==== Front Mol Med RepMol Med RepMolecular Medicine Reports1791-29971791-3004D.A. Spandidos 2990112410.3892/mmr.2018.9130mmr-18-02-1423ArticlesA novel APC mutation identified in a large Chinese family with familial adenomatous polyposis and a brief literature review Pang Minghui 1*Liu Yijun 2*Hou Xiaolin 1*Yang Jialiang 3He Xuelai 1Hou Nengyi 1Liu Peixi 5Liang Luo 1Fu Junwen 1Wang Kang 1Ye Zimeng 3Gong Bo 341 Department of Gastrointestinal Surgery, Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital, School of Medicine, University of Electronic Science and Technology of China, Chengdu, Sichuan 610072, P.R. China2 State Key Laboratory of Oncology in South China, Collaborative Innovation Center for Cancer Medicine, Department of Clinical Laboratory Medicine, Sun Yat-Sen University Cancer Center, Guangzhou, Guangdong 510000, P.R. China3 Sichuan Provincial Key Laboratory for Human Disease Gene Study, Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital, School of Medicine, University of Electronic Science and Technology of China, Chengdu, Sichuan 610072, P.R. China4 Institute of Chengdu Biology, Sichuan Translational Medicine Hospital, Chinese Academy of Sciences, Chengdu, Sichuan 610000, P.R. China5 Department of Gastroenterology, Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital, School of Medicine, University of Electronic Science and Technology of China, Chengdu, Sichuan 610072, P.R. ChinaCorrespondence to: Dr Bo Gong or Dr Zimeng Ye, Sichuan Provincial Key Laboratory for Human Disease Gene Study, Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital, School of Medicine, University of Electronic Science and Technology of China, 32 Road West 2, The First Ring Road, Chengdu, Sichuan 610072, P.R. China, E-mail: gongbo2007@hotmail.com, E-mail: zmy_daisy@163.com* Contributed equally 8 2018 05 6 2018 05 6 2018 18 2 1423 1432 12 1 2018 09 5 2018 Copyright: © Pang et al.2018This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.Familial adenomatous polyposis (FAP), an autosomal dominant disease, is a colon cancer predisposition syndrome that manifests as a large number of adenomatous polyps. Mutations in the Adenomatous polyposis coli (APC) gene are responsible for the majority of cases of FAP. The purpose of the present study was to report the clinical features of a Chinese family with FAP and screen for novel mutations using the targeted next-generation sequencing technology. Among the 29 family members, 12 were diagnosed of FAP. Based on an established filtering strategy and data analyses, along with confirmation by Sanger sequencing and co-segregation, a novel frameshift mutation c.1317delA (p.Ala440LeufsTer14) in exon 10 of the APC gene was identified. To the best of our knowledge, this mutation has not been reported prior to the present study. In addition, it was correlated with extra-colonic phenotypes featuring duodenal polyposis and sebaceous cysts in this family. This novel frameshift mutation causing FAP not only expands the germline mutation spectrum of the APC gene in the Chinese population, but it also increases the understanding of the phenotypic and genotypic correlations of FAP, and may potentially lead to improved genetic counseling and specific treatment for families with FAP in the future. familial adenomatous polyposisAdenomatous polyposis colinext-generation sequencingheterozygous mutation ==== Body Introduction Familial adenomatous polyposis (FAP) is an autosomal dominant inherited disorder with an incidence of approximately 3–10/100,000 (1). FAP is characterized by the presence of hundreds to thousands of adenomatous polyps in the colon and rectum, and is a disease predisposing individuals to colorectal cancer (CRC) (2). Affected FAP subjects without early diagnosis and treatment subsequently develop CRC in the late childhood to the sixties, with a mean age at diagnosis of 40 years old (3). CRC is the third most common malignant disease in both males and females in Asia, and is the second leading cause of cancer death in the past ten years (4). Patients who suffer from FAP also have increased risk of extra-colonic manifestations, including duodenal polyposis, sebaceous cysts, congenital hypertrophy of the retinal pigment epithelium (CHRPE) and tumors in the upper gastrointestinal tract, thyroid gland and brain (5,6). Germline mutations in the tumor suppressor adenomatous polyposis coli gene (APC) on chromosome 5q22.2 are responsible for the most cases of FAP. The APC gene comprises of 16 exons (NM_000038.5), including1 upstream non-coding exon and 15 coding exons. The last coding exon encompasses the majority (>75%) of the total coding region. Most of the mutations causing FAP are nonsense or frameshift mutations, and can result in premature stop codons thus produce truncated APC proteins (7). The APC protein, which comprises of 2843 amino acids, plays an important role in the β-catenin nuclear localization (8). Loss of APC function results in increased level of β-catenin and activation of growth-promoting genes via the increased β-catenin/Tcf-4 transcription complexes, subsequently leading to the development of adenomatous colorectal polyps at a young age (9). Adenomatous polyposis will consequently progress to CRC if left untreated. Genetic screening along with other preventative strategies can conspicuously improve the overall survival of FAP patients. In the present study, we screened for novel mutations that might cause FAP in a four-generation Chinese family with FAP using targeted next-generation sequencing method. A novel mutation in the exon 10 of APC (c.1317delA) was identified in all of the affected members, but not in the unaffected members or the 600 normal controls. In addition, this mutation was correlated to extra-colonic phenotypes featuring by duodenal polyposis and sebaceous cysts in this pedigree. This novel mutation can hopefully be utilized as a biomarker for molecular diagnosis and precise treatment in the foreseeable future. Materials and methods Subjects The family with FAP was recruited from Hospital of University of Electronic Science and Technology of China and Sichuan Provincial People's Hospital (Fig. 1). This study was conducted in accordance to the tenets of the Declaration of Helsinki and approved by the Institutional Review Boards of Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital. Written informed consents were obtained from the family prior to the study. 600 unrelated normal control subjects were recruited from participants who attended to the annual physical examination in Sichuan Provincial People's Hospital. They underwent comprehensive examinations and were free from any related diseases. Clinical diagnosis Twelve of the family members were diagnosed with FAP. Non-consanguineous marriages were found in the four-generation family and their clinical information is summarized in Table I. All the available members in this family were enrolled in our study and underwent complete clinical examination. Patient III: 7, diagnosed and treated in Sichuan Provincial People's Hospital, was the proband of this family (Fig. 1). FAP was confirmed in the family by endoscopic screening. The diagnostic criteria were as follows: (1) more than 100 colorectal polyps in total, and (2) at least 20 synchronous adenomatous polyps (Fig. 2). All patients' clinical information, family history, and the results of colonoscopic, laboratory, and pathologic examinations were collected. We obtained 5–10 ml of peripheral blood from as many families members as possible, with full informed consent, and reviewed pathologic slides whenever available. DNA extraction All genomic DNA was extracted from peripheral blood using a blood DNA extraction kit (QIAamp DNA Blood Midi kit; Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. DNA samples were stored at −20°C until used. DNA integrity was evaluated by 1% agarose gel electrophoresis and NanoDrop 2000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Targeted next-generation sequencing and variant detection In accordance with the literatures searched within online databases, a total of 200 candidate genes associated with colorectal cancer and ID/DD were selected as the genes of interest. We used a custom-designed gene panel, synthesized using the Agilent Sure-Select Target Enrichment technique (Zhongguancun Huakang Gene Institute, China), to capture the coding regions from the 200 genes, including their exons and exon-intron boundaries (1.285M bp in total). The following targeted next-generation sequencing (NGS) was performed on an Illumina GAIIx platform (Illumina, Inc., San Diego, CA, USA) using paired-end sequencing of 110 bp for two patients (III:7 and III:9). Bioinformatics analysis of the raw data included the following steps: i) image analysis using RTA software version 1.9 (real-time analysis, Illumina); ii) base calling using CASAVA software v1.8.2 (Illumina); iii) filtered out duplicate and low base quality score reads using the Genome Analysis Tool kit (GATK; Broad Institute) version 4; iv) aligned clean paired-end reads to the human reference genome build hg19 using BWA software (Pittsburgh Supercomputing Center, Pittsburgh, PA, U.S.A.) and v) identified insertion-deletions (indels) and single-nucleotide polymorphisms (SNPs) using the GATK and annotated using ANNOVAR (version 2017, July 16). The sequencing depth was more than 5X (range of 5X-185X; average of 136X), and the mean coverage was 98.56%. The detected variants were annotated and filtered based on public and in-house databases: i) Variants within intergenic, intronic, and UTR regions and synonymous mutations were excluded from downstream analysis and ii) variants in dbSNP138 (http://www.ncbi.nlm.nih.gov/projects/SNP/), 1000 Genomes Project (ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp), YH Database (http://yh.genomics.org.cn/), and HapMap Project (ftp://ftp.ncbi.nlm.nih.gov/hapmap) were excluded. Heterozygous variations of genes with autosomal dominant heredity were regarded as likely causative variations. We performed validation and parental origin analyses for these variations by conventional Sanger sequencing, and confirmed causative mutations according to parental origin of the variations and clinical features of the patients. Mutation validation The heterozygous APC (NM_000038.5) mutation identified by targeted NGS was further confirmed in all the family members and 600 normal controls by direct sequencing. Primers flanking the mutation were designed based on genomic sequences of Human Genome database and synthesized by Invitrogen; Thermo Fisher Scientific, Inc.: APC-F: GGGTTATATTAGTGATCCCTGCA; APC-R: ACACAGAGGAAGCAGCTGAT. Amplified PCR products were purified with spin columns (QIAquick; Qiagen, Inc., Valencia, CA, USA) and sequenced directly (BigDye Terminators Sequencing kit; Applied Biosystems; Thermo Fisher Scientific, Inc.) in both directions with an automated genetic analysis system (3730; ABI; Thermo Fisher Scientific, Inc.). Multiple sequence alignment of the human APC protein was performed along with other APC protein across different species, to check for the conservation of the residues. The homology modelling server SWISS-MODEL (www.swissmodel.expasy.org/) was used to predict the tertiary structure of APC protein. Brief Literature review A systematic literature search was conducted using the PubMed, Embase, Web of Science, and the Chinese Biomedical Database, in order to identify all published studies on the APC mutations of Han Chinese FAP subjects from their starting date to December 31, 2017. Two observers (YL and MP) independently piled up data from all eligible publications onto paper data collection forms. Disagreements were resolved by discussion until a consensus was achieved. Otherwise, two other investigators (BG and ZY) were consulted to resolve the dispute. The search strategy was based on the following search term/phase, ‘Familial adenomatous polyposis or FAP’, ‘adenomatous polyposis coli gene or APC’ and ‘Chinese’. The eligible articles were considered if they: i) evaluated germline mutations of APC gene in Chinese FAP families and ii) were original research articles, not reviews or comments. The articles selected were limited to studies in humans and in Han Chinese, but without restriction on sample size or time period. Excluded were abstracts from conferences, full texts without raw data available for retrieval, republished data, duplicate studies, association studies and reviews. A total of 79 Han Chinese families from 20 independent studies (including the current study) were included (some of the studies reported more than one family). All the mutations in the APC gene were coordinated using the same transcript reference NM_000038.5. Results Clinical findings A four-generation family composed of 29 members from Sichuan Province of China was recruited in this study. Among them, I1, I2, II1, II2, and II3 were deceased before this study, their information were collected from their medical records. III3 was deceased after he participated in this study and donated his blood sample. In total, 12 family members were diagnosed with FAP according to their clinical features, family history, medical history, colonoscopy, and pathology examinations. The disease exhibited a pattern of autosomal dominant inheritance, as indicated by the familial pedigree (Fig. 1). Detailed clinical information was presented in Table I. Extracolonic manifestations featuring by duodenal polyposis and sebaceous cysts were observed in all the available patients of this family, indicating a correlation with this novel mutation. The proband (III:7) had obvious duodenal polyposis, and was diagnosed with CRC at the age of 42 year old; while his cousin (III:15) had an onset of CRC at 43 year old. Two grape beaded polyps and multiple small polyps were present in the transverse colon and descending colon of the proband (Fig. 2). The mean age of diagnosis of polyposis was 30.5 years old among the patients in this family. The daughter (IV:5) and son (IV:6) of the proband had an aggressive phenotype with early onset of the polyposis at younger age of 16 and 21 years old, respectively. Targeted next-generation sequencing and mutation validation To ensure complete sequencing coverage of all coding regions in APC, the quality and reliability of NGS data were evaluated based on the percentage of readable bases and the coverage depth in the targeted region. In the APC gene, the coverage depth was up to 200×, with 100% of bases being readable in coding regions. This suggests high capacity for variant identification in most of the exons. Additionally, the mean depth was close to the median depth in each exon, indicating a good randomicity. On average, 295 variations within the 200 genes were found in the two patients (III:7 and III:9). Under the autosomal dominant model, 8 novel variations were filtered out. Because previously unclassified variations and pathogenic mutations detected by NGS were considered as causative candidate, the filtered data was narrowed down to a pathogenic heterozygous variant (c.1317delA in the APC gene). This variant was further validated using Sanger sequencing on other family members and 600 normal controls. Finally, we confirmed the novel heterozygous deletion mutation c.1317delA (p.Ala440LeufsTer14; Fig. 3A) in exon 10 of APC in the all of the affected members, and this mutation was absent in the unaffected member and the other 600 normal controls. Genotypes and phenotypes for the patients with APC mutations were described in Table I. Therefore, this mutation was co-segregated with the phenotype in this family. Comparative amino acid sequence alignment of other APC protein across different species revealed that this novel mutation occurred at highly conserved positions (Fig. 3B). This mutation is a 1-bp deletion of A at exon 10 (c.1317delA), leading to a subsequent reading frame-shift and producing a premature termination codon located at the 454th amino acid downstream (p.Ala440LeufsTer14). This premature termination consequently resulted in a truncation of 2,389 amino acids downstream of APC protein (Fig. 4). To further study the pathogenicity of this mutation, protein tertiary structures of wild type and p.Ala440LeufsTer14 mutation of APC were predicted using the SWISS-MODEL. According to the tetramer, the mutated APC protein lost C-terminal helices (2,389 amino acids downstream), which was an important region to bind with β-catenin, microtubule and other elements (Fig. 4). Brief literature review of the APC mutations in Han Chinese All the mutations that were hitherto reported were listed in Table II. We have retrieved 20 individual studies (including the current study). In total, there were 79 Han Chinese FAP families included, and 54 different APC mutations reported. Among the mutations, 59.3% (32/54) were frameshift mutations, 24.1% (13/54) were nonsense mutations, 3.7% (2/54) were missense mutations, 7.4% (4/54) were large deletions and 5.5% (3/54) were intronic variants. There were three main hotspot mutation sites in the APC gene: i) c.3180-c.3187/codon 1061–1062, which was in the β-catenin binding domain of APC, accounted for 12.7% (10/79) of the occurrence; ii) c.3921-c.3931/codon 1307–1309, which was in the mutation cluster region (MCR), accounted for 25.3% (20/79) of the occurrence; and iii) c.5432C>T (p.Ser1811Leu), which was in the β-catenin binding and down-regulation domain, accounted for 3.8% (3/79) of the occurrence. In total, these hotspot mutations accounted for 41.8% of the overall occurrence. Discussion Familial adenomatous polyposis (FAP) refers to an autosomal dominant inherited condition, which is characterized by the early onset of numerous adenomatous colorectal polyps. Approximately 50% of FAP patients develop adenomas at the age of 15, and it increases to 95% by the age of 35 years old (10). In many FAP patients, extra colonic manifestations are observed, including gastric and duodenal polyps, congenital hypertrophy of the retinal pigment epithelium (CHRPE), sebaceous cysts, and tumors in the upper gastrointestinal tract, thyroid gland and brain (5,6). In this pedigree, a novel frameshift mutation c.1317delA (p.Ala440LeufsTer14) in the APC gene was identified. The proband has the heterozygous mutation, so theoretically he inherited the mutant strand from his father (who was also a patient) and the wild-type strand from his mother (who was healthy). But unfortunately we are not able to validate the phenotypes of the proband's father and mother, because both of them passed away. However, we noticed that the novel mutation was correlated to extra colonic manifestations featuring by duodenal polyposis and sebaceous cysts. In addition, FAP patients also have a high lifetime risk of colorectal cancer (CRC), which is one of the most common forms of cancer in the world (10,11). In this family, patient III:7 (proband) and III:15 have been already diagnosed with CRC at the age of 42 and 43 respectively. Considering FAP-related CRC takes many years to develop, and the overall mean age of onset for CRC is 40 years old (3), unfortunately it's possible that other patients in this family may still have a high risk of CRC as time goes by. As a result, early diagnosis and routine medical monitoring are remarkably crucial for the FAP patients. Genetic diagnosis mainly focuses on the APC gene in chromosome 5q22.2, as mutations in this gene almost account for all cases of FAP (12). The APC gene encodes a tumor suppressor protein, which is responsible for ubiquitination and degradation of β-catenin and functions as an antagonist of the Wnt signaling pathway (13,14). β-catenin is an important factor in cell cycle entry, proliferation, differentiation, migration, apoptosis, and progression. Abnormal accumulation of β-catenin and aberrant activation of Wnt/β-catenin pathway leads to progression of several major human cancers (15,16). In addition, APC also involves in other processes including cell migration and adhesion, transcriptional activation, microtubule stabilization and apoptosis. Inactivation of APC can lead to defective chromosome segregation and aberrant mitosis (17–19). In the present study, we detected a novel frame shift mutation c.1317delA (p.Ala440LeufsTer14) in the exon 10 of the APC gene in a large Chinese FAP pedigree. This mutation could result in a truncation of 2,389 amino acids downstream of APC protein. Protein tertiary structure analysis revealed that the mutated APC protein lost C-terminal helices, which was an important region to bind with β-catenin, microtubule and other elements. Hitherto, more than 4,600 APC mutations have been reported according to Leiden Open Variation Database (LOVD; databases.lovd.nl/shared/genes/APC). However, these mutations are related to numerous diseases, mainly gastric cancer. And they are not confined to a certain population. Given that FAP-related CRC only accounts for approximately 1% of overall CRC (2) and ethnical difference might exist among different populations, we conducted a brief literature review and focused on the APC mutation spectrum only in the Han Chinese FAP population. According to our findings, among the 4,600 reported mutations, only 54 were related to Han Chinese FAP. Truncating mutations, including frameshift mutations (59.3%), nonsense mutations (24.1%) and large deletions (7.4%), account for an overall percentage of 90.8%. While non-truncating mutations, including missense mutations (3.7%) and intronic mutations (5.5%), account for the rest 9.2%. These findings support that direct sequencing of APC gene could still be the gold standard and the most accurate method in genetic diagnosis of FAP. In fact, there are several other alternative methods for gene testing, such as protein truncation test (PTT), multiplex ligation-dependent probe amplification (MLPA), southern blot, and real-time quantitative PCR (RT-PCR). But the major disadvantage of these methods is the inability to detect the non-truncating mutations, which account for 9.2% in the Han Chinese population. As a result, we still recommend that FAP testing should be performed using direct sequencing of the whole APC gene to detect the small-scale mutations along with MLPA to identify large insertion and deletions. If no mutation is detected, then testing for large gene rearrangements should be conducted. To sum up, we reported that a novel heterozygous frame shift mutation c.1317delA (p.Ala440LeufsTer14) in the APC gene was responsible for FAP in a large Chinese pedigree. And we revealed a genotype-phenotype correlation between this novel mutation and extra colonic manifestations featuring by duodenal polyposis and sebaceous cysts. In the meantime, we conducted a literature review, piling up all the reported APC mutations causing FAP in the Han Chinese population. In summary, these data enhance understanding of the mutation spectrum of the APC gene causing FAP in Han Chinese and inform the development of effective guidelines in its genetic diagnosis and clinical management. Acknowledgements Not applicable. Funding The present study was supported by grants from the Natural Science Foundation of China (grant nos. 81371048 and 81670853), The Department of Science and Technology of Sichuan Province, China (grant no. 2015HH0031) and The Department of Sichuan Provincial Health (grant no. 130163). Availability of data and materials The datasets used and analyzed during the current study are available from the corresponding authors on reasonable request. Authors' contributions BG and ZY designed the study. MP, XiH, XuH, NH, PL, LL, JF and KW recruited the participants and collected the clinical information. ZY and JY performed the sequencing analysis. YL and MP conducted the literature review and analyzed the data. ZY wrote the initial draft, and BG corrected the English spelling and grammar. All authors critically revised, reviewed and approved the publication of this manuscript. Ethics approval and consent to participate The present study was approved by the Institutional Review Boards of Sichuan Academy of Medical Sciences and Sichuan Provincial People's Hospital (Sichuan, China). Written informed consents were obtained from the family prior to the study. Consent for publication Written informed consents were obtained from the family prior to the study. Competing interests The authors declare that they have no competing interests. Figure 1. Pedigree of the FAP family. A four-generation family composed of 29 members from Sichuan, China, was recruited in the present study. The black arrow denotes the proband, solid symbols indicate affected individuals, and open symbols indicate unaffected individuals. In total, 12 family members were diagnosed with FAP. The disease exhibited a pattern of autosomal dominant inheritance. FAP, familial adenomatous polyposis; squares, males; circles, females; symbols with diagonal lines, deceased. Figure 2. Clinical characterization of the proband of this pedigree. (A) Two grape beaded polyps (red arrows) and some small polyps in the transverse colon. (B) A grape beaded polyp and some small polyps (red arrows) in the transverse colon. Figure 3. Novel mutation in the APC gene in this pedigree. (A) The novel heterozygous mutation c.1317delA (p.Ala440LysfsTer14) was validated using Sanger sequencing. (B) Multiple sequence alignment of APC proteins from various species. Red shades showed the premature termination of amino acids, which was resulted from the deletion. This region is highly conserved acrossdifferent species. APC, Adenomatous polyposis coli. Figure 4. Structure modeling of the functional domains of APC protein. (A) Structure of the APC protein, the red box denotes the site of the novel mutation, the green box shows the premature termination codon, the box with a dashed blue line indicates the truncated region of this protein, and the colored squares indicate the sub-domains in the APC protein. (B) Structure modeling of wild type and p.Ala440LeufsTer14 mutation of APC with SWISS-MODEL. Compared with wild type, the mutant leads to premature termination and potential loss of ability to bind with β-catenin. A440, Ala440; aa, amino acids; APC, Adenomatous polyposis coli. Table I. Clinical information of the participants in the family. Family ID Gender Age (years) Diagnosis Age at diagnosis Mutation Polyp count CRC (age of onset) Extra-colonic features I:1a M Deceased Patient Unspecified Unspecified Unspecified Unspecified Unspecified I:2a F Deceased Normal / / / / / II:1a F Deceased Normal / / / / / II:2a M Deceased Patient Unspecified Unspecified Unspecified Unspecified Unspecified II:3b M Deceased Patient Unspecified Unspecified Unspecified Unspecified Unspecified II:4 F 75 Normal / / / / / III:1 M 64 Normal / / / / / III:2 F 62 Normal / / / / / III:3b M Deceased Patient 34 c.1317delA >100 Unspecified None III:4 M 47 Patient 37 c.1317delA >100 None None III:5 F 46 Normal / / / / / III:6 M 45 Patient 38 c.1317delA >100 None None III:7 F 43 Patient 36 c.1317delA >100 42 None III:8 M 45 Normal / / / / / III:9 M 53 Patient 44 c.1317delA >100 None None III:10 F 50 Normal / / / / / III:11 M 50 Patient 49 c.1317delA >100 None None III:12 F 48 Normal / / / / / III:13 F 48 Normal / / / / / III:14 F 47 Normal / / / / / III:15 M 43 Patient 40 c.1317delA >100 43 None IV:1 M 39 Normal / / / / / IV:2 M 37 Normal / / / / / IV:3 M 24 Normal / / / / / IV:4 M 12 Normal / / / / / IV:5 F 24 Patient 21 c.1317delA >100 None None IV:6 M 19 Patient 16 c.1317delA >100 None None IV:7 F 20 Normal / / / / / IV:8 F 22 Normal / / / / / a I1, I2, II1, II2, II3 were deceased prior to the present study, their information was collected from their medical records. b III3 was deceased following participation in the present study and donated his blood sample. M, male; F, female; /, not applicable; CRC, colorectal cancer. Table II. Reported APC mutations causing familial adenomatous polyposis in the Han Chinese population. Author, year Mutation in APC gene (Han Chinese) Codon Mutation types Occurrence (Refs.) Liu et al, 2005 c.366delG(p.Phe123LeufsX2) 123 Frameshift 1 (20) Liu et al, 2005 c.387insT(p.Glu129AspfsX10) 129 Frameshift 1 (20) Liu et al, 2005 c.541insA(p.Gln181ThrfsX12) 181 Frameshift 1 (20) Liu et al, 2005 c.637C>T(p.Arg213X) 213 Nonsense 1 (20) Pang et al, 2001 c.646C>T (p.Arg216X) 216 Nonsense 1 (21) Cai et al, 2008 c.694C>T(p.Arg232X) 232 Nonsense 1 (22) Cai et al, 2008 c.763_764insA(p.His255GlnfsX2) 255 Frameshift 1 (22) Zhang et al, 2016 c.794_795insG (p.Val266SerfsX11) 266 Frameshift 1 (23) Liu et al, 2005; c.847C>T(p.Arg283X) 283 Nonsense 2 (20,21) Pang et al, 2001 Liu et al, 2005 c.1213C>T(p.Arg405X) 405 Nonsense 1 (20) Pang et al, 2018 c.1317delA (p.Ala440LeufsX14) 440 Frameshift Novel The present study Sheng et al, 2010 c.1327G>T (p.Glu443X) 443 Nonsense 1 (24) Liu et al, 2005 c.1495C>T(p.Arg499X) 499 Nonsense 1 (20) Jang et al, 2010 c.1548G>C (p.Lys516Asn) 516 Missense 1 (25) Jang et al, 2010 c.1766T>A (p.Leu589X) 589 Nonsense 1 (25) Song et al, 2013 c.1828_1829insG (p.Asp610GlyfsX23) 610 Frameshift 1 (26) Chen et al, 2011 c.1999 C>T (p. Gln667X) 667 Nonsense 1 (27) Jang et al, 2010 c.2016_2047del (p.Ser673LeufsX10) 673 Frameshift 1 (25) Cai et al, 2008 c.2031_2034delCAGT (p.Ser678MetfsX39) 678 Frameshift 1 (22) Zhang et al, 2016 c.2142_2143insG (p.His715AlafsX19) 715 Frameshift 1 (23) Cai et al, 2008 c.2240C>G(p.Ser747X) 747 Nonsense 1 (22) Sheng et al, 2010 c.2336_2337insT (p.Leu779PhefX9) 779 Frameshift 1 (24) Jang et al, 2010 c.2510C>G (p.Ser837X) 837 Nonsense 1 (25) Liu et al, 2005 c.2547_2550delTAGA (p.Asp849GlufsX11) 849 Frameshift 1 (20) Li et al, 2017 c.2971G>T (p.Glu991X) 991 Nonsense 1 (28) Pang et al, 2001 c.3067_3068insA (p.Thr1023AsnfsX6) 1,023 Frameshift 1 (21) Cai et al, 2008 c.3182_3183delAA (p.Lys1061ThrfsX3)a 1,061 Frameshift 1 (22) Liu et al, 2005; c.3183_3187delACAAA 1,061 Frameshift 5 (20–24) Pang et al, 2001; (p.Lys1061LysfsX2)a Cai et al, 2008; Sheng et al, 2010 Wang et al, 2008; c3184_3187delCAAA 1,061 Frameshift 3 (29–31) Chen et al, 2015; (p.Gln1061AspfsX59) Chen et al, 2015 Jang et al, 2010 c.3180_3184del (p.Gln1062X) 1,062 Nonsense 1 25 Cai et al, 2008; c.3202_3205delTCAA 1,068 Frameshift 3 (22,24) Sheng et al, 2010 (p.Ser1068GlyfsX57) Zhang et al, 2017 c.3418delC (p.Pro1140Leufx25) 1,140 Frameshift 1 (32) Cai et al, 2008 c.3576delA(p.Lys1192AsnfsX73) 1,192 Frameshift 1 (22) Zhu et al, 2012 c.3587C>A(p.Ser1196X) 1,196 Frameshift 1 (33) Liu et al, 2005 c.3667delC (p.Ser1223LeufsX42) 1,223 Frameshift 1 (20) Chen et al, 2015 c.3921_3924delAAAA (p.Ile1307MetfsX13)a 1,307 Frameshift 1 (31) Sheng et al, 2010 c.3923_3929delAAGAAAA (p.Lys1308ArgfsX11)a 1,308 Frameshift 1 (24) Chen et al, 2015 c.3926_3929delAAAAa 1,309 Frameshift 1 (30) Liao et al, 2014 c.3922_3925 del AAAG (p. Glu1309Argfs ×11) 1,309 Frameshift 1 (34) Wang et al, 2008; c.3926_3930delAAAAG 1,309 Frameshift 6 (29–31,34) Chen et al, 2015; (p.Glu1309AspfsX4) Chen et al, 2015; Liao et al, 2014 Liu et al, 2005; c.3927_3931delAAAGA 1,309 Frameshift 10 (20,22,24,35-37) Cai et al, 2008; (p.Glu1309AspfsX4) Sheng et al, 2010; Zhang et al, 2016; Pan et al, 2014; Gan et al, 1994 Chen et al, 2015 c4127_4126delAT (p.Tyr1376LysfsX9) 1,376 Frameshift 1 (31) Sheng et al, 2010 c.4179_4180GAdelinsT (p.Asp1394LeufsX21) 1,394 Frameshift 1 (24) Cai et al, 2008 c.4209delC (p.Ser1404ProfsX11) 1,404 Frameshift 1 (22) Liu et al, 2005 c.4391_4394delAGAG (p.Glu1464ValfsX8) 1,464 Frameshift 1 (20) Wang et al, 2008; c.5432C>T (p. Ser1811Leu)a 1,811 Missense 3 (29–31) Chen et al, 2015; Chen et al, 2015 Liu et al, 2005 c.5947_5950delGAAA (p.Glu1983MetfsX60) 1,983 Frameshift 1 (20) Jiang et al, 2015 c.1936-2148 del / Large deletion 1 (3) Sheng et al, 2010 10A (Alternative exon) and Exon11 / Large deletion 1 (24) Sheng et al, 2010 Exon15 start / Large deletion 1 (24) Zhang et al, 2016 c.423_8532del / Large deletion 1 (38) Sheng et al, 2010 c.532-2A>T / Intronic 1 (24) Sheng et al, 2010 c.657+1G>A / Intronic 1 (24) Zhang et al, 2016 c.1312+1G>A / Intronic 1 (23) a Hotspot mutation sites of the APC gene in Han Chinese population. APC, Adenomatous polyposis coli. ==== Refs References 1 Half E Bercovich D Rozen P Familial adenomatous polyposis Orphanet J Rare Dis 4 22 2009 10.1186/1750-1172-4-22 19822006 2 Galiatsatos P Foulkes WD Familial adenomatous polyposis Am J Gastroenterol 101 385 398 2006 10.1111/j.1572-0241.2006.00375.x 16454848 3 Jiang SS Li JJ Li Y He LJ Wang QJ Weng DS Pan K Liu Q Zhao JJ Pan QZ A novel pathogenic germline mutation in the adenomatous polyposis coli gene in a Chinese family with familial adenomatous coli Oncotarget 6 27267 27274 2015 10.18632/oncotarget.4776 26311738 4 Sung JJ Lau JY Goh KL Leung WK Asia Pacific Working Group on Colorectal Cancer: Increasing incidence of colorectal cancer in Asia: Implications for screening Lancet Oncol 6 871 876 2005 10.1016/S1470-2045(05)70422-8 16257795 5 Jang YH Lim SB Kim MJ Chung HJ Yoo HW Byeon JS Myung SJ Lee W Chun S Min WK Three novel mutations of the APC gene in Korean patients with familial adenomatous polyposis Cancer Genet Cytogenet 200 34 39 2010 10.1016/j.cancergencyto.2010.03.015 20513532 6 Burt RW DiSario JA Cannon-Albright L Genetics of colon cancer: Impact of inheritance on colon cancer risk Annu Rev Med 46 371 379 1995 10.1146/annurev.med.46.1.371 7598472 7 Stenson PD Ball EV Mort M Phillips AD Shiel JA Thomas NS Abeysinghe S Krawczak M Cooper DN Human gene mutation database (HGMD): 2003 update Hum Mutat 21 577 581 2003 10.1002/humu.10212 12754702 8 Fearnhead NS Britton MP Bodmer WF The ABC of APC Hum Mol Genet 10 721 733 2001 10.1093/hmg/10.7.721 11257105 9 Korinek V Barker N Morin PJ van Wichen D de Weger R Kinzler KW Vogelstein B Clevers H Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma Science 275 1784 1787 1997 10.1126/science.275.5307.1784 9065401 10 Leoz ML Carballal S Moreira L Ocaña T Balaguer F The genetic basis of familial adenomatous polyposis and its implications for clinical practice and risk management Appl Clin Genet 8 95 107 2015 25931827 11 Ibrahim A Barnes DR Dunlop J Barrowdale D Antoniou AC Berg JN Attenuated familial adenomatous polyposis manifests as autosomal dominant late-onset colorectal cancer Eur J Hum Genet 22 1330 1333 2014 10.1038/ejhg.2014.20 24549056 12 Aihara H Kumar N Thompson CC Diagnosis, surveillance, and treatment strategies for familial adenomatous polyposis: Rationale and update Eur J Gastroenterol Hepatol 26 255 262 2014 10.1097/MEG.0000000000000010 24161962 13 Van de Wetering M Sancho E Verweij C de Lau W Oving I Hurlstone A van der Horn K Batlle E Coudreuse D Haramis AP The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells Cell 111 241 250 2002 10.1016/S0092-8674(02)01014-0 12408868 14 Sieber OM Tomlinson IP Lamlum H The adenomatous polyposis coli (APC) tumour suppressor-genetics, function and disease Mol MedToday 6 462 469 2000 15 Moon RT Kohn AD De Ferrari GV Kaykas A WNT and beta-catenin signalling: Diseases and therapies Nat Rev Genet 5 691 701 2004 10.1038/nrg1427 15372092 16 Tang Y Simoneau AR Liao WX Yi G Hope C Liu F Li S Xie J Holcombe RF Jurnak FA WIF1, a Wnt pathway inhibitor, regulates SKP2 and c-myc expression leading to G1 arrest and growth inhibition of human invasive urinary bladder cancer cells Mol Cancer Ther 8 458 468 2009 10.1158/1535-7163.MCT-08-0885 19174556 17 Sulekova Z Reina-Sanchez J Ballhausen WG Multiple APC messenger RNA isoforms encoding exon 15 short open reading frames are expressed in the context of a novel exon 10A-derived sequence Int J Cancer 63 435 441 1995 10.1002/ijc.2910630323 7591245 18 Zumbrunn J Kinoshita K Hyman AA Nathke IS Binding of the adenomatous polyposis coli protein to microtubules increases microtubule stability and is regulated by GSK3 beta phosphorylation Curr Biol 11 44 49 2001 10.1016/S0960-9822(01)00002-1 11166179 19 Adamcikova Z Wachsmannova L Hainova K Stevurkova V Holec V Ciernikova S Cierna Z Janega P Babal P Mego M Study of the APC gene function in the mouse APC+/APC1638N model Neuro Endocrinol Lett 33 26 33 2012 22467108 20 Liu XR Shan XN Friedl W Uhlhaas S Propping P Wang YP Analysis of germline mutations in the APC gene in familial adenomatous polyposis patients Zhonghua Yi Xue Yi Chuan Xue Za Zhi 22 261 264 2005 15952110 21 Pang CP Fan DS Keung JW Baum L Tang NL Lau JW Lam DS Congenital hypertrophy of the retinal pigment epithelium and APC mutations in Chinese with familial adenomatous polyposis Ophthalmologica 215 408 411 2001 10.1159/000050898 11741105 22 Cai SR Zhang SZ Zheng S Detection of adenomatous polyposis coli gene mutations in 31 familial adenomatous polyposis families by using denaturing high performance liquid chromatography Zhonghua Yi Xue Yi Chuan Xue Za Zhi 25 164 167 2008 (In Chinese) 18393237 23 Zhang S Qin H Lv W Luo S Wang J Fu C Ma R Shen Y Chen S Wu L Novel and reported APC germline mutations in Chinese patients with familial adenomatous polyposis Gene 577 187 192 2016 10.1016/j.gene.2015.11.034 26625971 24 Sheng JQ Cui WJ Fu L Jin P Han Y Li SJ Fan RY Li AQ Zhang MZ Li SR APC gene mutations in Chinese familial adenomatous polyposis patients World J Gastroenterol 16 1522 1526 2010 10.3748/wjg.v16.i12.1522 20333795 25 Jang YH Lim SB Kim MJ Chung HJ Yoo HW Byeon JS Myung SJ Lee W Chun S Min WK Three novel mutations of APC gene in Chinese patients with familial adenomatous polyposis Cancer Genet Cytogenet 200 34 39 2010 10.1016/j.cancergencyto.2010.03.015 20513532 26 Song G Yuan Y Zheng F Yang N Novel insertion mutation p. Asp610GlyfsX23 in APC gene causes familial adenomatous polyposis in Chinese families Gene 516 204 208 2013 10.1016/j.gene.2012.12.077 23291410 27 Chen S Zhou J Zhang X Zhou X Zhu M Zhang Y Ma G Li J Mutation analysis of the APC Gene in a Chinese FAP Pedigree with unusual Phenotype ISRN Gastroenterol 2011 909121 2011 22164339 28 Li H Zhang L Jiang Q Shi Z Tong H Identification a nonsense mutation of APC gene in Chinese patients with familial adenomatous polyposis Exp Ther Med 13 1495 1499 2017 10.3892/etm.2017.4122 28413499 29 Wang TT Chen SQ Zhang XM Germline mutation of adenomatous polyposis coli gene in Chinese patients with familial adenomatous polyposis Zhonghua Yi Xue Yi Chuan Xue Za Zhi 25 199 202 2008 18393246 30 Chen Q Liu S Feng J Zhang X Chen S Ma G Zhu M Zhang Y Yu J Analysis of C.3925_3929 deletional mutations of APC gene in pedigrees with familial adenomatous polyposis Zhonghua Yi Xue Yi Chuan Xue Za Zhi 32 524 528 2015 (In Chinese) 26252100 31 Chen QW Zhang XM Zhou JN Zhou X Ma GJ Zhu M Zhang YY Yu J Feng JF Chen S Analysis of small fragment deletions of the APC gene in chinese patients with familial adenomatous polyposis, a precancerous condition Asian Pac J Cancer Prev 16 4915 4920 2015 10.7314/APJCP.2015.16.12.4915 26163615 32 Zhang Z Liang S Wang D Liang S Li Y Wang B Jiang T Zhao G Zhang X Banerjee S A novel pathogenic single nucleotide germline deletion in APC gene in a four generation Chinese family with familial adenomatous polyposis Sci Rep 7 12357 2017 10.1038/s41598-017-10395-x 28955048 33 Zhu Z Huang J Dong J Analysis of APC mutation in five kindreds of familial adenomatous polyposis Med J West China 24 1654 1657 2012 34 Liao DX Li B Du XM Yu JH Chang H Wu ZQ Hao HJ Wang YX Han WD Cheng SJ Luo CH Two Chinese pedigrees for adenomatous polyposis coli: New mutations at codon 1309 and predisposition to phenotypic variations Fam Cancer 13 361 368 2014 10.1007/s10689-014-9713-8 24664542 35 Zhang J Li Z Huang X Ye J Clinical and molecular characteristics of a child with familial adenomatous polyposis Zhonghua Er Ke Za Zhi 54 205 208 2016 26957067 36 Pan H Gao HL Wu QY Diagnosis of APC gene mutation in a patient with familial adenomatous polyposis Mil Med J Southeast China 16 566 168 2014 37 Gan YB Zheng S Cai XH Detection of a gene mutation in familial adenomatous polyposis families by PCR-RFLP method Zhonghua Yi Xue Za Zhi 74 352 354 390–391 1994 (In Chinese) 7994644 38 Zhang Z Liang S Huang H Wang D Zhang X Wu J Chen H Wang Y Rong T Zhou Y Banerjee S A novel pathogenic large germline deletion in adenomatous polyposis coli gene in a Chinese family with familial adenomatous polyposis Oncotarget 7 50392 50400 2016 27391059