==== Front Oncol RepOncol. RepOncology Reports1021-335X1791-2431D.A. Spandidos 2984526310.3892/or.2018.6461or-40-02-0669ArticlesNovel triple-positive markers identified in human non-small cell lung cancer cell line with chemotherapy-resistant and putative cancer stem cell characteristics Satar Nazilah Abdul 1*Fakiruddin Kamal Shaik 25*Lim Moon Nian 2Mok Pooi Ling 346Zakaria Norashikin 1Fakharuzi Noor Atiqah 2Rahman Ahmad Zuhairi Abd 2Zakaria Zubaidah 2Yahaya Badrul Hisham 1Baharuddin Puteri 21 Regenerative Medicine Cluster, Advanced Medical and Dental Institute (AMDI), Universiti Sains Malaysia, 13200 Penang, Malaysia2 Stem Cell Laboratory, Haematology Unit, Cancer Research Centre, Institute for Medical Research (IMR), 50588 Kuala Lumpur, Malaysia3 Department of Biomedical Science, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia4 Genetics and Regenerative Medicine Research Centre, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia5 Institute of Bioscience, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor, Malaysia6 Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Jouf University, Sakaka, Aljouf, Kingdom of Saudi ArabiaCorrespondence to: Mr. Kamal Shaik Fakiruddin, Stem Cell Laboratory, Haematology Unit, Cancer Research Centre, Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur, Malaysia, E-mail: kamal@imr.gov.my* Contributed equally 8 2018 24 5 2018 24 5 2018 40 2 669 681 17 10 2017 03 4 2018 Copyright: © Satar et al.2018This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.Through the specific identification and direct targeting of cancer stem cells (CSCs), it is believed that a better treatment efficacy of cancer may be achieved. Hence, the present study aimed to identify a CSC subpopulation from adenocarcinoma cells (A549) as a model of non-small cell lung cancer (NSCLC). Initially, we sorted two subpopulations known as the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulation using fluorescence-activated cell sorting (FACS). Sorted cells were subsequently evaluated for proliferation and chemotherapy-resistance using a viability assay and were further characterized for their clonal heterogeneity, self-renewal characteristics, cellular migration, alkaline dehydrogenase (ALDH) activity and the expression of stemness-related genes. According to our findings the triple-positive subpopulation revealed significantly higher (P<0.01) proliferation activity, exhibited better clonogenicity, was mostly comprised of holoclones and had markedly bigger (P<0.001) spheroid formation indicating a better self-renewal capacity. A relatively higher resistance to both 5-fluouracil and cisplatin with 80% expression of ALDH was observed in the triple-positive subpopulation, compared to only 67% detected in the triple-negative subpopulation indicated that high ALDH activity contributed to greater chemotherapy-resistance characteristics. Higher percentage of migrated cells was observed in the triple-positive subpopulation with 56% cellular migration being detected, compared to only 19% in the triple-negative subpopulation on day 2. This was similarly observed on day 3 in the triple-positive subpopulation with 36% higher cellular migration compared to the triple-negative subpopulation. Consistently, elevated levels of the stem cell genes such as REX1 and SSEA4 were also found in the triple-positive subpopulation indicating that the subpopulation displayed a strong characteristic of pluripotency. In conclusion, our study revealed that the triple-positive subpopulation demonstrated similar characteristics to CSCs compared to the triple-negative subpopulation. It also confirmed the feasibility of using the triple-positive (EpCAM+/CD166+/CD44+) marker as a novel candidate marker that may lead to the development of novel therapies targeting CSCs of NSCLC. CSCstriple-positive markersEpCAM+/CD166+/CD44+ cellsA549 cell lineNSCLC ==== Body Introduction Non-small cell lung cancer (NSCLC) is the most common type of lung cancer in the world, which accounts for approximately 80–85% of all lung cancer cases while the remaining 20% is attributed to small-cell lung cancer (1–3). NSCLC is generally resistant to chemotherapy and radiation, which often leads to relapse and even mortality after the initial treatment (4–6). Growing evidence has supported the role of cancer stem cells (CSCs) in the expansion, progression and chemoresistance of tumour cells, including those of lung cancer (7). Current therapies of NSCLC are less likely to affect CSCs, due to the characteristics of these cells or their subpopulations that are intrinsically less sensitive to common treatments (8–10). In addition, CSCs are largely quiescent to treatments, which allows them to elude standard chemotherapies. Therefore, failure to eradicate these subpopulations are the underlying cause of cancer relapse and fatality (11,12). The effort to identify new markers of lung tumour CSCs that can predict tumour progression through early stage diagnosis is an effective approach, since late detection may significantly lead to higher metastasis and mortality (13). Furthermore, the development of cancer as well as tumour cell metastasis is believed to be driven by CSCs, which has been supported by many studies (14,15). Therefore, in order to increase the efficacy of treatment and detection of the disease, several CSC markers have been identified. Although, many of these markers do exist in the context of lung cancer, nevertheless we believe that a precise characterization of the cells isolated by these markers, specifically for NSCLC is still needed. Several CSC markers have been identified from various tumours including malignant cells derived from breast (16), pancreas (17) prostate (18), colon (19) and head and neck (20) cancer, as well as leukaemia (21). Concerning lung cancer, putative CSCs derived from various surface markers including CD24 (22), CD133 (23), CD44 (24), CD166 (25) and CD326 (EpCAM) (26) have also been extensively studied and characterised. An example is the epithelial cell adhesion molecule known as the EpCAM, mostly expressed in several human carcinomas and in the majority of normal epithelial cells (27). Due to the strong association between the high expression of EpCAM and the progression of tumour cells in NSCLC, it is believed that this molecule would serve as a prominent marker that can distinguish CSCs from non-CSCs in tumour specimens which are mostly consisted of squamous cell carcinoma (28–30). In addition, EpCAM was observed to be an important biomarker due to its ability to detect circulating tumour cells in the blood of lung cancer patients (31). Another example is the leukocyte cell adhesion molecule (ALCAM) or CD166 that was also found to be a robust marker of lung CSCs, based on the high expression detected in most lung cancer samples and the capacity of the isolated cells to exhibit self-renewal capacity and differentiation in vivo (32). The chemotherapy-resistant characteristic is also one of the hallmarks that can specifically discriminate a CSC from a non-CSC subpopulation. For instance, a specific tumour subpopulation isolated from breast (33), colon (34) and gastric (35) cancer is believed to be a CSC subpopulation based on the expression of the homing cell adhesion molecule (HCAM) or CD44. The isolated cells positive for CD44 possess the ability for self-renewal and also the characteristic of being resistant to common chemotherapy, indicating the utility of CD44 as a marker for CSC (35). Furthermore, CD44 was also believed to be crucial for initiating and driving NSCLC stem cell mobility and metastasis (36). Hence, the aim of the present study was to identify and characterise a novel CSC subpopulation from the A549 cell line used as a model of NSCLC using a novel combination of three markers, EpCAM, CD166 and CD44, rather than single markers to strengthen the selection of the CSC population. Materials and methods Cell culture of NSCLC cell line (A549) The human NSCLC cell line A549, was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). Cells were grown and maintained in a complete RPMI-1640 medium (Invitrogen, Carlsbad, CA, USA) containing 10% foetal bovine serum (FBS), 100 IU/ml penicillin and 100 µg/ml streptomycin and were grown at 37°C in a humidified atmosphere of 5% CO2. The cells were maintained in a 75-cm2 tissue cultured flask and were harvested using 0.25% trypsin-EDTA. All culture reagents were obtained from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA) unless otherwise stated. Sorting of triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations The A549 cells were harvested by incubating the cells with 0.25% trypsin and followed by washing with phosphate-buffered solution (PBS) containing 2% FBS. The suspension cells were then labelled with antibodies (CD326/EpCAM-APC; 1:10 dilutions; cat. no. 347200; CD166-PE; 1:10 dilutions; cat. no. 560903; and CD44-FITC; 1:10 dilutions; cat. no. 347943) (BD Biosciences, San Jose, CA, USA). Briefly, the cells were transferred into 75-mm polystyrene round bottom test tubes (BD Falcon; BD Biosciences) and were suspended in PBS (90 µl) added with 2% FBS at a concentration of 1×106 cells/ml. Subsequently, 10 µl of each antibody were added into the cell suspension and were subsequently incubated for 30 min in the dark. The cells were then washed and filtered through a 40-µm cell strainer to obtain a single cell suspension before sorting. The expression of the CSC markers, EpCAM, CD166 and CD44 was analysed and sorted using a Fluorescence Activated Cell Sorter (FACSAria III; BD Biosciences). Gating was used for sorting out triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) population (Fig. 1). Cell proliferation assay MTS assay [3-(4, 5-dimethylthiazol-2-yl)-2H-tetrazolium, inner salt] was purchased from Promega (Madison, WI, USA) and was used to quantify the proliferation of both sorted and unsorted A549 cells at different time-points (24, 48 and 72 h). The cells were seeded at a density of 1×104 cells/well in a 96-well plate and were incubated for the appropriate length of time (24, 48 and 72 h) in a humidified 5% CO2 incubator at 37°C. Following that, the MTS solution (15 µl) was added to each individual well for further incubation for 4 h. Subsequently, solubilisation solution (100 µl) was added to the cells and absorbance was assessed using Odyssey® Sa Imaging system (LI-COR Biosciences, Lincoln, NE, USA) at 570 nm, using wells without cells as blank. The viability of cells at different time-points was calculated according to the following formula: cell viability (%) = cells (sample)/cells (control) × 100. Clonogenic assay Both sorted [triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−)] and unsorted A549 cells were seeded in triplicates (1,000 cells/ml) into a 6-well plate containing 2 ml of complete RPMI-1640 medium per well. The sorted cells were kept in a culture at 37°C in a 5% CO2 humidified incubator for 14 days. After 14 days, the colonies were observed using an inverted microscope (Olympus, Tokyo, Japan) at ×200 magnification and images from 20 fields of view were captured to evaluate, characterise and manually count the different clones, namely, holoclones, meroclones and paraclones (Barrandon and Green) (37). For the analysis on the number of colonies formed, the cells were stained using Giemsa (Sigma-Aldrich, St. Louis, MO, USA) and were manually counted. In brief, the supernatant was aspirated and the wells were rinsed twice with PBS, followed by subsequent fixing with 4% formaldehyde for 2 min at 24°C. Following fixation, the colonies were stained with Giemsa (Sigma-Aldrich) for 15 min in the dark at 24°C. Following that, the excessive dye was removed and the stained colonies were set to air-dry before analysis and counting. Spheroid assay Both sorted [triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−)] and unsorted A549 cells were suspended in serum-free sphere medium (1.0×103 cells/ml) containing DMEM-F12 (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10 ng/ml basic fibroblast growth factor (bFGF; Life Technologies, Foster City, CA, USA), 1% of B27 supplement (Life Technologies), 20 ng/ml of epidermal growth factor (EGF; Life Technologies), 100 IU/ml penicillin and 100 µg/ml streptomycin (Life Technologies). The cells were re-suspended in a ratio of 1:1 (v/v) of growth factor-reduced Matrigel (BD Biosciences) and serum-free sphere medium. The cells were then seeded in a 96-well ultra-low attachment (ULA) dish (Corning, Inc., Oneonta, NY, USA). The size and number of the formed spheroids were assessed after 20 days of culture by inverted phase contrast microscopy (Olympus). Chemotherapy-resistance assay The viability of both sorted and unsorted A549 cells was assessed by MTS assay following treatment with 5-fluouracil (5-FU) and cisplatin. Briefly, the cells were seeded at a concentration of 1×104 cells/well in a 96-well plate and were incubated overnight at 37°C in humidified air containing 5% CO2. Subsequenlty, 5-FU and cisplatin were added at different concentrations (5, 10, 30, 50, 70 and 90 µM) and incubated for 48 h, and then, 15 µl of MTS solution (CellTiter 96® AQueous One Solution; Promega) was added to each well and further incubated for another 4 h. Solubilisation solution (100 µl) was added to the cells and absorbance at 570 nm was assessed using Odyssey® Sa Imaging System (LI-COR Biosciences). Cell viability was calculated using the formula as aforementioned. Aldehyde dehydrogenase detection (Aldefluor assay) The Aldefluor assay (StemCell Technologies, Vancouver, Canada) was performed according to the manufacturer's instructions. Briefly, a total of 2×105 cells were collected, centrifuged, pelleted and re-suspended in 500 µl of assay buffer before the staining. Aldefluor stain (2.5 µl) was added into the samples followed by the addition of 5 µl ALDH1 inhibitor (diethylaminobenzaldehyde/DEAB) to the control tube. The cells were vortexed and incubated for 30 min at 37°C in the dark. Subsequently, the cells were centrifuged at 180 × g for 5 min and the collected pellet was re-suspended in 500 µl assay buffer before being subjected to flow cytometry (BD FACS Calibur; BD Biosciences) and analysed using BD CellQuest™ Pro software (BD Biosciences). Mitochondrial membrane potential (∆ψm) assay Analysis of mitochondrial membrane potential was conducted using the BD MitoScreen (BD Biosciences). To determine the amount of cells undergoing mitochondrial membrane potential (∆ψm) in response to cisplatin, the cells were incubated in JC-1 stain (5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolcarbocyanine iodide) for 15 min at 37°C in the dark, and then were washed two times with 1X assay buffer. Analysis on the ∆ψm was conducted based on the intensity of the fluorescence detected in both the FL-1 and FL-2 channels by using a flow cytometer (BD FACSCalibur; BD Biosciences). Scratch-wound/migration assay Briefly, both sorted and unsorted A549 cells were seeded at a density of ~3-4×105 cells/well (6-well plate) in complete RPMI-1640 medium and were grown overnight to 90% confluency. Then, the cells were incubated with colcemid (10 µg/ml) for 2 h for synchronization. After incubation, a scratch was created using a 200-µl pipette tip and the wells were gently washed using PBS to remove any residual debris. Fresh complete RPMI-1640 medium (2 ml) was added followed by incubation for another 48 h. The images of the migrated cells from five fields of view were captured using a relief-phase contrast microscope (Olympus IX71; Olympus) at ×400 magnification. The cells migrated into the wound area were evaluated using the following formula: Percentage of cells migrated = [Initial scratch (0 h) - Final scratch (48 h)])/ Initial (0 h) × 100. Quantitative real time-polymerase chain reaction (qRT-PCR) The mRNA expression of CSC markers in both sorted and unsorted A549 cells was determined by quantitative RT-PCR (qRT-PCR) using a LightCycler 480 (Roche, Mannheim, Germany). Initially, the total RNA was extracted from both cells using an RNAeasy extraction kit (Qiagen, Hamburg, Germany) according to the manufacturer's protocol. Subsequently, cDNA was synthesised from 1 µg of total RNA using a Transcriptor First Strand cDNA Synthesis kit (Roche Applied Science, Mannheim, Germany). The qRT-PCR reaction was prepared using a SYBR 1 Master Mix (Roche) as well as different sets of primers (REX1, SOX2, ABCG2, SSEA4, NANOG, OCT4 and GAPDH) as displayed in Table I. The PCR reactions were run under the following cycle conditions; a pre-denaturation step for 4 min at 95°C followed by 40 cycles of denaturation at 95°C for 15 sec, annealing at 60°C for 30 sec and extension at 72°C for 30 sec. The basic relative gene expression (RQ) was calculated using the ∆∆Ct formula and the efficiency (E) of a primer binding equal to 2. Statistical analysis Results are expressed as the means ± standard deviation (SD) of three independent experiments. Statistical analysis was performed using the IBM SPSS statistics version 21 (IBM Corp., Armonk, NY, USA). Comparisons between two groups were performed using the two-tailed t-test; P-values <0.01 were considered to indicate statistically significant differences. Comparisons among groups were performed using one factor analysis of variance (ANOVA) followed by the Tukey's post hoc test. Results Expression of triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations in the A549 cell line To identify the subpopulation believed to exhibit the putative CSC characteristics, we analysed and sorted subpopulations in the A549 cell line that expressed all three stem cell surface markers (EpCAM, CD166 and CD44), namely the triple-positive (EpCAM+/CD166+/CD44+), and the triple-negative (EpCAM−/CD166−/CD44−) as controls (Fig. 1). Our findings indicated that the expression of EpCAM, CD166 and CD44 markers in the A549 cell line that was positive for all three markers (EpCAM+/CD166+/CD44+) was 20.7% (Fig. 1B), compared to only 1.5% concerning the expression of the triple-negative (EpCAM−/CD166−/CD44−) subpopulation (Fig. 1C). Both the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations were sorted from the parental A549 cell line and culture-expanded for further downstream analysis. Proliferation activity of sorted and unsorted A549 cells Higher density of cells was observed for both the unsorted and triple-positive subpopulation as compared to the triple-negative subpopulation (Fig. 2A). Based on the MTS activity, the triple-positive subpopulation (EpCAM+/CD166+/CD44+) demonstrated higher cellular proliferative activities compared to the triple-negative subpopulation (EpCAM−/CD166−/CD44−) between 48 and 72 h (Fig. 2B). In addition, the proliferative activity of the unsorted cells, which comprised of a heterogeneous population was almost similar to that of the triple-positive subpopulation (Fig. 2B), indicating that the triple-positive subpopulation is the main contributor to the cell proliferation activity. Analysis on the hTERT gene expression between both the triple-positive and negative subpopulations revealed an equal hTERT activity indicating high proliferative activity in both subpopulations (Fig. 2C). Triple-positive (EpCAM+/CD166+/CD44+) subpopulation reveals compact clone formation as an indicator of ‘stemness’ The results revealed that the formation of holoclones was significantly higher (P<0.05), with 75.5±7.8 clones identified in the triple-positive (EpCAM+/CD166+/CD44+) subpopulation, compared to only 23.0±11.3 clones in the triple-negative subpopulation and 41.5±12.0 clones in the unsorted cells (Fig. 3). Notably, we noticed that the triple-negative subpopulation presented with substantially higher meroclones with 65.5±10.6 clones detected, compared to the triple-positive subpopulation and unsorted cells with only 23.0±1.4 clones and 33.5 ±16.3 clones detected, respectively (Fig. 3). Triple-positive (EpCAM+/CD166+/CD44+) subpopulation demonstrates the ability to form spheres The study was further validated through the investigation of the self-renewal capability of the sorted cells using a spheroid formation assay. Bigger spheroids reaching an average diameter of 142.7±31.6 µm in size were found in the triple-positive (EpCAM+/CD166+/CD44+) subpopulation (Fig. 4A). In addition, there were smaller spheroids in the unsorted and the triple-negative (EpCAM−/CD166−/CD44−) subpopulation corresponding to an average spheroid diameter of 112.6±30.7 and 63.0±23.2 µm, as depicted in Fig. 4B. Although both the unsorted and the triple-negative subpopulations were able to form spheroids, which indicated the self-renewal capability of these cells, these characteristics were more noticeable in the triple-positive subpopulation which developed larger sizes of formed spheroids. Chemotherapy-resistant properties of triple-positive (EpCAM+/CD166+/CD44+) subpopulation To investigate the chemotherapy-resistant properties of the triple-positive (EpCAM+/CD166+/CD44+) subpopulation, the cells were separately exposed to increasing doses of 5-FU and cisplatin, while both the triple-negative (EpCAM−/CD166−/CD44−) subpopulation and the unsorted cells were used as controls. When the cells were exposed to an increased concentration of 5-FU, the percentage of proliferation in the triple-positive subpopulation was markedly higher (P<0.01), compared to both the triple-negative subpopulation and the unsorted cells (Fig. 5A). Similarly, higher proliferation rate in the triple-positive subpopulation was noticed compared to the triple-negative subpopulation upon exposure to increasing cisplatin concentrations (Fig. 5B). Our findings also indicated a significant difference (P<0.01) in the IC50 values of the triple-positive subpopulation with 876.3±260.7 and 65.3±6.9 µM detected compared to the triple-negative subpopulation with only 9.5±1.2 and 35.6±4.1 µM after exposure of both subpopulations to 5-FU and cisplatin, respectively (Table II). High ALDH1 activity in the triple-positive (EpCAM+/CD166+/CD44+) subpopulation The chemo-resistance characteristic was further investigated through analysis of ALDH activity on triple-positive (EpCAM+/CD166+/CD44+) using the Aldefluor™ kit (StemCell Technologies, Vancouver, BC, Canada). Our analysis revealed that the level of ALDH1 activity was significantly higher (P<0.05) in the triple-positive subpopulation with 80.47±1.9% expression level detected, compared to the triple-negative (EpCAM−/CD166−/CD44−) subpopulation (67.88±0.7%) as displayed in Fig. 6. Furthermore, the expression level of ALDH1 in the unsorted cells was 76.26±0.1%, which was almost equal to the expression observed in the triple-positive subpopulation indicating that the ALDH1 activity of the unsorted cells was mostly contributed to the chemo-resistant characteristic of the triple-positive subpopulation (Fig. 6). Mitochondrial membrane potential (∆ψm) activity of the triple-positive (EpCAM+/CD166+/CD44+) subpopulation Chemotherapeutic drugs were able to stimulate changes of the inner mitochondrial membrane and subsequently cause the loss of mitochondrial membrane potential (∆ψm). Using the JC-1 stain, both unsorted and sorted cells were treated with cisplatin and the ∆ψm was subsequently evaluated analysing the JC-1 monomers (green fluorescence) on the FL-2 channel. Our findings indicated that cisplatin treatment resulted in a greater percentage of FL-2 value of 18.9±1.9% as detected in the triple-positive (EpCAM+/CD166+/CD44+) subpopulation. This was followed by the triple-negative (EpCAM−/CD166−/CD44−) subpopulation and unsorted cells at 8.9±1.0 and 15.1±0.76%, respectively (Fig. 7). Depolarizarion of the ∆ψm indicated a strong activity of the cells undergoing early apoptosis which was detected at a high level in the triple-positive subpopulation. Triple-positive (EpCAM+/CD166+/CD44+) subpopulation exhibits high epithelial to mesenchymal transition (EMT) characteristics The following assay was conducted by evaluating the migration ability of the triple-positive (EpCAM+/CD166+/CD44+) subpopulation compared to the triple-negative (EpCAM−/CD166−/CD44−) subpopulation and unsorted cells. Using an in vitro migration model, scratch assay was analysed on day 2 and 3 (Fig. 8). The triple-positive subpopulation demonstrated significantly higher migration (P<0.01) with 56.1±1.4 and 87.6±2.5% wound closure detected on day 2 and day 3, respectively. The findings were compared to the triple-negative subpopulation (with only 19.9±1.7% wound closure on day 2 and 51.9±6.3% on day 3) and indicated that the triple-positive subpopulation had a higher EMT activity. Triple-positive (EpCAM+/CD166+/CD44+) subpopulation of the A549 cell line exhibits the profile of stem cell-associated genes Finally, to further confirm the intrinsic stem cell properties of the triple-positive (EpCAM+/CD166+/CD44+) subpopulation, the expression of SSEA4, REX1, and ABCG2 was analysed using the quantitative gene analysis. The triple-positive subpopulation exhibited significantly higher (P<0.001) expression of the specific pluripotent gene, SSEA4 with 4.9±2.8-fold increase observed compared to the triple-negative subpopulation (Fig. 9A). Slight increase (P<0.05) was observed for the specific stem cell gene, REX1 in the triple-positive subpopulation compared to the triple-negative subpopulation as depicted in Fig. 9B. This event indicated that the triple-positive subpopulation possessed the features of stem cells as evidenced by the expression of markers related to CSC development. However, no significant differences were detected for the ABCG2 gene expression between the triple-positive and triple-negative subpopulations (Fig. 9C). Discussion To the best of our knowledge, the present study is the first to investigate and confirm the existence of a novel CSC subpopulation based on the presence of three surface markers, EpCAM, CD166 and CD44 combined, in which these markers can specifically identify and discriminate a distinctive subpopulation of putative CSCs in NSCLC. It has been hypothesised that by eliminating this subpopulation, treatment efficacy would be enhanced and chances of tumour relapse reduced. However, the heterogeneity of CSCs is the major impediment that needs to be overcome in order to achieve a better treatment goal. Therefore, a marker that is both robust and specific to identify the major CSC subpopulation is an effective approach for lung cancer treatment. In our previous study, we have identified a potential CSC subpopulation using the combination of two markers from three surface markers (CD166, CD44 and EpCAM) that significantly discriminated CSCs from the non-CSCs in NSCLC (38). Furthermore, we also concluded that these subpopulations (CD166+/EpCAM+ and CD166+/CD44+) exhibited the transcriptomic profile of multipotent cells including the self-renewal capacity, ability for adipogenic, as well as osteogenic differentiation and upregulation of the CSC gene pathways, that further confirmed the stemness characteristics of these subpopulations. In addition, the in vivo study also confirmed the tumourigenic capacity presented by the ability of these subpopulations to generate bigger tumour bulk, compared to their non-CSCs counterpart (CD166−/EpCAM− and CD166−/CD44−) (38). Therefore, these findings have paved the way to the present study of using a combination of all three markers simultaneously in order to have a stringent selection of CSCs in NSCLC. Isolating CSCs from the A549 cell line using a combination of all three markers (EpCAM, CD166 and CD44) resulted in two subpopulations known as the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−). In the present study, we found that the triple-positive subpopulation presented with 20.7% expression of the combined markers (Fig. 1), which was higher than the expected percentage of CSCs reported in other studies (39,40). Although the expression was high and may indicate that the combination marker was unspecific, numerous studies have reported the validity of these markers in detecting specific CSC subpopulations, either as single markers, e.g., CD166 (41) and CD44 (42) or co-expressed with other known CSC markers such as CD90 (43) and CD133 (44). Our findings indicated that the triple-positive markers, although highly expressed in the A549 cell line, may serve as specific and yet robust markers that can discriminate a large population of lung CSCs from the non-CSCs due to their high specificity detected in several tumours. According to Barrandon and Green (1987) (45) who described different clonogenicity to multiplication characteristics, only colonies known as holoclones (colonies with well-defined border) with cellular characteristics of pluripotent stem cells (i.e., high nuclear to cytoplasmic ratio, prominent nucleolus and small cell size) were capable of extensive proliferation, self-renewal and cellular growth. However, the meroclones and paraclones (colonies without a well-defined border) had a limited proliferation capacity and were incapable of self-renewal. From our findings, we observed that in contrast to the triple-negative subpopulation, the triple-positive subpopulation could give rise to higher number of holoclones (Fig. 3). Furthermore, the triple-negative subpopulation consisted of mostly meroclones, indicating that the subpopulation was predominantly governed by differentiated types of CSCs. We also observed that the triple-positive subpopulation had the ability to form bigger spheroids (Fig. 4) compared to its counterpart. Significance in the size of spheroids between the putative CSCs and non-CSCs by in vitro analysis that may also reflex the bulk of tumours in xenografts has been reported as an indicator of CSC stemness in numerous studies. The triple-negative subpopulation may also form spheroids as these cells are also tumour cells, however the observation that they were significantly smaller than the triple-positive subpopulation cells indicated its level of tumourigenicity (46). Collectively, the results indicated that the triple-positive subpopulation has the fundamental characteristic of stemness (Figs. 3 and 4) (47). In addition to clonogenicity, chemoresistance is also an equally important characteristic that can clearly define a typical feature of CSC (48). Since the expression of ALDH1 was high in the triple-positive subpopulation (Fig. 6), it was plausible that the subpopulation was resistant to both cisplatin and 5-FU treatments when compared to the triple-negative subpopulation (Fig. 5). Furthermore, enriched CSCs such as the triple-positive subpopulation would have a lower sensitivity to common chemotherapy as reflected by the higher cell viability post treatment, compared to the unsorted cells where the sensitivity to chemotherapy was higher due to the existence of non-CSCs in their population (49,50). This finding was in line with previous studies that have revealed a similar observation in CD133+ subpopulation derived from colon cancer cells and pretreated with both oxaliplatin and 5-FU (51). The chemotherapy-resistant activity, as confirmed by gene expression analysis, has recently been reported as a potential marker that can specifically discriminate CSCs from non-CSCs (52–55) in different tumour types (52,53,56) However, our observation in the expression of ABCG2 mRNA (a multidrug resistance family gene) indicated no differences between the triple-positive and triple-negative subpopulations (Fig. 9). Nonetheless, it is believed that the ABCG2 may not directly influence the chemoresistant characteristic of this subpopulation. Therefore, screening for several other multidrug resistance genes such as the ABCG1, P-glycoprotein and MDR family were necessary in order to fully characterise the chemo-resistant activity of this subpopulation. There was higher loss of mitochondrial membrane potential (∆ψm) in the triple-positive subpopulation following cisplatin treatment, than the triple-negative subpopulation indicating that this particular subpopulation was more sensitive to the treatment. The treatment also induced loss of the ∆ψm activity which eventually led to an activation of the intrinsic apoptotic pathways in both subpopulations (57,58). A higher ∆ψm activity in the triple-positive subpopulation following treatment was possibly due to a greater proliferation activity as seen in the triple-positive subpopulation (Fig. 2), all of which may lead to the production of a higher number of proliferative cells for apoptosis. It is also known that due to the cisplatin mechanism of action that binds to DNA, the activity of cisplatin is greater in highly proliferative cells since the inhibition activity of cisplatin only peaks during cellular division and mitosis (59). In addition to the stemness and high resistance to drug treatments, high metastatic and EMT activity are also part of the hallmarks of CSCs (60). EMT would normally result in the migration of CSCs with invasive characteristics, induced by the transforming growth factor-B (TGF-B) and activation of hedgehog signalling pathway (61) under a hypoxic condition (62). Our findings clearly indicated that the triple-positive subpopulation exhibited significantly higher migratory phenotype on day 2 and 3 when compared to the triple-negative subpopulation. The EpCAM and CD44 target molecules, that have been reported to regulate cell migration and metastasis through the Wnt/β-catenin signalling pathway (63–66), may be the key reason for cellular motility and invasion that contribute to the characteristics of CSCs, and ultimately tumour metastasis (67). CSCs preferentially express genes relevant for stemness such as SOX2, NANOG, REX1, SSEA4 and OCT4 which have been shown to be important for human embryonic stem cell development (68). The mRNA expression of REX1 and SSEA4, were relatively higher (Fig. 9) in the triple-positive subpopulation, indicating the contribution of these pluripotent genes in the functions and maintenance of CSCs. We believed that these genes were not only important markers that can determine a pure population of CSCs, but also suitable candidate genes for targeted therapy to disrupt the regulation of CSCs for an enhanced treatment efficacy of lung cancer. In conclusion, we revealed for the first time, that the triple-positive subpopulation derived from the A549 cell line possessed CSC characteristics, including being highly proliferative, having greater clonogenicity, ability for self-renewal through spheroid formation, being chemoresistant, and exhibiting high ALDH activity and migratory potential. To better understand the chemoresistance of this subpopulation, an in vivo drug-resistant assay can be performed to further verify the characteristics of this subpopulation. Furthermore, the gene expression analysis confirmed that the triple-positive subpopulation expressed higher pluripotent genes (REX1 and SSEA4) compared to the triple-negative subpopulation. Collectively, the present study indicated that the identified triple-positive (EpCAM+/CD166+/CD44+) subpopulation may be a potential candidate of CSCs for tumour samples derived from NSCLC and the population may also represent a significant group of chemoresistant cells that can be used for drug screening and chemosensitivity testing. Acknowledgments The authors wish to thank the Director General of Health of Malaysia for his permission to publish the present study. Funding The present study was supported by a grant from the Ministry of Health (MOH), Malaysia (no. JPP-IMR-16-038/NMRR-16-869-30708). Availability of data and materials The datasets used during the present study are available from the corresponding author upon reasonable request. Authors' contributions KSF conceived, designed and performed the experiments. MNL performed part of the experiment and edited the manuscript. NZ, NAF and AZAR analysed the data. PB and ZZ provided the reagents and tools. NAS and KSF wrote the paper. BHY and PLM edited and reviewed the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved. Ethics approval and consent to participate All experimental protocols were approved by the Institutional Review Board, Institute for Medical Research (IMR), Malaysia and the Medical Research and Ethics Committee (MREC), Ministry of Health (MOH), Malaysia. Consent for publication Not applicable. Competing interests The authors state that they have no competing interests. Figure 1. Sorting of triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) A549 cells. Cells were analysed using the surface markers of EpCAM (CD326)-APC, CD166-PE and CD44-FITC and sorted by FACS. (A) Cell debris and doublets were discriminated to differentiate between viable and dead cells before sorting, as indicated in the first three panels. (B and C) The expression of the triple-positive and the triple-negative subpopulations in A549 cells was 20.7% and 1.5%, respectively. Figure 2. Cell proliferation activity of triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations in the NSCLC A549 cell line. (A) The cells were cultured in a 96-well plate at a density of 1×103 cells/well and the proliferation activity was assessed by absorbance at 570 nm. Images were captured showing higher number of cells in both the unsorted and triple-positive compared to the triple-negative subpopulations at 72 h post incubation. (B) The triple-positive subpopulation exhibited significantly higher absorbance reading between 48 and 72 h compared to the triple-negative subpopulation indicating higher proliferative activity of these cells. (C) Analysis of the hTERT resulted in slightly higher expression of the gene in the triple-positive subpopulation, however there was no significant difference noticed between both subpopulations (*P<0.01, **P<0.001; t-test). Figure 3. Comparison of clonal heterogeneity (holoclones, meroclones and paraclones) between the unsorted and sorted subpopulations of A549 cells. Cells were seeded at a density of 1×103 cells/well and grown in a 6-well plate for 14 days. The triple-positive (EpCAM+/CD166+/CD44+) cells showed higher number of holoclones signifying the stem cell characteristic of the subpopulation, while the triple-negative (EpCAM−/CD166−/CD44−) cells presented with greater number of meroclones indicating that the subpopulation exhibited mostly differentiated CSCs (*P<0.01; t-test). Figure 4. Potential of sorted (EpCAM+/CD166+/CD44+ and EpCAM−/CD166−/CD44−) subpopulations to form spheroids under serum-free culture condition. (A) Cells were seeded at a density of 500 cells/well in a 24-well ultra-low attachment plate. The triple-positive (EpCAM+/CD166+/CD44+) subpopulation formed bigger anchorage independent spheroids compared to the triple-negative (EpCAM−/CD166−/CD44−) subpopulation after 14 days of culture. (B) The images showing the sizes of spheres in each well indicated in A, were subsequently analysed as depicted in B. The error bar indicated the average standard deviation of triplicate experiments (**P<0.001; t-test). Figure 5. Comparison of cell viability between the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations during chemotherapy-induced cytotoxicity. (A and B) The cells were exposed to different concentrations (5–90 µM) of chemotherapy (5-fluouracil, A; and cisplatin, B) for 72 h, followed by analysis of cell viability using Cell Titter-96® AQueous One Solution (Promega). The triple-positive subpopulation exhibited greater chemo-resistant characteristics while the triple-negative subpopulation was more sensitive to the treatments. The error bar indicated the average standard deviation of triplicate experiments (*P<0.01, **P<0.001; t-test). Figure 6. ALDH activity and expression in the sorted triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations and unsorted cells derived from the A549 cell line. The triple-positive (EpCAM+/CD166+/CD44+) subpopulation presented with higher ALDH activity (80.46%), compared to the triple-negative (EpCAM−/CD166−/CD44−) subpopulation with only 67.88% detected, indicating the resistant characteristic of the triple-positive subpopulation to common treatments and the lower sensitivity of this subpopulation to common chemotherapy. The error bar indicated the average standard deviation of triplicate experiments (*P<0.01, **P<0.001; t-test). Figure 7. Observation of the mitochondrial membrane potential (∆ψm) in the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations prior to treatment with cisplatin. Cells were grown and treated with cisplatin for 72 h and stained with the JC-1 for 15 min at 37°C in the dark. The fluorescence intensity was detected using flow cytometry and the percentage of the ∆ψm was gated on the R1 area. The error bars indicated the average standard deviation of triplicate experiments (*P<0.01, **P<0.001; t-test). Figure 8. The triple-positive (EpCAM+/CD166+/CD44+) subpopulation exhibits higher cellular migratory and metastatic potential. (A) Representative photomicrographs and analysis of wound closure were presented for the sorted (EpCAM+/CD166+/CD44+ and EpCAM−/CD166−/CD44−) subpopulations and the unsorted A549 cell line. Higher migratory potential was observed in the triple-positive compared to the triple-negative subpopulation at day 2 and day 3 indicating higher metastatic ability of this subpopulation compared to the control. (B) Wound closures were subsequently analysed as depicted in the graph. The error bar indicated the average standard deviation of triplicate experiments (**P<0.001; t-test). Figure 9. The mRNA expression of pluoripotent and multi-drug resistance genes on both the triple-positive (EpCAM+/CD166+/CD44+) and triple-negative (EpCAM−/CD166−/CD44−) subpopulations. The mRNA expression of (A) SSEA4, (B) REX1 and (C) ABCG2 was analysed using qRT-PCR and the unsorted cells with GAPDH were used as an internal control (#P<0.05, **P<0.001; t-test). Table I. List of primers used in qRT-PCR for the expression of stem cell genes. Gene Accession Forward primer Reverse primer REX1 NM_174900 GCGTACGCAAATTAAAGTCCAGA ATCCTAAACCAGCTCGCAGAAT SOX2 NM_0031063 CCCCCGGCGGCAATAGCA TCGGCGCCGGGGAGATACAT ABCG2 NM_001257386 GTTTATCCGTGGTGTGTCTGG CTGAGCTATAGAGGCCTGGG SSEA4 NM_006927 TGGACGGGCACAACTTCATC GGGCAGGTTCTTGGCACTCT NANOG NM_001297698 TCCTCCATGGATCTGCTTATTCA CAGGTCTTCACCTGTTTGTAGCTGAG OCT4 NM_001173531 CGACCATCTGCCGCTTTGAG CCCCCTGTCCCCCATTCCTA Table II. IC50 values of the A549 cell line subpopulations. IC50 values (µM) for the treatments A549 cell subpopulation 5-fluouracil (5-FU) Cisplatin Unsorted   27.8±6.3 59.2±7.9 EpCAM+/CD166+/CD44+ 876.3±260.7 65.3±6.9 EpCAM−/CD166−/CD44−   9.5±1.2 35.6±4.1 Results are the mean ± standard deviation (SD). The IC50 values were determined as specified in Materials and methods. ==== Refs References 1 Yagui-Beltrán A Jablons DM A translational approach to lung cancer research Ann Thorac Cardiovasc Surg 15 213 2009 19763051 2 Okudela K Nagahara N Katayama A Kitamura H Cancer Stem Cells in Lung Cancer: Distinct Differences between Small Cell and Non-Small Cell Lung Carcinomas Cancer Stem Cells Theories and Practice InTech 2011 https://www.intechopen.com/.../cancer-stem-cells-theorie 3 22 2011 10.5772/13913 3 Al-Hajj M Wicha MS Benito-Hernandez A Morrison SJ Clarke MF Prospective identification of tumorigenic breast cancer cells Proc Natl Acad Sci USA 100 3983 3988 2003 10.1073/pnas.0530291100 12629218 4 Caramori G Casolari P Cavallesco GN Giuffrè S Adcock I Papi A Mechanisms involved in lung cancer development in COPD Int J Biochem Cell Biol 43 1030 1044 2011 10.1016/j.biocel.2010.08.022 20951226 5 Buttery RC Rintoul RC Sethi T Small cell lung cancer: The importance of the extracellular matrix Int J Biochem Cell Biol 36 1154 1160 2004 10.1016/S1357-2725(03)00261-9 15109562 6 Pei J Lou Y Zhong R Han B MMP9 activation triggered by epidermal growth factor induced FoxO1 nuclear exclusion in non-small cell lung cancer Tumour Biol 35 6673 6678 2014 10.1007/s13277-014-1850-z 24705809 7 Wang J Li ZH White J Zhang LB Lung cancer stem cells and implications for future therapeutics Cell Biochem Biophys 69 389 398 2014 10.1007/s12013-014-9844-4 24549856 8 Vermeulen L Sprick MR Kemper K Stassi G Medema JP Cancer stem cells - old concepts, new insights Cell Death Differ 15 947 958 2008 10.1038/cdd.2008.20 18259194 9 Freitas DP Teixeira CA Santos-Silva F Vasconcelos MH Almeida GM Therapy-induced enrichment of putative lung cancer stem-like cells Int J Cancer 134 1270 1278 2014 10.1002/ijc.28478 24105655 10 Dingli D Michor F Successful therapy must eradicate cancer stem cells Stem Cells 24 2603 2610 2006 10.1634/stemcells.2006-0136 16931775 11 Chen X Liao R Li D Sun J Induced cancer stem cells generated by radiochemotherapy and their therapeutic implications Oncotarget 8 17301 17312 2017 28038467 12 Tang Q-L Liang Y Xie XB Yin JQ Zou CY Zhao ZQ Shen JN Wang J Enrichment of osteosarcoma stem cells by chemotherapy Chin J Cancer 30 426 432 2011 10.5732/cjc.30.0426 21627865 13 Liloglou T Bediaga NG Brown BR Field JK Davies MP Epigenetic biomarkers in lung cancer Cancer Lett 342 200 212 2014 10.1016/j.canlet.2012.04.018 22546286 14 Allan AL Vantyghem SA Tuck AB Chambers AF Tumor dormancy and cancer stem cells: Implications for the biology and treatment of breast cancer metastasis Breast Dis 26 87 98 2006-2007 10.3233/BD-2007-26108 15 Lobo NA Shimono Y Qian D Clarke MF The biology of cancer stem cells Annu Rev Cell Dev Biol 23 675 699 2007 10.1146/annurev.cellbio.22.010305.104154 17645413 16 Velasco-Velázquez MA Popov VM Lisanti MP Pestell RG The role of breast cancer stem cells in metastasis and therapeutic implications Am J Pathol 179 2 11 2011 10.1016/j.ajpath.2011.03.005 21640330 17 Li C Heidt DG Dalerba P Burant CF Zhang L Adsay V Wicha M Clarke MF Simeone DM Identification of pancreatic cancer stem cells Cancer Res 67 1030 1037 2007 10.1158/0008-5472.CAN-06-2030 17283135 18 Maitland NJ Collins AT Prostate cancer stem cells: A new target for therapy J Clin Oncol 26 2862 2870 2008 10.1200/JCO.2007.15.1472 18539965 19 Kozovska Z Gabrisova V Kucerova L Colon cancer: Cancer stem cells markers, drug resistance and treatment Biomed Pharmacother 68 911 916 2014 10.1016/j.biopha.2014.10.019 25458789 20 Prince ME Sivanandan R Kaczorowski A Wolf GT Kaplan MJ Dalerba P Weissman IL Clarke MF Ailles LE Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma Proc Natl Acad Sci USA 104 973 978 2007 10.1073/pnas.0610117104 17210912 21 Wang JC Dick JE Cancer stem cells: Lessons from leukemia Trends Cell Biol 15 494 501 2005 10.1016/j.tcb.2005.07.004 16084092 22 Kristiansen G Schlüns K Yongwei Y Denkert C Dietel M Petersen I CD24 is an independent prognostic marker of survival in nonsmall cell lung cancer patients Br J Cancer 88 231 236 2003 10.1038/sj.bjc.6600702 12610508 23 Tirino V Camerlingo R Franco R Malanga D La Rocca A Viglietto G Rocco G Pirozzi G The role of CD133 in the identification and characterisation of tumour-initiating cells in non-small-cell lung cancer Eur J Cardiothorac Surg 36 446 453 2009 10.1016/j.ejcts.2009.03.063 19464919 24 Leung EL-H Fiscus RR Tung JW Tin VP Cheng LC Sihoe AD Fink LM Ma Y Wong MP Non-small cell lung cancer cells expressing CD44 are enriched for stem cell-like properties PLoS One 5 e14062 2010 10.1371/journal.pone.0014062 21124918 25 Zhang WC Shyh-Chang N Yang H Rai A Umashankar S Ma S Soh BS Sun LL Tai BC Nga ME Glycine decarboxylase activity drives non-small cell lung cancer tumor-initiating cells and tumorigenesis Cell 148 259 272 2012 10.1016/j.cell.2012.02.024 22225612 26 Lin S Sun JG Wu JB Long HX Zhu CH Xiang T Ma H Zhao ZQ Yao Q Zhang AM Aberrant microRNAs expression in CD133+ /CD326+ human lung adenocarcinoma initiating cells from A549 Mol Cells 33 277 283 2012 10.1007/s10059-012-2252-y 22349807 27 Laimer K Fong D Gastl G Obrist P Kloss F Tuli T Gassner R Rasse M Norer B Spizzo G EpCAM expression in squamous cell carcinoma of the oral cavity: Frequency and relationship to clinicopathologic features Oral Oncol 44 72 77 2008 10.1016/j.oraloncology.2007.01.008 17418618 28 Litvinov SV van Driel W van Rhijn CM Bakker HA van Krieken H Fleuren GJ Warnaar SO Expression of Ep-CAM in cervical squamous epithelia correlates with an increased proliferation and the disappearance of markers for terminal differentiation Am J Pathol 148 865 875 1996 8774141 29 Munz M Baeuerle PA Gires O The emerging role of EpCAM in cancer and stem cell signaling Cancer Res 69 5627 5629 2009 10.1158/0008-5472.CAN-09-0654 19584271 30 Pak MG Shin DH Lee CH Lee MK Significance of EpCAM and TROP2 expression in non-small cell lung cancer World J Surg Oncol 10 53 60 2012 10.1186/1477-7819-10-53 22482828 31 Skirecki T Hoser G Kawiak J Dziedzic D Domagała-Kulawik J Flow cytometric analysis of CD133− and EpCAM-positive cells in the peripheral blood of patients with lung cancer Arch Immunol Ther Exp (Warsz) 62 67 75 2014 10.1007/s00005-013-0250-1 23959111 32 Tachezy M Zander H Wolters-Eisfeld G Müller J Wicklein D Gebauer F Izbicki JR Bockhorn M Activated leukocyte cell adhesion molecule (CD166): An ‘inert’ cancer stem cell marker for non-small cell lung cancer? Stem Cells 32 1429 1436 2014 10.1002/stem.1665 24501004 33 de Beça FF Caetano P Gerhard R Alvarenga CA Gomes M Paredes J Schmitt F Cancer stem cells markers CD44, CD24 and ALDH1 in breast cancer special histological types J Clin Pathol 66 187 191 2013 10.1136/jclinpath-2012-201169 23112116 34 Jing F Kim HJ Kim CH Kim YJ Lee JH Kim HR Colon cancer stem cell markers CD44 and CD133 in patients with colorectal cancer and synchronous hepatic metastases Int J Oncol 46 1582 1588 2015 10.3892/ijo.2015.2844 25625240 35 Takaishi S Okumura T Tu S Wang SS Shibata W Vigneshwaran R Gordon SA Shimada Y Wang TC Identification of gastric cancer stem cells using the cell surface marker CD44 Stem Cells 27 1006 1020 2009 10.1002/stem.30 19415765 36 Su J Wu S Wu H Li L Guo T CD44 is functionally crucial for driving lung cancer stem cells metastasis through Wnt/β-catenin-FoxM1-Twist signaling Mol Carcinog 55 1962 1973 2016 10.1002/mc.22443 26621583 37 Barrandon Y Green H Cell size as a determinant of the clone-forming ability of human keratinocytes Proc Natl Acad Sci USA 82 5390 5394 1985 10.1073/pnas.82.16.5390 2410922 38 Zakaria N Yusoff NM Zakaria Z Lim MN Baharuddin PJ Fakiruddin KS Yahaya B Human non-small cell lung cancer expresses putative cancer stem cell markers and exhibits the transcriptomic profile of multipotent cells BMC Cancer 15 84 2015 10.1186/s12885-015-1086-3 25881239 39 Shi Y Fu X Hua Y Han Y Lu Y Wang J The side population in human lung cancer cell line NCI-H460 is enriched in stem-like cancer cells PLoS One 7 e33358 2012 10.1371/journal.pone.0033358 22428030 40 Wang P Gao Q Suo Z Munthe E Solberg S Ma L Wang M Westerdaal NA Kvalheim G Gaudernack G Identification and characterization of cells with cancer stem cell properties in human primary lung cancer cell lines PLoS One 8 e57020 2013 10.1371/journal.pone.0057020 23469181 41 Levin TG Powell AE Davies PS Silk AD Dismuke AD Anderson EC Swain JR Wong MH Characterization of the intestinal cancer stem cell marker CD166 in the human and mouse gastrointestinal tract Gastroenterology 139 2072 2082.e5 2010 10.1053/j.gastro.2010.08.053 20826154 42 Li W Ma H Zhang J Zhu L Wang C Yang Y Unraveling the roles of CD44/CD24 and ALDH1 as cancer stem cell markers in tumorigenesis and metastasis Sci Rep 7 13856 2017 10.1038/s41598-017-14364-2 29062075 43 Bahnassy AA Fawzy M El-Wakil M Zekri AR Abdel-Sayed A Sheta M Aberrant expression of cancer stem cell markers (CD44, CD90, and CD133) contributes to disease progression and reduced survival in hepatoblastoma patients: 4-year survival data Transl Res 165 396 406 2015 10.1016/j.trsl.2014.07.009 25168019 44 Zhang H Lin XG Hua P Wang M Ao X Xiong LH Wu C Guo JJ The study of the tumor stem cell properties of CD133+ CD44+ cells in the human lung adenocarcinoma cell line A549 Cell Mol Biol (Noisy-le-grand) 56 Suppl OL1350 8 2010 20937222 45 Barrandon Y Green H Three clonal types of keratinocyte with different capacities for multiplication Proc Natl Acad Sci USA 84 2302 2306 1987 10.1073/pnas.84.8.2302 2436229 46 Yan W Chen Y Yao Y Zhang H Wang T Increased invasion and tumorigenicity capacity of CD44+ /CD24− breast cancer MCF7 cells in vitro and in nude mice Cancer Cell Int 13 62 2013 10.1186/1475-2867-13-62 23799994 47 Reya T Morrison SJ Clarke MF Weissman IL Stem cells, cancer, and cancer stem cells Nature 414 105 111 2001 10.1038/35102167 11689955 48 Dean M Fojo T Bates S Tumour stem cells and drug resistance Nat Rev Cancer 5 275 284 2005 10.1038/nrc1590 15803154 49 Huang C-P Tsai MF Chang TH Tang WC Chen SY Lai HH Lin TY Yang JC Yang PC Shih JY ALDH-positive lung cancer stem cells confer resistance to epidermal growth factor receptor tyrosine kinase inhibitors Cancer Lett 328 144 151 2013 10.1016/j.canlet.2012.08.021 22935675 50 Izumiya M Kabashima A Higuchi H Igarashi T Sakai G Iizuka H Nakamura S Adachi M Hamamoto Y Funakoshi S Chemoresistance is associated with cancer stem cell-like properties and epithelial-to-mesenchymal transition in pancreatic cancer cells Anticancer Res 32 3847 3853 2012 22993328 51 Todaro M Alea MP Di Stefano AB Cammareri P Vermeulen L Iovino F Tripodo C Russo A Gulotta G Medema JP Colon cancer stem cells dictate tumor growth and resist cell death by production of interleukin-4 Cell Stem Cell 1 389 402 2007 10.1016/j.stem.2007.08.001 18371377 52 Chen Y-C Chen YW Hsu HS Tseng LM Huang PI Lu KH Chen DT Tai LK Yung MC Chang SC Aldehyde dehydrogenase 1 is a putative marker for cancer stem cells in head and neck squamous cancer Biochem Biophys Res Commun 385 307 313 2009 10.1016/j.bbrc.2009.05.048 19450560 53 Huang EH Hynes MJ Zhang T Ginestier C Dontu G Appelman H Fields JZ Wicha MS Boman BM Aldehyde dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis Cancer Res 69 3382 3389 2009 10.1158/0008-5472.CAN-08-4418 19336570 54 Charafe-Jauffret E Ginestier C Iovino F Tarpin C Diebel M Esterni B Houvenaeghel G Extra JM Bertucci F Jacquemier J Aldehyde dehydrogenase 1-positive cancer stem cells mediate metastasis and poor clinical outcome in inflammatory breast cancer Clin Cancer Res 16 45 55 2010 10.1158/1078-0432.CCR-09-1630 20028757 55 Jiang F Qiu Q Khanna A Todd NW Deepak J Xing L Wang H Liu Z Su Y Stass SA Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer Mol Cancer Res 7 330 338 2009 10.1158/1541-7786.MCR-08-0393 19276181 56 Tanei T Morimoto K Shimazu K Kim SJ Tanji Y Taguchi T Tamaki Y Noguchi S Association of breast cancer stem cells identified by aldehyde dehydrogenase 1 expression with resistance to sequential Paclitaxel and epirubicin-based chemotherapy for breast cancers Clin Cancer Res 15 4234 4241 2009 10.1158/1078-0432.CCR-08-1479 19509181 57 Bouchier-Hayes L Muñoz-Pinedo C Connell S Green DR Measuring apoptosis at the single cell level Methods 44 222 228 2008 10.1016/j.ymeth.2007.11.007 18314052 58 Ma D Tremblay P Mahngar K Akbari-Asl P Collins J Hudlicky T Pandey S Induction of apoptosis and autophagy in human pancreatic cancer cells by a novel synthetic C-1 analogue of 7-deoxypancratistatin Am J Biomed Sci 3 278 291 2011 10.5099/aj110400278 59 Dasari S Tchounwou PB Cisplatin in cancer therapy: Molecular mechanisms of action Eur J Pharmacol 740 364 378 2014 10.1016/j.ejphar.2014.07.025 25058905 60 Wang X Zhu Y Ma Y Wang J Zhang F Xia Q Fu D The role of cancer stem cells in cancer metastasis: New perspective and progress Cancer Epidemiol 37 60 63 2013 10.1016/j.canep.2012.07.007 22884170 61 Wang F Ma L Zhang Z Liu X Gao H Zhuang Y Yang P Kornmann M Tian X Yang Y Hedgehog signaling regulates epithelial-mesenchymal transition in pancreatic cancer stem-like cells J Cancer 7 408 417 2016 10.7150/jca.13305 26918054 62 Singh A Settleman J EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer Oncogene 29 4741 4751 2010 10.1038/onc.2010.215 20531305 63 Ni J Cozzi P Hao J Beretov J Chang L Duan W Shigdar S Delprado W Graham P Bucci J Epithelial cell adhesion molecule (EpCAM) is associated with prostate cancer metastasis and chemo/radioresistance via the PI3K/Akt/mTOR signaling pathway Int J Biochem Cell Biol 45 2736 2748 2013 10.1016/j.biocel.2013.09.008 24076216 64 Patriarca C Macchi RM Marschner AK Mellstedt H Epithelial cell adhesion molecule expression (CD326) in cancer: A short review Cancer Treat Rev 38 68 75 2012 10.1016/j.ctrv.2011.04.002 21576002 65 Visvader JE Lindeman GJ Cancer stem cells in solid tumours: Accumulating evidence and unresolved questions Nat Rev Cancer 8 755 768 2008 10.1038/nrc2499 18784658 66 Wielenga VJ Smits R Korinek V Smit L Kielman M Fodde R Clevers H Pals ST Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway Am J Pathol 154 515 523 1999 10.1016/S0002-9440(10)65297-2 10027409 67 Hou J-M Krebs M Ward T Sloane R Priest L Hughes A Clack G Ranson M Blackhall F Dive C Circulating tumor cells as a window on metastasis biology in lung cancer Am J Pathol 178 989 996 2011 10.1016/j.ajpath.2010.12.003 21356352 68 Mizrak SC Chikhovskaya JV Sadri-Ardekani H van Daalen S Korver CM Hovingh SE Roepers-Gajadien HL Raya A Fluiter K de Reijke TM Embryonic stem cell-like cells derived from adult human testis Hum Reprod 25 158 167 2010 10.1093/humrep/dep354 19815622