==== Front
Genomics Proteomics BioinformaticsGenomics Proteomics BioinformaticsGenomics, Proteomics & Bioinformatics1672-02292210-3244Elsevier S1672-0229(18)30166-910.1016/j.gpb.2018.07.001CorrigendumCorrigendum to “GoldCLIP: Gel-omitted Ligation-dependent CLIP” [Genomics Proteomics Bioinformatics 16 (2) (2018) 136–143] Gu Jiaqi 12#aWang Ming 2#bYang Yang 3#cQiu Ding 2dZhang Yiqun 2eMa Jinbiao majb@fudan.edu.cn1⁎fZhou Yu yu.zhou@whu.edu.cn3⁎gHannon Gregory J. greg.hannon@cruk.cam.ac.uk4⁎hYu Yang yuyang@ibp.ac.cn2⁎i1 State Key Laboratory of Genetic Engineering, Department of Biochemistry, School of Life Sciences, Fudan University, Shanghai 200438, China2 CAS Key Laboratory of RNA Biology, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China3 Hubei Key Laboratory of Cell Homeostasis, College of Life Sciences, Wuhan University, Wuhan 430072, China4 Cancer Research UK, Li Ka Shing Centre, University of Cambridge, Cambridge CB2 ORE, United Kingdom⁎ Corresponding authors. majb@fudan.edu.cnyu.zhou@whu.edu.cngreg.hannon@cruk.cam.ac.ukyuyang@ibp.ac.cn# Equal contribution.

a ORCID: 0000-0002-5304-1688.

b ORCID: 0000-0002-1959-4879.

c ORCID: 0000-0003-0715-4283.

d ORCID: 0000-0002-0807-1749.

e ORCID: 0000-0001-8691-7722.

f ORCID: 0000-0002-0232-1786.

g ORCID: 0000-0002-2102-9377.

h ORCID: 0000-0003-4021-3898.

i ORCID: 0000-0003-0536-2783.

20 7 2018 6 2018 20 7 2018 16 3 221 222 © 2018 The Authors2018This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
==== Body
The authors regret there was a typo for a critical nucleotide in the sequence of the RNA adapter listed in the subsection “GoldCLIP-seq library preparation” of the main text and the 3′ RNA linker listed as a primer in the associated File S1. The RNA adapter/linker sequence “/5′P/AGGTCGGAAGAGCGGTTCAG/3′ddC/” should be corrected to “/5′P/AGATCGGAAGAGCGGTTCAG/3′ddC/”. The correct content in this subsection is shown below. The authors would like to apologize for any inconvenience caused.

GoldCLIP-seq library preparation
In a typical GoldCLIP experiment, ∼1 × 107 HEK 293T cells expressing the Halo-PTB fusion protein were crosslinked using UVP crosslinker at either UVC (254 nm, 400 mJ/cm2) or UVA (365 nm, 400 mJ/cm2, pre-incubated for 16 h with media containing 100 μM 4-thiouridine). Crosslinked cells were then scraped off the plates and mixed with ∼5 × 105 of Drosophila S2 cells expressing a Halo-CG7544 fusion protein (serving as an internal normalizing control), dounced with type B pestle in lysis buffer (see above) and digested using micrococcal nuclease (1:1000; catalog No. M0247S; New England Biolabs) for 3 min at 37 °C. Magne® HaloTag® Beads (catalog No. G7281; Promega) were incubated with the lysates with rotation at 4 °C for about 10–16 h. Beads associated with Halo-PTB complexes were first washed with PBST (PBS + 0.1% Triton X-100), dephosphorylated with calf intestinal phosphatase (catalog No. M0290S; New England Biolabs) at 37 °C for 30 min. Then the beads were washed with Trizol LS reagent and equilibrated with 8 M urea. The beads were then washed five times with PNK buffer containing 50 mM Tris–HCl (pH 8.0), 10 mM MgCl2, and 1% Triton X-100. The RNAs crosslinked with the PTB proteins were ligated with an RNA adapter (/5′P/AGATCGGAAGAGCGGTTCAG/3ddC/) at 3′ end using T4 RNA Ligase I (catalog No. AM2141; Ambion) on beads at 16 °C overnight. Then, further denaturing washes using the buffers containing either 8 M guanidine, 8 M urea or 10% SDS were applied to the beads to completely remove non-covalent contaminants. Finally, PTB–RNA complexes were cleaved off the beads by TEV protease and digested with protease K (catalog No. P8102S; New England Biolabs) at 37 °C for 30 min. The RNA–peptide adducts were cloned following the iCLIP library cloning protocol [11].

The detailed protocol for GoldCLIP-seq is provided in File S1.

Supplementary material
The following are the Supplementary data to this article:Supplementary data 1
 

Peer review under responsibility of Beijing Institute of Genomics, Chinese Academy of Sciences and Genetics Society of China.

Supplementary material associated with this article can be found, in the online version, at https://doi.org/10.1016/j.gpb.2018.07.001.