==== Front Ann Saudi MedAnn Saudi MedAnnals of Saudi Medicine0256-49470975-4466King Faisal Specialist Hospital and Research Centre 2723639510.5144/0256-4947.2016.223asm-3-223Original ArticleMolecular investigation of extended-spectrum beta-lactamase genes and potential drug resistance in clinical isolates of Morganella morganii Al-Muhanna Abbas S. aAl-Muhanna Sddiq aAlzuhairi Maytham A. ab a Department of Biology, University of Kufa, An Najaf, Iraq b Department of Clinical Laboratory, Al-Furat Al-Awsat Technical University, Kufa, An Najaf, IraqCorrespondence: Dr. Abbas Sh. Al-Muhanna, Department of Biology, University of Kufa, Al Kufa Main Road, An Najaf, Iraq 54001, T: +964-781-544-0226, alzahare1985@yahoo.com, ORCID ID: http://orcid.org/0000-0003-4525-6328May-Jun 2016 36 3 223 228 Copyright © 2016, Annals of Saudi Medicine2016This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.BACKGROUND Resistance to beta-lactam antibiotics has become more common in Morganella morganii, which can cause of outbreaks of bacteremia and septicemia in postoperative patients. OBJECTIVE Investigate drug susceptibility of M morganii, identify the gene responsible for extended-spectrum beta-lactamase (ESBL) production and explore treatment options. DESIGN Descriptive study. SETTING Hospitals in An Najaf, Iraq. METHODS M morganii isolates were identified based on morphology, biochemical tests and VITEK® 2 compact system using (GN-ID) card. M morganii isolates were subjected to antibiotic resistance tests using the minimum inhibitory concentration (MIC) technique and an antibiogram was produced. Molecular studies were conducted using the polymerase chain reaction technique. MAIN OUTCOME MEASURE (S) Minimum inhibitory concentration. RESULTS From 395 gram-negative bacteria, only 17 isolates M morganii grew on MacConkey agar. M morganii isolates strongly resistant to several antibiotics were considered multidrug resistant. All M morganii isolates were ESBL producers. Four genes (CTX-M, SHV, TEM and OXA) encoding the β-lactamase enzyme were detected. Meropenem and imipenem were highly active against the M morganii isolates. CONCLUSIONS All isolates showed resistance to most common antibiotics, which limits options for treatment. This study provided useful information for selecting antibiotics to precisely target infections caused by M morganii. LIMITATIONS Limited to antibiotic susceptibility and genotype. ==== Body Morganella morganii is a rod-shaped gram-negative bacteria, a member of the tribe Proteeae of the family Enterobacteriaceae. The Proteeae, which consists of Morganella, Proteus and Providencia, are important opportunistic pathogens that cause a variety of nosocomial infections.1,2 Exposure of bacterial strains to β-lactam antibiotics has altered the dynamics of β-lactamase mutations, leading to an increase in activity against third- and fourth-generation cephalosporins such as cefepime, ceftazidime and cefotaxime as well as aztreonam.3 Like other Enterobacteriaceae, M morganii are naturally resistant to beta-lactam antibiotics, but resistance has become more common in M morganii, as demonstrated by the increased production of the so-called extended spectrum β-lactamases (ESBLs).4,5 M morganii has been implicated in outbreaks of bacteraemia and septicemia in humans that occur most commonly in postoperative patients.6,7 The majority of the known gene cassettes confer resistance to antibiotics.8 The integration of most β-lactamase genes in plasmids and transposons encourages rapid transferance of resistance genes between microbes.9 The β-lactamase genes are often found within the integrons with multi-drug resistance cassettes which are involved in resistance to chloramphenicol, aminoglycosides, sulphonamides and macrolides.10 Third-generation cephalosporins, referred to as extended-spectrum cephalosporins, which include ceftriaxone, ceftazidime, and cefotaxime, were effective against ampicillin hydrolyzing β-lactamases and gained wide-spread clinical use. However, within a few years of their introduction, hospital-acquired gram-negative bacilli (such as Klebsiella pneumonia) started producing a mutated version of β-lactamases called extended spectrum β-lactamases (ESBLs) and plasmid-mediated AmpC β-lactamases that conferred resistance to third-generation cephalosporins.11 The wide spectrum of β-lactamases represented by TEM-1 and SHV-1 gave rise to the name “extended spectrum” beta-lactamses (ESBL), which later involved CTX-M and OXA-type enzymes. 9 These enzymes are capable of hydrolyzing and inactivating a wide variety of therapeutic β-lactam antimicrobials. 12 The purpose of our study was to investigate drug susceptibility of M morganii at hospitals in the city of Najaf, Iraq, identify the gene responsible for extended-spectrum beta-lactamase (ESBL) production and explore treatment options. PATIENTS AND METHODS Samples collection Clinical samples were collected from November 2014 to February 2015. These samples were collected from patients at different hospitals in An Najaf, Iraq (Alsader Teaching Hospital, Al Najaf General Hospital and Al-Furat Al-Awsat hospital). All samples were inoculated onto MacConkey agar plates and incubated at 37°C under aerobic conditions for 18 to 24 hours. Isolation and identification of the microorganism M morganii isolates were recovered from clinical samples after culturing on MacConkey agar, which incubated for overnight at 37°C. Identification was based on morphology, gram staining, and biochemical tests (catalase, oxidase, methyl red, citrate, indole, Voges-Proskauer, Kligler iron agar, motility, urease, gelatin liquefaction and lactose). The VITEK® 2 compact system was used to carry out final identification. Antibiogram testing Antibiogram testing was carried out using the VITEK® 2 system according to manufacturer instructions using ASTN093 cards. The following antibiotics were tested by ASTN093: piperacillin-tazobactam, piperacillin, ticarcillin, ticarcillin-clavulanic acid, ceftazidime, cefepime, aztreonam, meropenem, imipenem, isepamicin, tobramycin, amikacin, gentamicin, pefloxacin, ciprofloxacin, trimethoprimsulfamethoxazole, minocycline, colistin and rifampicin. Extended-spectrum β-lactamase production All bacterial isolates were tested for extend spectrum-spectrum β-lactamase by an initial screening test depending on the MIC results for ceftazidime with the VITEK® 2 compact system. The isolate was considered a potential ESBL producer if the ceftazidime MIC was ≥2 μg/mL (CLSI, 2012). The disk approximation test was used to confirm ESBL production. The test involves 30 μg antibiotic disks of ceftazidime, ceftriaxione, cefotaxime and azetreonam placed 15 mm apart (edge to edge) around a central disk of amoxicillin-clavulanate disk (20:10μg) on Muller-Hinton agar plates inoculated with the organism being tested for ESBL production. The augmentation (increase in diameter of inhibition zone) between the central amoxicillin-clavulanate disk and β-lactam antibiotic disks reflects antibiotic resistance and the organism was recorded as an ESBL producer. 13 Isolation of plasmid DNA and polymerase chain reaction Plasmid DNA was extracted by the alkaline method according to manufacturer instructions (G-Biosciences, USA). The polymerase chain reaction (PCR) test was carried out in a final volume of 25 μL containing a 4 μL template DNA, 12.5 μL of 2X KABA2G Robust HotStart ReadyMix, 1.25 μL of forward primer, 1.25 μL of reserve primer and 6 μL of PCR grade water for each sample. The DNA amplification was performed for the blaCTX-M gene by an initial denaturation at 94°C for 3 min, denaturation at 94°C for 45 sec, annealing 60°C for 30 sec, extension 72°C for 1 min and final extension 72°C for 3 min followed by 35 cycles of amplification. For the blaSHV gene an initial denaturation at 94°C for 3 min, denaturation at 94°C for 1 min, annealing 55 °C for 1 min, extension 72°C for 1 min and final extension 72°C for 7 min was followed by 40 cycles of amplification. For the blaTEM gene an initial denaturation at 94°C for 5 min, denaturation 94°C for 1 min, annealing 55°C for 1 min, extension 72°C for 30 sec and final extension 72°C for 5 min was followed by 35 cycles of amplification. For the blaOXA gene an initial denaturation at 94°C for 5 min, denaturation at 94°C for 45 sec, annealing 55°C for 45 sec, extension 72°C for 1 min and final extension 72°C for 5 min was followed by 30 cycles of amplification. PCR products were separated on 1 % agarose gel and visualized using a transilluminator (BIO-RAD, USA). Statistical analysis The Microsoft Excel (Package 2007) was used to compile the data. RESULTS During the study interval from November 2014 to February 2015, clinical samples were collected from 800 patients (Table 1). All M morganii isolates were resistant to a minimum of three classes of antibiotics to which they were tested, and this were considered multidrug resistant (MDR) (Figure 1). All isolates were resistant to piperacillin, piperacillin-tazobactam, and aztreonam, with lower rates of resistance to ticarcillin and ticarcillin-clavulanic acid, with the lowest rates to imipenem and meropenem. Figure 1 shows the rates of resistance and sensitivity for other antibiotics. The aminoglycosides had a high-to-moderate effect against M morganii isolates, while most isolates were resistant to fluoroquinolones, colistin and rifampicin. Results of susceptibility revealed that none of the isolates was fully resistant or susceptible to antibiotics tested. The ceftazidime MIC results from the VITEK® 2 compact system showed that all M morganii isolates (n=17) were ESBL producers during the initial screening (Table 2). The phenotypic confirmatory test using the disk approximation method confirmed the ability of M morganii isolates to produce ESBLs. All M morganii isolates (n=17) were ESBL positive on the phenotypic confirmatory test (Figure 2). Table 3 shows the specific primers used to detect extended-spectrum β-lactamase genes (CTX-M, SHV, TEM and OXA) from the 17 isolates of M morganii.14–17 Of the 17 M morganii isolates, 16 carried at least one type of blagene (Figures 3, 4, 5 and 6). However, the most commonly identified ESBL gene was blaCTX-M type in 15 of the isolates (Figure 3). PCR amplification using specific primers of the blaSHV gene found the gene in 10 isolates (Figure 4). The blaTEM gene was detected in six isolates (Figure 5). Finally, only two of the examined isolates harbored a gene for the OXA type enzyme (Figure 6). DISCUSSION Much evidence supports the hypotheses that two factors largely contribute to the development and spread of antimicrobial resistance: the transmission of plasmids between microbes and poor selection of antimicrobials for treatment of infections. Plasmid-mediated antimicrobial resistance from horizontal transmission of plasmids is a global threat.18 In the present study, M morganii isolates were highly resistant to many antimicrobials (cephalosporins, ceftazidime and cefepime). However, resistance to third-generation cephalosporins occurred mainly by mutations in the common group of class A β-lactamases that include TEM, SHV and CTX-M.19 We found high resistance to third-generation cephalosporins such as ceftazidime that may be due to the production of cefotaximases encoded by the CTX-M gene. These CTX-Ms appear to have more activity toward cefotaxime than ceftazidime.20 We found intermediate resistance (47%) toward ticarcillin/clavulanic acid. Although β-lactamase inhibitors prevent the inactivation of the β-lactam antibiotics, they have low antimicrobial activity themselves.21 Since high susceptibility rates to imipenem and meropenem (88.2% and 94.1%, respectively) were found among M morganii isolates, this study shows that those two β-lactam antibiotics are the most effective against M morganii, a finding consistent with previous data by researchers from Greece and China.2,22 In this study, ceftazidime resistance was chosen to detect ESBL producers because it is the best third-generation cephalosporin substrate for most TEM, SHV and CTX-M derived ESBLs.23,24 The CTX-M genes are a recent family of plasmid-mediated ESBLs; some of them are part of transposons or constitute gene cassettes in integrons.25,26 The blaSHV gene was detected in 10 isolates. The SHV β-lactamases enzymes are mainly found in gram-negative bacteria.27 These enzymes possess variants of substituted serine instead of glycine at position 238 and lysine instead of glutamate at position 240.28 There are more than 125 SHV varieties described worldwide.29 The SHV β-lactamases were the predominant ESBL types in Europe and the United States.30 The blaTEM gene was detected in six of the tested M morganii isolates. The TEM-ESBLs are the first plasmid-mediated β-lactamase that are detected in many genera of Enterobacteriaceae such as Proteus mirabilis and Klebsiella pneumonia, E coli; and also in non-Enterobacteriaceae like Pseudomonas aeruginosa.31 Finally, two of the M morganii isolates harbored the blaOXA gene. However, most of the OXA derivative genes are located in plasmids and integrons,32 while some OXA-type β-lactamases are encoded by chromosomal genes that appear to be resident in some microbial genomes such as those in Pseudomonas aeruginosa.33 The integrons that harbor co-resistance genes make it a useful tool for facilitating dissemination.34,35 Our study was limited to antibiotic susceptibility and genotype testing. further study using sequencing technology and proteomic analysis is recommended. In summary, M morganii harbors several beta-lactamases genes and shows resistance to most common antibiotics, which limit options for treatment. This study provided useful information for seleccting antibiotics to precisely target infections caused by M morganii. Figure 1 Antibiogram testing of Morganella morganii isolates with the automated VITEK® 2 compact system by using AST-N093 cards (n=17). PIP, Piperacillin; TIC, Ticarcillin; TZP, Piperacillin-tazobactam; TCC, Ticarcillin-clavulanic acid; FEP, Cefepime; CAZ, Ceftazidime; FOX, Cefoxitin; ATM, Aztreonam; IPM, Imipenem; MEM, Meropenem; AN, Amikacin; ISP, Isepamicin; TM, Tobramycin; GN, Gentamicin; PEF, Pefloxacin; CIP, Ciprofloxacin; SXT, Trimethoprim-sulfamethoxazole; MNO, Minocycline; CS, Colistin and RA, Rifampicin. Figure 2 Show positive result of phenotypic confirmatory test for ESBL. Figure 3 blaCTX-M gene with amplified product 569bp. Figure 4 blaSHV gene with amplified product 867 bp. Figure 5 blaTEM gene with amplified product 717 bp. Figure 6 blaOXA gene with amplified product 619 bp. Table 1 Sources and distribution of clinical samples according to type of infection. Infection type Samples No. Bacterial growth No. (%) Yielded no growth No. (%) Urinary tract infection 400 207 (51.8) 193 (48.2) Ear infection 200 119 (59.5) 81 (40.5) Respiratory tract infection 200 69 (34.5) 131 (65.5) Total (%) 800 395 (49.4) 405 (50.6) Table 2 Minimum inhibitory concentration (MIC) ranges for each antibiotic for Morganella morganii isolates. Antibiotic MIC range (μg/ml) Antibiotic MIC range (μg/ml) Cefepime 4 – ≥64 Gentamicin 2 – ≥16 Ceftazidime 32 – ≥64 Pefloxacin 0.5 ≥16 Aztreonam 32 – ≥64 Ciprofloxacin 0.5 ≥4 Imipenem 2 – ≥16 Trimethoprimsulfamethoxazole ≤20 – ≥320 Meropenem 0.5 – ≥16 Minocycline 8 – ≥16 Amikacin 8 – ≥64 Colistin ≥16 Isepamicin 8 – ≥64 Rifampicin ≥32 Tobramycin 2 – ≥16 Table 3 Primer sequences for detection of extended-spectrum beta-lactamase genes. No. Target gene Primer sequence Amplicaon Size (bP) References 1 blaCTX-M F CGCTGTTGTTAGGAAGTGTG R GGCTGGGTGAAGTAAGTGAC 569 14 2 blaOXA F ATATCTCTACTGTTGCATCTCC R AAACCCTTCAAACCATCC 619 15 3 blaTEM F TGCAACAGTGCCTCTCGATA R CTCGTGCACCCAACTGATCT 717 16 4 blaSHV F GGTTATGCGTTATATTCGCC R GGTTAGCGTTGCCAGTGCTC 867 17 ==== Refs REFERENCES 1 Chen Y Peng H Shia W Hsu F Ken C Tsao Y Chen C Wholegenome sequencing and identification of Morganella morganii KT pathogenicity-related genes BMC Genomics 2012 13 4 11 22216965 2 Falagas ME Kavvadia PK Mantadakis E Kofteridis DP Bliziotis IA Saloustros E Maraki S Samonis G Morganella morganii infections in a general tertiary hospital Infection 2006 34 315 321 17180585 3 Samaha-Kfoury JN Araj GF Recent developments in b-lactamases and extended spectrum b-lactamases BMJ 2003 327 1209 1213 14630759 4 Al-Jasser AM Extended-specrum betalactamases (ESBLs): a global problem Kuwait Medical Journal 2006 38 3 171 185 5 Poirel L Guibert M Girlich D Naas T Nordmann P Cloning sequence analyses expression and distribution of amp-CampR from Morganella morganii clinical isolates Antimicrob Agents Chemother 1999 43 769 776 10103179 6 Rowen JL Lopez SM Morganella morganii early onset sepsis Pediatr Infect Dis J 1998 17 1176 1177 9877376 7 Manos J Belas R The Genera Proteus Providencia and Morganella Prokaryotes 2006 6 245 269 8 Fluit AC Schmitz FJ Class 1 integrons gene cassettes mobility and epidemiology Eur J Clin Microbiol Infect Dis 1999 18 761 770 10614949 9 Bradford PA Extended-spectrum b-lactamases in the 21st century: characterization epidemiology and detection of this important resistance threat Clinical Microbiology Reviews 2001 14 933 951 11585791 10 Eldhagen GF Integrons and b-lactamases-a novel perspective on resistance Int J Antimicrob AG 2004 23 556 562 11 Mocktar C Govinden U Sturm AW Essack SY CMY- 20 a novel AmpC-type beta-lactamase from South African clinical Escherichia coli isolates Diagn Micr Infec Dis 2008 60 405 408 12 Chaudhary U Aggarwal R Extended-spectrum b-lactamases (ESBL) An emerging threat to clinical therapeutics Indian Journal Med Microb 2004 22 75 80 13 Murray PR Baron EJ Pfaller MA Manual of Clinical Microbiology American Society for Microbiology Washington, DC, USA 7th edition 1999 14 Bali Elif Burcu Acik Leyla Sultan Nedim Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum beta-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital Afr J Microbiol Res 2010 4 8 650 654 15 Colom Karmele Pérez J Alonso R Fernández-Aranguiz A Lariño E Cisterna R Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and bla-OXA–1 genes in Enterobacteriaceae FEMS Microbiol Lett 2003 223 2 147 151 12829279 16 Sompolinsky D Nitzan Y Tetry S Wolk M Vulikh I Kerrn MB Katcoff DJ Integron-mediated ESBL resistance in rare serotypes of Escherichia coli causing infections in an elderly population of Israel J Antimicrob Chemother 2005 55 1 119 122 15574469 17 Wang C Cai P Chang D Mi Z A Pseudomonas aeruginosa isolate producing the GES-5 extended-spectrum β-lactamase J Antimicrob Chemother 2006 57 6 1261 1262 16617065 18 Carattoli A Plasmids in clinically significant Gram-negative bacteria report in European Infectious Disease Istituto Superiore di Sanità Rome 2008 7 116 118 19 Bush K Jacoby G Medeiros A A functional classification scheme for b-lactamases and its correlation with molecular structure Antimicrob Agents Chemother 1995 39 1211 1233 7574506 20 Walther-Rasmussen J Hoiby N Cefotaximases (CTX-Mases) an expanding family of extended-spectrum b-lactamases Can J Microbiol 2004 50 137 165 15105882 21 Marti MS Molecular bases of antimicrobial resistance in Acinetobacter spp. clinical isolates PhD Thesis Faculty of Medicine University of Barcelona 2008 22 Cai JC Yang W Hu YY Zhang R Zhou HW Chen GX Detection of KPC-2 and qnrS1 in clinical isolates of Morganella morganii from China Diagn Micr Infec Dis 2012 73 207 209 23 Livermore DM Brown DFJ Detection of b-lactamasemediated resistance Antimicrob Chemother 2001 48 59 64 24 Aggarwal R Chaudhary U Extended spectrum b-lactamases (ESBL) an emerging threat to clinical therapeutics Indian J Med Microbiol 2004 22 75 80 17642700 25 Livermore DM Canton R Gniadkowski M Nordmann P Rossolini GM Arlet G Ayala J CTX-M: changing the face of ESBLs in Europe J Antimicrob Chemother 2007 59 165 174 17158117 26 Bonnet R Growing group of extended-spectrum b-lactamases: the CTX-M enzymes Antimicrob Agents Chemother 2004 48 1 14 14693512 27 Huang ZM Mao PH Chen Y Wu L Wu J Study on molecular epidemiology of SHV type beta-lactamase encoding genes of multiple-drug- resistant Acinetobacter baumannii Zhonghua Liu Xing Bing Xue Za Zhi 2004 25 425 427 15231171 28 Poole K Resistance to b-lactam antibiotics Cell Mol Life Sci 2004 61 2200 2223 15338052 29 Heritage John M’Zali Fatima H Gascoyne-Binzi Deborah Hawkey Peter M Evolution and spread of SHV extended-spectrum b-lactamases in Gram-negative bacteria J Antimicrob Chemother 1999 44 3 309 318 10511397 30 Paterson DL Hujer KM Hujer AM Yeiser B Bonomo MD Rice LB Bonomo RA the International Klebsiella Study Group Extended-spectrum b-lactamases in Klebsiella pneumoniae blood stream isolates from seven countries: dominance and widespread prevalence of SHV- and CTX-M-type b-lactamases Antimicrob Agents Chemother 2003 47 3554 3560 14576117 31 Shah AA Hasan F Ahmed S Hameed A Characteristics epidemiology and clinical importance of emerging strains of Gram-negative bacilli producing extendedspectrum betalactamases Res Microbiol 2004 155 409 421 15249058 32 Poirel L Weldhagen GF Naas T De Champs C Dove MG Nordmann P GES-2 a class A beta-lactamase from Pseudomonas aeruginosa with increased hydrolysis of imipenem Antimicrob Agents Chemother 2001 45 2598 2603 11502535 33 Giuliani F Docquier JD Riccio ML Pagani L Rossolini GM OXA-46 a new class D b-lactamase of narrow substrate specificity encoded by a blaVIM-1 containing integron from a Pseudomonas aeruginosa clinical isolate Antimicrob Agents Chemother 2005 49 1973 1980 15855521 34 Poirel L Weldhagen GF De Champs C Nordmann PA Nosocomial outbreak of Pseudomonas aeruginosa isolates expressing the extended-spectrum beta-lactamase GES-2 in South Africa J Antimicrob Chemother 2002 49 561 565 11864961 35 Toleman MA Rolston K Jones RN Walsh TR Molecular and biochemical characterization of OXA-45 an extended-spectrum Class 2d? b-lactamase in Pseudomonas aeruginosa Antimicrob Agents Chemother 2003 47 2859 2863 12936985