5.0 was used to perform the statistical analysis in this study. The One-way analysis of variance (One-way ANOVA) was used to compare between the results of different TiO2 groups either by using Bonferroni's Multiple Comparison Test for multiple comparisons or by Dunnett's Multiple Comparison Test to compare between TiO2 results with the control group 1A. Unpaired one-tailed t-tests were performed separately for comparison between the results of two separate groups. 3 Results 3.1 Cell count and optical density (OD) 3.1.1 Spectrophotometry The optical density (OD) was measured and cell count was performed and then calculated in percentages compared to 1A (Table 2) and plotted in (Fig. 3).Table 2 Cell count was performed in 5 separate TiO2 plates of each group. 3B (GNP + SBF + PhF) showed maximum cellular proliferation compared to the other TiO2 surfaces. Table 2TiO2 group 1 2 3 4 5 Average 1A 100.00% 101.29% 101.29% 101.93% 99.36% 100% 2A 110.30% 101.29% 112.87% 100.64% 107.72% 106% 3A 125.10% 133.46% 127.67% 125.10% 120.59% 126% 1B 116.73% 114.16% 117.37% 116.09% 116.09% 116% 2B 134.11% 131.53% 132.82% 129.60% 132.82% 132% 3B 146.98% 152.12% 143.11% 150.84% 154.70% 149% Fig. 3 Cell growth ratio and standard deviation (SD) on different TiO2 modified surfaces compared to the control group (1A) which was set at 100%. UV treated groups showed higher cellular density in general, and Group 3B showed the highest density. Fig. 3 3.1.1.1 Statistical analysis One-way ANOVA was used to perform statistical analysis. Bonferroni's Multiple Comparison Test between each two groups revealed that there is a statistical significant increase in cellular count when adding SBF, GNPs and UV light treatment to the titanium plates. The only two non-significant differences were between 1A vs 2A and 3A vs 2B (Table 3).Table 3 Bonferroni's Multiple Comparison Test between different optical densities. Significance level is indicated by*. Table 3Bonferroni's Multiple Comparison Test Mean diff. t Significance P < 0.05 Summary 95% CI of diff 1A vs 2A −5.790 2.369 No ns −13.93 to 2.352 1A vs 3A −25.61 10.48 Yes *** −33.75 to −17.47 1A vs 1B −15.31 6.265 Yes *** −23.46 to −7.172 1A vs 2B −31.40 12.85 Yes *** −39.54 to −23.26 1A vs 3B −48.78 19.95 Yes *** −56.92 to −40.63 2B vs 3B −17.37 7.107 Yes *** −25.52 to −9.232 2B vs 3B: T-test revealed that there is a significantly high increase in the OD of 3B compared to 2B with P value < 0.0001. 3.2 Cell viability assay (live/dead assay) PhF and GNPs increase the cellular viability (Fig. 4), The percentage of viable cells was counted. The ratio of live cells was found to increase in the TiO2 plates in the following order 1A, 2A, 3A, 1B, 2B, 3B (Table 4). The ratio with the standard deviations of all groups was plotted in (Fig. 5).Fig. 4 All PhF TiO2 surfaces showed higher cellular viability when compared to the non-PhF ones. In both UV treated and non treated groups, the viability in comparison was GNPs > SBF > H2So4. Fig. 4Table 4 Live/dead assay shown by the average percentage of live cells from the total cell count. Table 4 1 2 3 4 Average 1A 48.84 49.06 54.39 49.18 50.37% 2A 53.73 55.10 54.12 57.89 55.21% 3A 60.00 59.26 64.52 60.61 61.10% 1B 70.00 60.71 63.41 64.15 64.57% 2B 78.26 72.22 67.50 60.98 69.74% 3B 82.35 81.82 79.17 73.33 79.17% Fig. 5 The ratio of live cells in different TiO2 groups, with the standard deviation (SD). Fig. 5 3.2.1 Live/dead assay results 3.2.1.1 Statistical analysis Statistical analysis shows that the live/dead ratio is significantly higher in UV treated groups than the non UV treated ones (Table 5).Table 5 Dunnett's Multiple Comparison Test for cell viability between different TiO2 groups. T test was preformed for 2B and 3B. Significance level is indicated by*. Table 5Dunnett's Multiple Comparison Test Mean diff. q Significance P < 0.05 (t-test) Summary 95% CI of diff 1A vs 2A −4.897 1.677 No ns −12.96 to 3.167 1A vs 3A −10.79 3.693 Yes ** −18.85 to −2.721 1A vs 1B −14.26 4.882 Yes *** −22.32 to −6.191 1A vs 2B −19.43 6.653 0.0156 *** −27.49 to −11.36 1A vs 3B −28.86 9.881 0.0147 *** −36.92 to −20.79 *B2 vs B3: Unpaired t test: shows that there is a significant increase in viability in 3B compared to 2B with a P value of 0.0330. 3.3 Morphology and morphometry of cells The OD of Actin and vinculin are good indicators for cytoskeletal development. The pattern of actin and vinculin expression was as the following: 1B > 1A, 2B > 2A, and 3B > 3A. The expression of actin and vinculin was found to increase in the titanium plates in the following order 1A, 2A, 1B, 3A, 2B, 3B (Fig. 6).Fig. 6 PhF treated titanium expressed higher stress fibers development, cytoskeletal maturation as well as higher differentiation and cellular density than those with no PhF treatment. The cellular growth and development was GNPs > SBF > H2SO4. Fig. 6 3.3.1 Optical density (OD) calculations IPP6.0 software was used for the analysis of the optical density of fluorescent photographs, each group had three TiO2 plates analyzed, optical density analysis per area was calculated for the integral optical density (IOD). The average OD were then calculated (Table 6) and (Fig. 7).Table 6 Average optical density of actin and vinculin for different TiO2 groups. Table 6Group Average OD of F-actin Average OD of vinculin 1A 0.06132 0.05135 1B 0.06958 0.06033 2A 0.06608 0.05608 2B 0.08210 0.07518 3A 0.07508 0.06690 3B 0.08518 0.07911 Fig. 7 UV treated groups show enhanced expression of actin and vinculin. Fig. 7 3.4 Surface characterization using scanning electron microscopy (SEM) SEM was preformed 24 hours following seeding the cells onto the TiO2 plates to check for surface morphology. The acid-etched titanium plates were of uniform roughness with about 2 um pits as can be seen in 1A and 1B (Fig. 8a). SBF coated plates (2A and 2B) shows the hydroxyapatite layer at higher magnification (Fig. 8b). Both PhF treated (Fig. 9) and GNP treated (Fig. 10) SBF surfaces showed enhanced cellular differentiation. The osteoblasts showed a more defined filopodia and lamellipodia attached to the TiO2 surface. The PhF groups in general show high increase in affinity and more cellular spread on titanium indicating an increase of the hydrophilicity to the titanium surface (Fig. 11).Fig. 8 a) acid etched TiO2. b) SBF-modified showing the hydroxyapatite layer covering the TiO2 surface. Fig. 8Fig. 9 a) SBF-treated none PhF surface, b) SBF-treated PhF surfaces show higher cellular differentiation. Fig. 9Fig. 10 a) SBF treated surfaces, b) GNP treated surfaces at the same magnification showing more cellular maturation. Fig. 10Fig. 11 a) GNP – treated surfaces, b) GNP and UV treatment showing more pronounced pseudopodia and cytoskeletal development. Fig. 11 3.5 Osteogenic gene expression The osteogenic differentiation was assessed using quantitative real-time PCR (qPCR) after one week of cell culture to measure the gene expressions of the Col-1, OPN and late osteogenic biomarker OCN was analyzed. Beta-actin was used as the reference gene, it was used as a positive control for the expression of Col-1, OPN and OCN (Table 7).Table 7 B-actin relative gene expression for different TiO2 groups. Table 7 1A 2A 3A 1B 2B 3B Rat B-actin 19.071 18.286 18.701 18.636 19.204 18.722 19.083 18.198 18.612 18.474 19.184 18.802 19.066 18.341 18.588 18.681 19.339 18.843 3.5.1 Collagen 1 The average relative gene expression of Col-1 protein was calculated from the PCR results are plotted in (Fig. 12). 1A was considered the control group. Statistical analysis is shown in (Table 8).- Analysis of relative gene expression of Col-1: Fig. 12 Col-1 expression with the standard deviation (SD). Fig. 12 The mean Col-1 expression of different groups was 1A (1.000), 2A (1.547), 3A (1.807). 1B (1.781), 2B (2.412), 3B (3.446). Col-1 expression after one day of cell culture on the titanium plates was higher on the UV treated group (group B) than that of group A. 1B showed more Col-1 expression than 1A, 2B showed more expression than B1 and 3B also showed more expression of Col-1 than 3A. Titanium plates with SBF coating showed more expression of this biomarker than the plates with no SBF treatment, while the TiO2 plates modified with GNPs were the highest to express this gene. 3.5.1.1 Statistical analysis Table 8 Dunnett's Multiple Comparison Test shows significant increase of Col-1 between 2B and 3B compared to the control. *indicates the level of significance. Separate t-tests shows that 3B is more significant. Table 8Dunnett's Multiple Comparison Test Mean diff. q Significance P < 0.05 (t- test) Summary 95% CI of diff 1A vs 2A −0.5467 1.811 No ns −1.422 to 0.3289 1A vs 3A −0.8070 2.674 No ns −1.683 to 0.06860 1A vs 1B −0.7813 2.589 No ns −1.657 to 0.09427 1A vs 2B −1.412 4.679 0.0263 ** −2.288 to −0.5364 1A vs 3B −2.446 8.104 0.0065 *** −3.321 to −1.570 *2B vs 3B: Paired t test showed that there is a significant increase in Col-1 Expression in 3B compared to 2B with a P value of 0.0238. 3.5.2 Osteopontin The average relative gene expression of OPN protein was calculated from the PCR results are plotted in (Fig. 13). 1A was considered the control group. Statistical analysis is shown in (Table 9).- Analysis of relative gene expression of osteopontin: Fig. 13 OPN expression with the standard deviation (SD). Fig. 13 The mean OPN expression of different groups was 1A (1.000), 2A (1.202), 3A (1.850). 1B (1.365), 2B (2.616), 3B (3.843). qPCR analysis of OPN showed that the non-PhF surfaces expressed less OPN than the UV treated groups. 3.5.2.1 Statistical analysis Table 9 Dunnett's Multiple Comparison Test shows significant increase of OPN between 3A, 2B and 2B with the control. * indicates the level of significance. Separate t-tests shows the P values of the significant groups. Table 9Dunnett's Multiple Comparison Test Mean diff. q Significance P < 0.05 (t test) Summary 95% CI of diff 1A vs 2A −0.2017 1.326 No ns −0.6429 to 0.2395 1A vs 3A −0.8497 5.587 yes *** −1.291 to −0.4085 1A vs 1B −0.3653 2.402 No ns −0.8065 to 0.07587 1A vs 2B −1.616 10.63 0.0067 *** −2.057 to −1.175 1A vs 3B −2.843 18.69 0.0006 *** −3.284 to −2.401 *2B vs 3B: t test showed that there is a significant increase in OPN Expression in 3B compared to 2B with a P value of 0.0023. 3.5.3 Osteocalcein The average relative gene expression of OCN protein was calculated from the PCR results are plotted in (Fig. 14). 1A was considered the control group. Statistical analysis is shown in (Table 10).- Analysis of relative gene expression of osteocalcin: Fig. 14 OCN expression with the standard deviation (SD). Fig. 14 The mean OCN expression of different groups was 1A (1.000), 2A (1.735), 3A (2.037). 1B (1.848), 2B (2.834), 3B (3.885). The expression of the OCN was similar in pattern to those expressed by Col-1 and OPN. The UV treated surfaces had a noticeably higher gene expressions than their counter groups in the none-PhF surfaces. 3.5.3.1 Statistical analysis Table 10 Dunnett's Multiple Comparison Test shows significant increase of OCN in all groups. * indicates the level of significance. Separate t-tests shows the P values of the significant groups. Table 10Dunnett's Multiple Comparison Test Mean diff. q Significance P < 0.05 (t test) Summary 95% CI of diff A1 vs A2 −0.7523 3.941 Yes * −1.323 to −0.1815 A1 vs A3 −1.037 5.434 Yes ** −1.608 to −0.4665 A1 vs B1 −0.8473 4.439 Yes ** −1.418 to −0.2765 A1 vs B2 −1.834 9.607 0.0120 *** −2.405 to −1.263 A1 vs B3 −2.886 15.12 0.0002 *** −3.457 to −2.315 *2B vs 3B: t test showed that there is a significant increase in OCN Expression in 3B compared to 2B with a P value of 0.0038. 3.6 ALP activity ALP activity was measured two weeks after cell seeding onto the TiO2 plates. The p-Nitrophenyl Phosphate (PNPP) was used a single-point photospectrometry assay via calculating the catalytic ability of ALP to hydrolyse the PNPP. It was measured by the amount of hydrolysis per square area on the TiO2 surfaces (Fig. 15) using the IPP6.0 software.Fig. 15 ALP expression after 2 weeks of cell seeding, showing much higher results in the PhF TiO2 groups. Fig. 15 ALP activity results following two weeks of cell seeding showed remarkable differences between the PhF TiO2 surfaces and the non-PhF ones (Fig. 14). 3B had the highest expression among all surfaces with 20% more ALP expression than B2. 4 Discussion The implant's surface topography can highly affect the osseointegrative capacity and enhance the level of cellular attachment and spreading. Rougher surfaces for instance show higher osteoblastic proliferation and collagen synthesis than smooth surfaces. The biological properties can also significantly influence the cellular reactions toward the surface of the implant. For example, hydrophilic surfaces enhances osteoblastic differentiation than hydrophobic surfaces [130, 131]. Takahiro Ogawa et al. [11] used UV light to photofunctionalize the titanium surface and convert it from hydrophobic to what he called “superhydrophilic”, the UV modification have also to change the surface charge from negative to positive as well as removing the surface carbons that accumulates on the TiO2 surface resulting in a significant increase in protein absorption, osteoblastic differentiation and mineralization. It was shown that UV PhF can increase the BIC from 55% to over 98%, translating into a significant increase in primary stability and decrease in healing time. Simulated body fluid (SBF) was reported in the literature to form a hybrid micro-nano TiO2 surface. Its ability to form a bone-like apatite layer has proved to enhance both the mechanical and biological properties [132]. Similarly, many other reports have also suggested that the increase in surface energy (hydrophilicity) does not only improve cellular function, but also leads to more expression of osteogenic biomarkers such as Col-1, OPN and ALP [133, 134, 135]. Makiko Saita et al. photofunctionalized SBF-modified titanium and found that PhF accelerated the deposition of nanoscale apatite on titanium, and the function of osteoblasts were further enhanced on the apatite-coated titanium [136]. Dohan Ehrenfest et al. found that titanium surface nanomodification has a remarkable impact on the osseointegration process by altering the molecular level via the expression of higher surface energy leading to an increase in the hydrophilicity of the surface and therefore enhancing the cellular and protein interactions on the TiO2 surface [137]. In another study, Dong Nyoung et al. demonstrated that gold nanoparticles enhances the osteogenic differentiation of adipose derived stem cells and shows high expression of osteogenic differentiation specific markers such as COL1, Runx2, OCN, as well as high levels of alkaline phosphatase activity [138]. Collagen type I (COL-1) is the major matrix protein produced during the proliferation of osteoblasts and it is the most abundant protein in bone matrix [139, 140]. It is a good parameter of cellular differentiation but is not exclusive to osteoblastic cells, therefore, quantifying the expression of osteopontin (OPN), osteocalcin (OCN) and alkaline phosphatase (ALP) is essential. These biomarkers are more specific to bone formation and mineralization [141]. Osteopontin is a multifunctional protein linked mainly to bone metabolism and remodeling. It is produced by osteoblasts and osteoclasts and it is involved in the remodeling of bone matrix and in tissue calcification [142, 143]. Osteocalcin is produced only by osteoblasts and is involved in bone metabolism [144] It is one of the main biomarkers indicating activity of osteoblasts [145]. ALP, although not specific to osteoblasts, is an essential early marker for osteoblast differentiation. It also plays a major role in the mineralization process [146]. 4.1 Optical density In our study we have created a hybrid micro-nano topography on the TiO2 surface. The titanium plates in group 3B had all the surface treatment modalities we proposed. Results have shown a significant increase in OD for 3B group compared to the only acid etched groups, except for 2A which increased by only 6%, indicating that the hydroxyapatite layer alone has less impact on cellular differentiation and proliferation than GNPs and PhF. The OD increased by 20% in 3A compared to the control group indicating higher biocompatibility of nanoscale surfaces over not only microtopographies, but also Phf ones. The PhF-SBF plates (2B) showed higher results than those non-PhF nanotopographies indicating higher impact of UV light, 3B had a significantly more OD when compared to 2B with a p value < 0.0001, which also puts an emphasis on the GNPs effect on the cellular differentiation. 4.2 Cytotoxicity In order to investigate the cytotoxicity of different modification modalities on the MSCs, a live/dead assay was performed. and the results showed an increased cellular viability in the following matter 1A < 2A < 3A < 1B < 2B < 3B with the number of live cells compared to total cells is roughly 50%, 55%, 60%, 65%, 70% and 80% respectively. Following 24 hours of cell seeding into TiO2 plates, there was roughly 5% increase of the number of living cells per each modification except for a 10% increase from 2B to B3 indicating that the increased protein absorption due to PhF probably enhances the GNPs role in cellular differentiation as well. It can also be suggested that the rapid differentiation of MSCs might may contribute to the increasing ratio of live cells. Our results are in accordance to previous studies which suggested that reported cytotoxicity of GNPs can be related to their surface ligand rather than from the nanoparticles themselves [147, 148, 149]. Based on our results, we suggest that our 10 nm GNPs has less cytotoxicity than other groups and it also seemed to highly improve cellular viability. 4.3 Immunofluorescence Confocal laser scanning microscopy was done after 24 hours of cell seeding and the immunofluorescence images showed the various osteoblast differentiation on the different titanium surfaces. PhF surfaces expressed 13% more actin fibers and 17% more vinculin than 1A which can be considered a representative of typical “as received” commercial implants. There was a higher cytoskeletal development and more organized stress fibers in the SBF coated plates 2B than 2A, and in the GNP-modified 3B than 2B. This confirms the positive physiochemical effect of the UV on reversing the biological ageing of the titanium surface. Our findings comes in accordance with many previous studies regarding the ageing of TiO2 surfaces and the reversing of this phenomena with PhF [8, 11, 12, 13, 14]. The increased cellular attachment on UV treated plates can be linked to the removal of the hydrocarbon layer on the surface of TiO2 and to the increase in the surface energy which has been previously reported to accelerate both osteogenic differentiation of stem cells and the mineralization process [142]. The enhanced cellular spreading on all groups of TiO2 compared to the none UV treated groups is also indicative of the newly acquired “Superhydrophilicity” of the surface. Other treatment modalities also showed noticeable differences in cellular behavior. SBF immunofluorescent images showed higher cellular proliferation, more actin and vinculin expression and more cytoskeletal development than the none-SBF coated TiO2 plates due to the precipitation of calcium and phosphate ions from the simulated body fluid onto the titanium to form a layer of hydroxyapatite on its surface. These findings came in accordance to the previous studies which concluded that SBF coating enhances both the biological and the mechanical properties and therefore enhances the osteoblastic differentiation [133]. The GNP modified group of titanium surfaces on the other hand showed the fastest rates of cellular differentiation, cytoskeletal maturation and associated actin and vinculin fibers expression, with 3B expressing just below 40% more actin and more than 50% vinculin compared to the control group. More mitotic activity was detected in the GNP modified surfaces. The positive biological effect of GNPs on cellular behaviour was shown to further enhance the physiochemical effect of PhF. 4.4 Surface characterization The scanning electron microscopy (SEM) images were also taken 24 hours after the stem cells were seeded onto the titanium plates. UV treated plates showed considerable increase in the cellular activity and extracellular matrix (ECM) production compared to the none UV treated ones indicating that PhF induced an increase in the affinity of cellular and protein absorption to the TiO2 surfaces. The hydroxyapatite coating on the SBF modified plates can be seen clearly covering the titanium micropits indicating the precipitation of the calcium and phosphate ions on the surface. This bone-like surface participates in the enhancement of the mechanical and biological properties, resulting in an enhanced cellular attachment and more cytoskeletal differentiation. 2B (UV treated) showed much more spreading due to the superhydrophilic TiO2 surfaces. The SEM images of the GNP treated TiO2 surfaces (3A, 3B) revealed more pronounced cellular extensions with 3B having more spreading and attachment across the titanium surfaces due to the PhF effect. Previous studies have shown that the increased roughness of TiO2 surface up-regulates the ALP activity and enhances osteoblastic differentiation but at the same time it reduces the proliferation rate compared to smooth surfaces while smooth surfaces have less effect on differentiation and more on proliferation [143, 144, 145, 146, 147, 148, 149]. This suggests that the higher cellular attachment and proliferation seen in the GNP modified TiO2 plates in our study is not actually due to the hybrid micro-nano topography which was formed by the acid etched-hydroxyapatite coated layer but it is rather due to the GNP and the UV light effect. The size of GNPs is reported in the literature to have various effects on cellular differentiation. D. Zhang et al. investigated the osteogenic effect of 20 nm and 40 nm GNPs differentiation and mineralization and they concluded that “size matters” and that the smaller GNPs show higher ALP activity than the larger ones [114]. Wan-Kyu and colleagues also investigated other sizes ranging from 15 to 100 nm GNPs on adipose derived stem cells and they said 30–50 nm GNPs were the most efficient [115]. We used 10 nm GNPs in our experiment, which is one of the smallest to be used for growing cells on a titanium surface and could be a key parameter for catalyzing the cellular differentiation process. The results showed that the 10 nm GNPs are very effective in promoting cellular differentiation and adhesion via increasing the protein adsorption at the nanoscale surface. Some studies have shown that nanosurfaces can interact with the osteoblasts and activate the integrin singling pathway to produce more extracellular matrix (ECM), and can also induce surface binding proteins to expose more membrane anchoring sites in the osteoblasts leading to enhanced cellular differentiation [150, 151, 152, 153, 154, 155]. Although results were more pronounced in UV treated surfaces (3B), 3A confirms the effectiveness of GNPs alone in promoting cellular differentiation is by cellular intake of the colloidal gold. 4.5 Gene expression Previous studies have shown that GNPs can specifically and highly promote the mitogen-activated protein kinases (MAPK) pathway leading to upregulation of the Runt-related transcription factor 2 (RunX-2) which is considered the major gene in the process of osteoblastic differentiation and in turn directly promotes the expression of other osteoblastic specific genes such as Col-1, OPN and OCN [114]. This is consistent with our ECM and immunofluorescence findings which show increased ECM and pseudopodia development suggesting enhanced osteoblastic differentiation and maturation. The results of the real time quantitative PCR have shown different levels of mRNA expression of Col-1, OPN and OCN. 1A had the least mRNA expression for the three genes and was considered the control group. All the other titanium groups showed an increase in all gene expressions indicating involvement of the MAP kinase pathway and the up-regulation of the expression of the osteogenic gene Runx-2. The expression of the genes was significantly higher than the control group in the UV treated hydroxyapatite coated TiO2 plates 2B and 3B (GNP-treated). This can be related to the increased serum protein adsorption due to the PhF effect and the GNPs combined. Previous reports highlighted that the incubation of nanomaterials results in an increased adsorption of serum proteins on the surface of the cells, and induces cellular influx of these nanoparticles through receptor-mediated endocytosis, causing them to aggregate in peri-nuclear compartments, interact with cytoplasmic proteins and activate metabolic signaling pathways [156, 157]. Despite the lack of visual detection of our GNPs due to their size we can still suggest based on these previous reports that the absorbed serum proteins on the surface of our GNPs have acted in a similar manner. This is supported by the increase in the expression of the three tested genes in group 3A indicating internalization of the 10 nm GNPs and activation of the MAPK pathway. The PCR results were further supported by the results of the ALP expression done one week after cell incubation. 4.6 Alkaline phosphatase activity ALP is a considered an early marker of osteogenic differentiation [158] and is indicative of an ongoing mineralization process [141]. The ALP assay in our experiment was performed 2 weeks after cell incubation and it revealed remarkable differences between the PhF TiO2 plates and the none-UV treated ones. The molecular response to UV light demonstrated by around a 3-fold increase in ALP activity in all TiO2 groups. Therefore, we can conclude that although GNPs are very effective in triggering and enhancing the cellular differentiation cascade, the absorption and cellular internalization of GNPs largely depends on the UV enhanced protein absorption capacity of the TiO2 surface. These PhF surfaces showed much higher cellular activity which confirms that the ageing of titanium and the resulting accumulation of surface carbon on the surface, loss of positive surface charge and hydrophilicity indeed significantly affects the speed and extent of cellular behavior as well as GNP internalization. Nevertheless, our novel hybrid micro-nanoscale hydroxyapatite-coated GNP-modified UV-treated TiO2 surface seems to be the clear winner regarding the speed and extent of differentiation, spread, osteogenic gene expressions and even mineralization which is indicated by this high alkaline phosphatase activity. Our attempt was to combine different treatment modalities in order to get the advantages of each and get the most biocompatible TiO2 surface. The results show that we have largely succeeded in doing that. The new surface (3B) that we have created have shown the most cellular differentiation and proliferation within the first 24 hours, it showed the highest expression of osteogenic biomarkers after one week and the highest ALP expression two weeks after seeding the TiO2 plates with the MSCs. Cellular morphology and function were significantly enhanced in 3B even when compared to the closest modality (2B). This indicates that GNPs played a vital role in this osteogenic cascade. Though we did not test for the p38-MAP Kinase signaling pathway, based on the levels of mRNA expression of the osteogenic biomarkers, we believe that the GNPs triggered the differentiation process, and it was enhanced by the increased protein absorption caused by the effect of the UV rays. Our method showed highly enhanced cellular differentiation rates on a titanium. The new topography could further enhance the already existing “Superosseointergration” phenomenon, meaning that it can improve the bone to implant contact (BIC) ratio to more than 98% in a very short time, leading to better primary stability, less healing time, elimination of the stability dip, better anchorage for short implants and better predictability and prognosis. It could also open new treatment options in the fields of orthopedics and maxillofacial surgery for the use of screws, plates or any titanium surfaces. Further investigations should be done to evaluate the effect of this new surface on osseointegration in vivo. 5 Conclusions We have created a novel hybrid micro-nano titanium surface with a remarkable osteogenic potential. 10 nm GNPs did not show any cytotoxicity. Immunofluorescence and SEM results showed that it highly increased the rate of differentiation, proliferation, attachment, spreading and mineralization. PCR results showed enhanced gene expressions of Col-1, OPN and OCN osteogenic markers. ALP activity was also higher than the other groups. GNPs plays an important role in cellular activity and growth. Photofunctionalizing GNPs can highly improve its ostogenic capabilities. The new topography seems to have a very high potential in enhancing osseointegration and improving outcomes for implant, maxillofacial and orthopedic patients. Declarations Author contribution statement Yassir Elkhidir: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper. Ranfa Lai, Zhiqiang Feng: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data. Funding statement This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Competing interest statement The authors declare no conflict of interest. Additional information No additional information is available for this paper. ==== Refs References 1 Steinemann S.G. Titanium—the material of choice? Periodontol. 2000 17 1998 7 21 10337309 2 Mavrogenis A.F. Dimitriou R. Parvizi J. Babis G.C. Biology of implant osseointegration J. Musculoskelet. Neuronal Interact. 9 2 2009 61 72 19516081 3 Ramazanoglu M. Oshida Y. Osseointegration and bioscience of implant surfaces – current concepts at bone-implant interface; implant dentistry – a rapidly evolvong practice InTech 2011 4 Ogawa T. Photofunctionalization of TiO2 for Optimal Bone-titanium Integration: a Novel Phenomenon of Superosseointegration Enviromentally Benign Photocatalysts 2010 Springer New York 699 713 5 Davies J.E. Mechanisms of endosseous integration Int. J. Prosthodont. 11 1998 391 401 9922731 6 Gao Y. Liu Y. Zhou L. The effects of different wavelength UV photofunctionalization on micro-arc oxidized titanium PLoS One 8 7 2013 e68086 23861853 7 Niinomi M. Liu Y. Nasaki M. Biomedical titanium alloys with Young's moduli close to that of cortical bone Regen. Biometer. 3 3 2016 173 185 8 Lee J.H. Ogawa T. The biological aging of titanium implants Implant Dent. 21 5 2012 415 421 22968574 9 Parkash R.B. Shetty O. Tabassum R. Surface modifications of Endosseous dental implants Int. J. Oral Implantol. Clin. Res. 3 3 2012 116 121 10 Albrektsson T. Johansson C. Osteoinduction, osteoconduction and osseointegration Eur. Spine J. 2 2001 96 101 11 Ogawa T. UV photofunctionalization of titanium implants J. Craniofac. Tissue Eng. 2 2012 151 158 12 Att W. Ogawa T. Biological aging of implant surfaces and their restoration with ultraviolet light treatment: a novel understanding of osseointegration Int. J. Oral Maxillofac. Implants 27 2012 753 761 22848875 13 Suzuki T. Hori N. Att W. Ultraviolet treatment overcomes time-related degrading bioactivity of titanium Tissue Eng. Part A 15 2009 3679 3688 19397472 14 Iwasa F. Tsukimura N. Sugita Y. TiO2 micro-nano-hybrid surface to alleviate biological aging of UV-photofunctionalized titanium Int. J. Nanomed. 6 2011 1327 1341 15 Hori N. Ueno T. Suzuki T. Ultraviolet light-treatment for the restoration of age-related degradation of titanium bioactivity Int. J. Oral Maxillofac. Implants 25 2010 49 62 20209187 16 Hori N. Ueno T. Minamikawa H. Electrostatic control of protein adsorption on UV-photofunctionalized titanium Acta Biomater. 6 2010 4175 4180 20466081 17 Iwasa F. Hori N. Ueno T. Enhancement of osteoblast adhesion to UV-photofunctionalized titanium via an electrostatic mechanism Biomaterials 31 2010 2717 2727 20035996 18 Rapuano B.E. Lee J.J. MacDonald D.E. Titanium alloy surface oxide modulates the conformation of adsorbed fibronectin to enhance its binding to integrins in osteoblasts Eur. J. Oral Sci. 120 3 2012 185 194 22607334 19 Rapuano B.E. MacDonald D.E. Surface oxide net charge of a titanium alloy; modulation of fibronectin-activated attachment and spreading of osteogenic cells Colloids Surf. B Biointerfaces 82 1 2011 95 103 20884181 20 Rapuano B.E. Hackshaw K.M. Schniepp H.C. Effects of coating a titanium alloy with fibronectin on the expression of osteoblast gene markers in the MC3T3 osteoprogenitor cell line Int. J. Oral Maxillofac. Implants 27 5 2012 1081 1090 23057020 21 Tsai J.A. Lagumdzija A. Stark A. Albumin-bound lipids induce free cytoplasmic calcium oscillations in human osteoblast-like cells Cell Biochem. Funct. 25 2007 245 249 16397911 22 Klinger A. Steinberg D. Kohavi D. Mechanism of adsorption of human albumin to titanium in vitro J. Biomed. Mater. Res. 36 1997 387 392 9260109 23 Kusakawa Y. Yoshida E. Hayakawa T. Protein adsorption to titanium and zirconia using a quartz crystal microbalance method Biomed Res. Int. 2017 1521593 28246591 24 Bagambisa FB1 Kappert H.F. Schilli W. Cellular and molecular biological events at the implant interface J. Craniomaxillofac. Surg. 22 1 1994 12 17 8175991 25 Flanagan D. Photofunctionalization of dental implants J. Oral Implantol. 42 5 2016 445 450 27168159 26 Att W. Hori N. Iwasa F. The effect of UV-photofunctionalization on the time-related bioactivity of titanium and chromium–cobalt alloys Biomaterials 30 26 2009 4268 4276 19473697 27 Shie J.L. Lee C.H. Chiou C.S. Photodegradation kinetics of formaldehyde using light sources of UVA, UVC and UVLED in the presence of composed silver titanium oxide photocatalyst J. Hazard. Mater. 155 2008 164 172 18155832 28 Aita H. Hori N. Takeuchi M. The effect of ultraviolet functionalization of titanium on integration with bone Biomaterials 30 2009 1015 1110 19042016 29 Suzuki S. Kobayashi H. Ogawa T. Implant stability change and osseointegration speed of immediately loaded photofunctionalized implants Implant Dent. 22 5 2013 481 490 24021973 30 Att W. Hori N. Takeuchi M. Time-dependent degradation of titanium osteoconductivity: an implication of biological aging of implant materials Biomaterials 30 2009 5352 5363 19595450 31 Iwasa F. Baba K. Ogawa T. Enhanced intracellular signaling pathway in osteoblasts on ultraviolet lighttreated hydrophilic titanium Biomed. Res. 37 1 2016 1 11 26912135 32 Le Guehennec L. Soueidan A. Layrolle P. Surface treatments of titanium dental implants for rapid osseointegration Dent. Mater. 23 2007 844 854 16904738 33 Sykaras N. Iacopino A.M. Marker V.A. Implant materials, designs, and surface topographies: their effect on osseointegration. A literature review Int. J. Oral Maxillofac. Implants 15 2000 675 690 11055135 34 Parsons J.T. Horwitz A.R. Schwartz M.A. Cell adhesion: integrating cytoskeletal, dynamics and cellular tension Nat. Rev. Mol. Cell Biol. 11 9 2010 633 643 20729930 35 Humphries J.D. Wang P. Streuli C. Geiger B. Humphries M.J. Ballestrem C. Vinculin controls focal adhesion formation by direct interactions with talin and actin J. Cell Biol. 179 2007 1043 1057 18056416 36 Wen K.K. Rubenstein P.A. Demali K.A. Vinculin nucleates actin polymerization and modifies actin filament structure J. Biol. Chem. 284 44 2009 30463 30473 19736312 37 Ellingsen J.E. A study on the mechanism of protein adsorption to TiO2 Biomaterials 12 1991 593 596 1663394 38 Goldmann W.H. Ingber D.E. Intact vinculin protein is required for control of cell shape, cell mechanics, and rac-dependent lamellipodia formation Biochem. Biophys. Res. Commun. 290 2002 749 755 11785963 39 Ezzell R.M. Goldmann W.H. Wang N. Vinculin promotes cell spreading by mechanically coupling integrins to the cytoskeleton Exp. Cell Res. 231 1997 14 26 9056408 40 Mata A. Su X. Fleischman A.J. Osteoblast attachment to a textured surface in the absence of exogenous adhesion proteins IEEE Trans. Nanobiosci. 2 2003 287 294 41 Pols H.A. Schilte H.P. Nijweide P.J. Visser T.J. Birkenhager J.C. The influence of albumin on vitamin D metabolism in fetal chick osteoblast-like cells Biochem. Biophys. Res. Commun. 125 1984 265 272 6334519 42 Al-Jawad M. Fragneto G. Liu J. Fibronectin adsorption studied using neutron reflectometry and complementary techniques Eur. Phys. J. E. Soft Matter 30 2009 175 179 19551415 43 Dewez J.L. Doren A. Schneider Y.J. Competitive adsorption of proteins: key of the relationship between substratum surface properties and adhesion of epithelial cells Biomaterials 20 1999 547 559 10213358 44 Pendegrass C.J. El-Husseiny M. Blunn G.W. The development.of fibronectin-functionalised hydroxyapatite coatings to improve dermal fibroblast attachment in vitro J. Bone Jt. Surg. Br. 94 2012 564 569 45 Mischa Z. Darren A. Morgan R.A. The role of albumin and fibronectin in the adhesion of fibroblasts to plasma polymer surfaces Plasma Process. Polym. 9 2011 149 156 46 Arima Y. Iwata H. Effect of wettability and surface functional groups on protein adsorption and cell adhesion using well-defined mixed self-assembled monolayers Biomaterials 28 2007 3074 3082 17428532 47 Miyata K. Takebe J. Anodized-hydrothermally treated titanium with a nanotopographic surface structure regulates integrin-α6β4 and laminin-5 gene expression in adherent murine gingival epithelial cells J. Prosthodont. Res. 57 2013 99 108 23415882 48 Bik E.M. Long C.D. Amitage G.C. Bacterial diversity in the oral cavity of 10 healthy individuals ISME J. 4 8 2010 962 1047 20336157 49 Siqueira J.F. Jr. Fouad A.F. Rocas I.N. Pyrosequencing as a tool for better understanding of human microbiomes J. Oral Microbiol. 2012 4 50 Safii S.H. Palmer R.M. Wilson R.F. Risk of implant failure and marginal bone loss in subjects with a history of periodontitis: a systematic review and metaanalysis Clin. Implant Dent. Relat. Res. 12 2010 165 174 19438942 51 Mombelli A. Muller N. Cionca N. The epidemiology of peri-implantitis Clin. Oral Implants Res. 23 6 2012 67 76 52 Jin L. Guo W. Xue P. Quantitative assay for the colonization ability of heterogeneous bacteria on controlled nanopillar structures Nanotechnology 26 2015 055702 25581320 53 Cavalcanti I.M. Ricomini Filho A.P. Lucena-Ferreira S.C. Da Silva W.J. Paes Leme A.F. Senna P.M. Salivary pellicle composition and multispecies biofilm developed on titanium nitrided by cold plasma Arch. Oral Biol. 59 2014 695 703 24769315 54 Badihi Hauslich L. Sela M.N. Steinberg D. The adhesion of oral bacteria to modified titanium surfaces: role of plasma proteins and electrostatic forces Clin. Oral Implants Res. 24 A100 2013 49 56 22150723 55 Rileya D.J. Bavastrelloa V. Covanib U. Baroneb A. Nicolinia N. An in-vitro study of the sterilization of titanium dental implants using low intensity Dent. Mater. 21 8 2005 756 760 15878616 56 Einarsson E. Svard S.G. UV irradiation responses in Giardia intestinalis Exp. Parasitol. 154 2015 25 32 25825252 57 Barbut F. How to eradicate Clostridium difficile from the environment J. Hosp. Infect. 89 4 2015 287 295 25638358 58 Enwemeka C.S. Williams D. Enwemeka S.K. Blue 470-nm light kills methicillin-resistant Staphylococcus aureus (MRSA) in vitro Promot. Laser Surg. 27 2 2009 221 226 59 Gallardo-Moreno A.M. Pacha-Olivenza M.A. Saldana L. In vitro biocompatibility and bacterial adhesion of physico-chemically modified Ti6Al4V surface by means of UV irradiation Acta Biomater. 5 1 2009 181 192 18768375 60 Yamada Y. Yamada M. Ueda T. Reduction of biofilm formation on titanium surface with ultraviolet-C pre-irradiation Biomater. Appl. 29 2 2014 161 171 61 De Avila E.D. Lima B.F. Sekiya T. Effect of UV-photofunctionalization on oral bacterial attachment and biofilm formation to titanium implant material Biomaterials 67 2015 84 92 26210175 62 Hirota M. Ozawa T. Iwai T. Implant stability development of photofunctionalized implants placed in regular and complex cases: a case-control study Int. J. Oral Maxillofac. Implants 31 3 2016 676 686 27183088 63 Funato A. Yamada M. Ogawa T. Success rate, healing time, and implant stability of photofunctionalized dental implants Int. J. Oral Maxillofac. Implants 28 5 2013 1261 1271 24066316 64 Ogawa T. Photofunctionalization of TiO2 for Optimal Integration of Titanium with Bone Applications of Titanium Oxide-based Materials. Benign Photocatalysts 2010 Springer 699 713 65 Meredith N. Alleyne D. Cawley P. Quantitative determination of the stability of the implant-tissue interface using resonance frequency analysis Clin. Oral Implants Res. 7 1996 261 267 9151590 66 Huang H.L. Tsai M.T. Su K.C. Relation between initial implant stability quotient and bone-implant contact percentage: an in vitro model study Oral Surg. Oral Med. Oral Pathol. Oral Radiol. 116 5 2013 356 361 67 Park K.J. Kwon J.Y. Kim S.K. The relationship between implant stability quotient values and implant insertion variables: a clinical study J. Oral Rehabil. 39 2012 151 159 21923718 68 Ueno T. Yamada M. Suzuki T. Enhancement of bone-titanium integration profile with UV-photofunctionalized titanium in a gap healing model Biomaterials 31 2010 1546 1557 19962757 69 Nishimura I. Huang Y. Butz F. Discrete deposition of hydroxyapatite nanoparticles on a titanium implant with predisposing substrate microtopography accelerated osseointegration Nanotechnology 18 2007 1 9 70 Mendonca G. Mendonca D.B. Aragao F.J. Advancing dental implant surface technology—from micron- to nanotopography Biomaterials 29 2008 3822 3835 18617258 71 Ikeda T1 Hagiwara Y. Hirota M. Effect of photofunctionalization on fluoride-treated nanofeatured titanium J. Biomater. Appl. 28 8 2014 1200 1212 23985537 72 Tsukimura N. Ueno T. Iwasa F. Bone integration capability of alkali- and heat-treated nanobimorphic Ti-15Mo-5Zr-3Al Acta Biomater. 7 2011 4267 4277 21888994 73 Svanborg L.M. Andersson M. Wennerberg A. Surface characterization of commercial oral implants on the nanometer level J. Biomed. Mater. Res. B Appl. Biomater. 92 2010 462 469 19957360 74 Kubo K. Tsukimura N. Iwasa F. Cellular behavior on TiO2 nanonodular structures in a micro-to-nanoscale hierarchy model Biomaterials 30 2009 5319 5329 19589591 75 Heo D.N. Ko W.K. Lee H.R. Titanium dental implants surface-immobilized with gold nanoparticles as osteoinductive agents for rapid osseointegration J. Colloid Interface Sci. 469 2016 129 137 26874978 76 Sanchez C. Arribart H. Guille M.M. Biomimetism and bioinspiration as tools for the design of innovative materials and systems Nat. Mater. 4 2005 277 288 15875305 77 Spatz J.P. Nano- and micropatterning by organic–inorganic templating of hierarchical self-assembled structures Angew Chem. Int. Ed. Engl. 41 2002 3359 3362 12298032 78 Dalby M.J. Gadegaard N. Curtis A.S. Nanotopographical control of human osteoprogenitor differentiation Curr. Stem Cell Res. Ther. 2 2007 129 138 18220898 79 Jager M. Zilkens C. Zanger K. Significance of nano- and microtopography for cell-surface interactions in orthopaedic implants J. Biomed. Biotechnol. 8 2007 69036 80 Ueno T. Tsukimura N. Yamada M. Enhanced boneintegration capability of alkali- and heat-treated nanopolymorphic titanium in micro-to-nanoscale hierarchy Biomaterials 32 2011 7297 7308 21742375 81 Ogawa T. Saruwatari L. Takeuchi K. Ti nano-nodular structuring for bone integration and regeneration J. Dent. Res. 87 2008 751 756 18650547 82 Li L.H. Kong Y.M. Kim H.W. Improved biological performance of Ti implants due to surface modification by micro-arc oxidation Biomaterials 25 2004 2867 2875 14962565 83 Lim Y.W. Kwon S.Y. Sun D.H. Kim H.E. Kim Y.S. Enhanced cell integration to titanium alloy by surface treatment with microarc oxidation: a pilot study Clin. Orthop. Relat. Res. 467 2009 2251 2258 19434468 84 Jeon O. Alsberg E. Photofunctionalization of Alginate hydrogels to promote adhesion and proliferation of human mesenchymal stem cells Tissue Eng. A19 2013 11 12 85 Aita H. Att W. Ueno T. Ultraviolet light-mediated photofunctionalization of titanium to promote human mesenchymal stem cell migration, attachment, proliferation and differentiation Acta Biomater. 5 8 2009 3247 3257 19427421 86 Tabuchi M. Ikeda T. Hirota M. Effect of UV photofunctionalization on biologic and anchoring capability of orthodontic miniscrews Int. J. Oral Maxillofac. Implants 30 4 2015 868 879 26252039 87 Crismani A.G. Bertl M.H. Celar A.G. Miniscrews in orthodontic treatment: review and analysis of published clinical trials Am. J. Orthod. Dentofac. Orthop. 137 1 2010 108 113 88 Hirota M. Ikeda T. Tabuchi M. Effect of ultraviolet-mediated photofunctionalization for bone formation around medical titanium mesh J. Oral Maxillofac. Surg. 72 9 2014 1691 1702 25109583 89 Matsuura K. Utoh R. Nagase K. Cell sheet approach for tissue engineering and regenerative medicine J Contr. Release 190 C 2014 228 239 90 Ishijima M. Hirota M. Park W. Osteogenic cell sheets reinforced with photofunctionalized micro-thin titanium J. Biomater. Appl. 29 10 2015 1372 1384 25604095 91 Zhang Z. Wang K. Bai C. The influence of UV irradiation on the biological properties of MAO-formed ZrO2 Colloids Surf. B Biointerfaces 89 2012 40 47 21920713 92 Sollazzo V. Pezzetti F. Scarano A. Zirconium oxide coating improves implant osseointegration in vivo Dent. Mater. 24 3 2008 357 361 17640724 93 Tuna T. Wein M. Swain M. Influence of ultraviolet photofunctionalization on the surface characteristics of zirconia-based dental implant materials Dent. Mater. 31 2 2015 14 24 94 Chevalier J. What future for zirconia as a biomaterial? Biomaterials 27 2006 535 543 16143387 95 Chevalier J. Loh J. Gremillard L. Low-temperature degradation in zirconia with a poroussurface Acta Biomater. 7 2011 2986 2993 21414426 96 Att W. Takeuchi M. Suzuki T. Enhanced osteoblast function on ultraviolet light-treated zirconia Biomaterials 30 7 2009 1273 1280 19095298 97 Han Y. Yan Y. Lu C. Ultraviolet-enhanced bioactivity of ZrO2 films prepared by micro-arc oxidation Thin Solid Films 517 5 2009 1577 1581 98 Giljohann D.A. Seferos D.S. Daniel W.L. Gold nanoparticles for biology and medicine Angew Chem. Int. Ed. Engl. 49 19 2010 Apr 26 3280 3294 20401880 99 Dykman L. Khlebtsov N. Gold nanoparticles in biomedical applications: recent advances and perspectives Chem. Soc. Rev. 41 6 2012 Mar 21 2256 2282 22130549 100 Boisselier E1 Astruc D. Gold nanoparticles in nanomedicine: preparations, imaging, diagnostics, therapies and toxicity Chem. Soc. Rev. 38 6 2009 Jun 1759 1782 19587967 101 Ghosh P. Han G. De M. Gold nanoparticles in delivery applications Adv. Drug Deliv. Rev. 60 2008 1307 1315 18555555 102 Dykman L.A. Khlebtsov N.G. Immunological properties of gold nanoparticles Sci. Chem. Sci. 8 3 2017 Mar 1 1719 1735 28451297 103 Kumar A. Zhang X. Liang X.-J. Gold nanoparticles: emerging paradigm for targeted drug delivery system Biotechnol. Adv. 31 2013 593 606 23111203 104 Niikura K. Matsunaga T. Suzuki T. Gold nanoparticles as a vaccine platform: influence of size and shape on immunological responses in vitro and in vivo ACS Nano 7 2013 3926 3938 23631767 105 Yi C. Liu D. Fong C.-C. Gold nanoparticles promote osteogenic differentiation of mesenchymal stem cells through p38 MAPK pathway ACS Nano 4 2010 6439 6448 21028783 106 Mu Q.X. Broughton D.L. Endosomal leakage and nuclear translocation of multiwalled carbon nanotubes: developing a model for cell uptake Nano Lett. 9 2009 4370 4375 19902917 107 Porter A.E. Gass M. Bendall J.S. Uptake of noncytotoxic acid-treated single-walled carbon nanotubes into the cytoplasm of human macrophage cells ACS Nano 3 2009 1485 1492 19459622 108 Xiao G. Jiang D. Thomas P. MAPK pathways activate and phosphorylate the osteoblast-specific transcription factor, Cbfa1 J. Biol. Chem. 275 2000 4453 4459 10660618 109 Jaiswal R.K. Jaiswal N. Bruder S.P. Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen-activated protein kinase J. Biol. Chem. 275 2000 9645 9652 10734116 110 Ziros P.G. Gil A.P. Georgakopoulos T. The bone- specific transcriptional regulator Cbfa1 is a target of mechanical signals in osteoblastic cells J. Biol. Chem. 277 2002 23934 23941 11960980 111 Liu D. Zhang J. Yi C. The effects of gold nanoparticles on the proliferation, differentiation, and mineralization function of MC3T3-E1 cells in vitro Chin. Sci. Bull. 55 2010 1013 1019 112 Sul O.-J. Kim J.-C. Kyung T.-W. Gold nanoparticles inhibited the receptor activator of nuclear factor-κb ligand (RANKL)-induced osteoclast formation by acting as an antioxidant Biosci. Biotechnol. Biochem. 74 2010 2209 21071867 113 Yi C.Q. Fong C.C. Chen W.W. Interactions between carbon nanotubes and DNA polymerase and restriction endonucleases Nanotechnology 18 2007 025102 114 Zhang D. Liu D. Zhang J. Gold nanoparticles stimulate differentiation and mineralization of primary osteoblasts through the ERK/MAPK signaling pathway Mater. Sci. Eng. C 42 2014 70 77 115 Ko W.K. Heo D.N. The effect of gold nanoparticle size on osteogenic differentiation of adipose-derived stem cells J. Colloid Interface Sci. 438 2015 68 76 25454427 116 Miyaza T. Kim H.M. Kokubo T. Mechanism of bonelike apatite formation on bioactive tantalum metal in a simulated body fluid Biomaterials 23 3 2002 827 832 11771702 117 Wang X.X. Hayakawa S. Tsuru K. A comparative study of in vitro apatite deposition on heat-, H(2)O(2)-, and NaOH-treated titanium surfaces J. Biomed. Mater. Res. 54 2 2001 172 178 11093176 118 Kokubo T. Takadama H. How useful is SBF in predicting in vivo bone bioactivity? Biomaterials 27 2006 2907 2915 16448693 119 Kim H.M. Miyaji F. Kokubo T. Bonding strength of bone-like apatite layer to Ti metal substrate J. Biomed. Mater. Res. 38 2 1997 121 127 9178739 120 Ajami E. Aguey-Zinsou K.F. Calcium phosphate growth at electropol-ished titanium surfaces J. Funct. Biomater. 3 2 2012 327 348 24955535 121 Havitcioglu H. Cecen B. Pasinli A. In vivo investigation of calcium phosphate coatings on Ti6-Al-4V alloy sub-strates using lactic acid – sodium lactate buffered synthetic body fluid Acta Orthop. Traumatol. Turc. 47 6 2013 417 422 24509222 122 Sandrini E. Giordano C. Busini V. Apatite formation and cellular response of a novel bioactive titanium J. Mater. Sci. Mater. Med. 18 6 2007 1225 1237 17277983 123 Kokubo T. Kim H.M. Kawashita M. Bioactive metals: preparation and properties J. Mater. Sci. Mater. Med. 15 2 2004 99 107 15330042 124 Moroni L. Fornasari P.M. Human mesenchymal stem cells: a bank perspective on the isolation, characterization and potential of alternative sources for the regeneration of musculoskeletal tissues J. Cell. Physiol. 228 2013 680 687 22949310 125 Wu L. Cai X. Zhang S. Regeneration of articular cartilage by adipose tissue derived mesenchymal stem cells: perspective from stem cell biology and molecular medicine J. Cell. Physiol. 228 2013 938 944 23042088 126 Undale Anita H. Westendorf Jennifer J. Mesenchymal stem cells for bone repair and metabolic bone diseases Mayo Clin. Proc. 84 10 2009 Oct 893 902 19797778 127 Qin Yunhao Guan Junjie Zhang Changqing Mesenchymal stem cells: mechanisms and role in bone regeneration Postgrad. Med. J. 90 1069 2014 Nov 643 647 25335795 128 Yue Y. Yang X. Wei X. Osteogenic differentiation of adipose-derived stem cells prompted by low-intensity pulsed ultrasound Cell Prolif. 46 2013 320 327 23692090 129 Liu L. Yuan W. Wang J. Mechanisms for osteogenic differentiation of human mesenchymal stem cells induced by fluid shear stress Biomech. Model Mechanobiol. 9 2010 659 670 20309603 130 Wei N. Bin S. Jing Z. Influence of implant surface topography on bone-regenerative potential and mechanical retention in the human maxilla and mandible Am. J. Dent. 27 3 2014 Jun 171 176 25208367 131 Wennerberg A. Albrektsson T. Effects of titanium surface topography on bone integration: a systematic review Clin. Oral Implants Res. 20 Suppl. 4 2009 Sep 172 184 19663964 132 Hao J. Li Y. Li B. Biological and mechanical effects of micro-nanostructured titanium surface on an osteoblastic cell line in vitro and osteointegration in vivo Appl. Biochem. Biotechnol. 2017 Mar 20 133 Lim J.Y. Shaughnessy M.C. Zhou Z. Surface energy effects on osteoblast spatial growth and mineralization Biomaterials 29 2008 1776 1784 18222536 134 Lai H.C. Zhuang L.F. Liu X. The influence of surface energy on early adherent events of osteoblast on titanium substrates J. Biomed. Mater. Res. A 93 2010 289 296 19562750 135 Qu Z. Rausch-Fan X. Wieland M. The initial attachment and subsequent behavior regulation of osteoblasts by dental implant surface modification J. Biomed. Mater. Res. A 82 2007 658 668 17323317 136 Saita Makiko Ikeda Takayuki UV photofunctionalization promotes nano-biomimetic apatite deposition on titanium Int. J. Nanomed. 11 2016 223 234 137 Dohan Ehrenfest D.M. Coelho P.G. Kang B.S. Classification of osseointegrated implant surfaces: materials, chemistry and topography Trends Biotechnol. 28 4 2010 198 206 20116873 138 Li J. Li J.J. Zhang J. Gold nanoparticle size and shape influence on osteogenesis of mesenchymal stem cells Nanoscale 8 15 2016 Apr 21 7992 8007 27010117 139 Kadler Karl E. Holmes David F. Trotter John A. Collagen fibril formation Biochem. J. 316 1 May 15, 1996 1 11 8645190 140 Mahmoudi Morteza Lynch Iseult Reza Ejtehadi Mohammad Protein−nanoparticle interactions: opportunities and challenges Chem. Rev. 111 9 2011 5610 5637 21688848 141 Castillo Diaz Luis A. Elsawy Mohamed Osteogenic differentiation of human mesenchymal stem cells promotes mineralization within a biodegradable peptide hydrogel J. Tissue Eng. 2016 Jan-Dec 7 142 De Fusco Carolina Messina Antonietta Osteopontin: relation between adipose tissue and bone homeostasis Stem Cells Int 2017 4045238 28194185 143 Kothari A.N. Arffa M.L. Chang V. Osteopontin—a master regulator of epithelial-mesenchymal transition J. Clin. Med. 5 4 2016 39 144 Lee N.K. Sowa H. Hinoi E. Endocrine regulation of energy metabolism by the skeleton Cell 130 3 Aug 2007 456 469 17693256 145 Bharadwaj S. Naidu A.G. Betageri G.V. Milk ribonuclease-enriched lactoferrin induces positive effects on bone turnover markers in postmenopausal women Osteoporos. Int. 20 9 Sep 2009 1603 1611 19172341 146 Štefková K. Procházková J. Pacherník J. Alkaline phosphatase in stem cells Stem Cell. Int. 2015 2015 628368 147 Grabinski C. Schaeublin N. Wijaya A. Effect of gold nanorod surface chemistry on cellular response ACS Nano 5 2011 2870 2879 21405102 148 Heo D.N. Ko W.K. Moon H.J. Inhibition of osteoclast differentiation by gold nanoparticles functionalized with cyclodextrin curcumin complexes ACS Nano 8 2014 12049 12062 25420230 149 Suarasan S. Focsan M. Soritau O. One-pot, green synthesis of gold nanoparticles by gelatin and investigation of their biological effects on osteoblast cells Colloids Surf. B 132 2015 122 131 150 Wall I. Donos N. Carlqvist K. Modified titanium surfaces promote accelerated osteogenic differentiation of mesenchymal stromal cells in vitro Bone 45 2009 17 26 19332166 151 Kieswetter K. Schwartz Z. Hummert T.W. Surface roughness modulates the local production of growth factors and cytokines by osteoblast-like MG-63 cells J. Biomed. Mater. Res. 32 1996 55 63 8864873 152 Olivares-Navarrete R. Hyzy S.L. Hutton D.L. Direct and indirect effects of microstructured titanium substrates on the induction of mesenchymal stem cell differentiation towards the osteoblast lineage Biomaterials 31 2010 2728 2735 20053436 153 Schwartz Z. Lohmann C.H. Oefinger J. Implant surface characteristics modulate differentiation behavior of cells in the osteoblastic lineage Adv. Dent. Res. 13 1999 38 48 11276745 154 Lossdorfer S. Schwartz Z. Wang L. Microrough implant surface topographies increase osteogenesis by reducing osteoclast formation and activity J. Biomed. Mater. Res. A 70 2004 361 369 15293309 155 Lincks J. Boyan B.D. Blanchard C.R. Response of MG63 osteoblast-like cells to titanium and titanium alloy is dependent on surface roughness and composition Biomaterials 19 1998 2219 2232 9884063 156 Batzer R. Liu Y. Cochran D.L. Prostaglandins mediate the effects of titanium surface roughness on MG63 osteoblast-like cells and alter cell responsiveness to 1α,25-(OH)2D3 J. Biomed. Mater. Res. 41 1998 489 496 9659620 157 Boyan B.D. Batzer R. Kieswetter K. Titanium surface roughness alters responsiveness of MG63 osteoblast-like cells to 1α,25-(OH)2D3 J. Biomed. Mater. Res. 39 1998 77 85 9429099 158 Palin E. Liu H. Webster T. Mimicking the nanofeatures of bone increases bone-forming cell adhesion and proliferation Nanotechnology 16 2005 9