==== Front
J Vet Med SciJ. Vet. Med. SciJVMSThe Journal of Veterinary Medical Science0916-72501347-7439The Japanese Society of Veterinary Science 2976031317-049910.1292/jvms.17-0499Internal MedicineFull PaperDetection of Sirtuin-1 protein expression in peripheral blood leukocytes in dogs YOSHIMURA Kuniko 1MATSUU Aya 2SASAKI Kai 1MOMOI Yasuyuki 1*1) Laboratory of Veterinary Diagnostic Imaging, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan2) Transboundary Animal Diseases Research Center, Joint Faculty of Veterinary Medicine, Kagoshima University, 1-21-24 Korimoto, Kagoshima 890-0065, Japan* Correspondence to: Momoi, Y.: k5241972@kadai.jp11 5 2018 7 2018 80 7 1068 1076 06 9 2017 01 5 2018 ©2018 The Japanese Society of Veterinary Science2018This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (by-nc-nd) License. (CC-BY-NC-ND 4.0:  https://creativecommons.org/licenses/by-nc-nd/4.0/)Sirtuin-1 (SIRT1) is a nicotinamide adenine dinucleotide (NAD+)-dependent histone deacetylase with a large number of protein substrates. It has attracted a lot of attention in
association with extending lifespan. The objective of this study was to enable the evaluation of SIRT1 expression in peripheral blood mononuclear cells (PBMCs) from dogs by flow cytometry.
Three transcript variants were amplified from PBMCs by reverse transcription PCR and the nucleotide sequences were analyzed. On the basis of deduced amino acid sequence, a monoclonal
antibody against human SIRT1, 1F3, was selected to detect canine SIRT1. Canine SIRT1 in peripheral blood mononuclear cells was successfully detected by western blotting using this antibody.
Intracellular canine SIRT1 was also detected in permeabilized 293T cells transfected with a canine SIRT1 expression plasmid by flow cytometry using this antibody. SIRT1 was detected in all
leukocyte subsets including lymphocytes, granulocytes and monocytes. The expression level was markedly different among individual dogs. These results indicated that the method applied in
this study is useful for evaluating canine SIRT1 levels in PBMCs from dogs.

dogflow cytometrysirtuin-1
==== Body
Previous studies have characterized Sir2 protein as a pro-longevity factor for replicative lifespan in yeast [15, 20, 26, 46, 53]. Sir2 orthologs also extended lifespan in other
organism species including Caenorhabditis elegans and flies [43, 50]. Because it has been suggested
that the beneficial effects of caloric restriction on lifespan are mediated by Sir2 orthologs in higher eukaryotes [4, 7, 8, 44], sirtuins received significant public interest. Sirtuins are a family of highly conserved
nicotinamide adenine dinucleotide (NAD+)-dependent protein deacylases found in eukaryotes. In humans, there are seven sirtuin homologs (SIRT1–7). All sirtuins require NAD+
as a cofactor, making them prone to regulation by fluctuations in NAD+ conditions, thus linking them to cellular metabolism in response to nutritional and environmental perturbations such as
caloric restriction. Of all the sirtuins, SIRT1 has received the most attention in relation to longevity. It deacetylates key histone residues involved in transcription regulation, and multiple
non-histone proteins including p53, FOXO1/3, PGC-1α and NF-κB [11, 37, 51].
By targeting these proteins, SIRT1 is able to regulate numerous vital signaling pathways, including DNA repair, apoptosis, muscle and fat differentiation, neurogenesis, mitochondrial biogenesis,
hormone secretion, cell stress responses and circadian rhythms [3, 37, 42]. In
general, SIRT1 activation triggers nuclear transcription programs that enhance metabolic efficiency and up-regulate mitochondrial oxidative metabolism accompanying resistance to oxidative stress
[13, 16].

SIRT1 is expressed in systemic organs and localizes primarily in the nucleus [37]. SIRT1 is also detected in the cytoplasm of granulocytes and monocytes
[47]. Though its enzymatic activity has been measured to evaluate its potential inhibitors and activators using cultured cells or recombinant SIRT1
[14] with respect to longevity, it is usually difficult to evaluate its activity in tissue samples obtained from patients. Thus SIRT1 expression was
evaluated by measuring mRNA transcription, tissue SIRT1 protein expression or plasma SIRT1 concentration in association with nutritional conditions or diseases [10, 21, 23, 24, 29, 35, 36, 38, 49]. Not only SIRT1 activation
but also increasing SIRT1 expression is related to lifespan extension in experimental condition [2]. Compounds that increase SIRT1 expression have been
intently screened and reported [41].

To our knowledge, there are few published studies measuring SIRT1 level in companion animals [17, 18, 30, 31]. In dogs, there are two reports: one is in association with the p53 mutations status in a dog with multiple
tumors [31], and the other evaluated SIRT1 gene expression in a cell line in relation to coronavirus infection [30]. The reason for the low number of studies is, at least in part by, the lack of antibodies to detect canine SIRT1.

The aim of this study is to determine the nucleotide sequence of canine SIRT1 mRNA and make SIRT1 protein detection possible in lymphocytes, which are easily available in
veterinary clinical settings. Flow cytometry was applied to clinical cases to obtain basic information on SIRT1 expression in canine lymphocytes.

MATERIALS AND METHODS
Animals and blood samples
Dogs were client owned or protection dogs brought to the Kagoshima University Veterinary Teaching Hospital for veterinary care. Residues of heparinized blood samples applied for biochemical
tests were used in this study. Information including the patient’s signalment, body condition score (5 points scale), diagnosis and undergoing treatment was obtained from the veterinary
medical record or from the veterinarians in charge.

Determination of canine SIRT1 mRNA nucleotide sequence
Total RNA was extracted from an EDTA-K2-treated blood sample from client owned dogs using a PureLink RNA Mini Kit (ThermoFisher Scientific, Waltham, MA, U.S.A.). Reverse transcription
polymerase chain reaction (PCR) was performed using Primescript One Step RT-PCR kit (Takara, Kusatsu, Japan). In a preliminary experiment, we could not amplify cDNA fragments encompassing
the whole predicted canine SIRT1 coding region (GenBank Accession No. XM_546130.4). Thus, primer pairs were designed to amplify two overlapping DNA fragments that cover the
whole SIRT1 coding region by nested and semi-nested PCR. In the first PCR, 5′-end and 3′-end DNA fragments were amplified by One-Step RT-PCR using the Sense_1-Reverse_1 and
Sense_2-Reverse_2 primer pairs, respectively (Table 1Table 1. Oligo nucleotide primers used in this study
	Primer name	Nucleotide sequence (5′-3′)	Positiona)	Remarks	
For 1st reverse-trasnscription PCR	Sense_1	ggaggagggccagagaggcagtt	71–93	For 5′ fragment amplification	
Reverse_1	ggtggaacaattcctgtacct	2371–2351		
	
Sense_2	agactgtgaagctgtacgag	1220–1239	For 3′ fragment amplification	
Reverse_2	cctgaaactcttagcaccaag	2981–2961		
	
For nested PCR	Sense_3	agttggaagatggcggacga	90–109	For 5′ fragment amplification	
Reverse_3	ggcatattcaccacctaacc	1580–1561		
	
Sense_2	agactgtgaagctgtacgag	1220–1239	For 3′ fragment amplification	
Reverse_1	ggtggaacaattcctgtacct	2371–2351		
	
For 5′-RACE	RT-primer	(P)-aaacattgcttgagg	977–963	Phosphorylated at 5′ end for RACE	
	
S1-primer	gtttcttgtggaatacctgact	882–903	For 1st PCR	
A1-primer	ggaggaattgtttctggtagt	721–701		
	
S2-primer	gcaatagacttcccagacct	936–955	For 2nd PCR	
A2-primer	ggatctgtgccaatcatgag	679–660		
a) Nucleotide data from predicetd canine SIRT1 cDNA sequence (GeneBank accession No. XM_546130.5).

). PCR conditions were 94°C for 2 min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 3 min. Then RT-PCR products were used as templates, nested and
semi-nested PCRs were conducted by GoTaq® Hot Start Colorless Master Mix (Promega, Madison, WI, U.S.A.), to amplify 5′ and 3′ cDNA fragments using the Sense_3-Reverse_3 and Sense_2-Reverse_1
primer pairs (Table 1). The PCR conditions were the same as the first PCR. The second set of PCR products were electrophoresed in 2% agarose. DNA
fragments were extracted from the gel and purified using High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany). The nucleotide sequence was determined by the dye
terminator method at a commercial laboratory, Fasmac (Atsugi, Japan). We also investigated canine SIRT1 transcript variants by 5′-terminal inverse PCR amplification. Total
RNA was extracted as mentioned above from blood samples obtained from a client owned Labrador Retriever. The 5′-end of canine SIRT1 cDNA was amplified using a 5′-Full RACE
Core Kit (Takara) according to the manufacturer’s instructions. The nucleotide sequence of the 5′-phosphorylated primer for reverse transcription (RT-primer) is shown in Table 1. Inverse nested PCRs were performed using GoTaq® Hot Start Colorless Master Mix. The nucleotide sequences of the primers for the first (S1-A1 primers) and
nested PCR (S2-A2 primers) are shown in Table 1. The PCR conditions for the first and second PCRs were 94°C for 2 min, followed by 30 cycles of
94°C for 30 sec, 55°C for 30 sec and 72°C for 3 min. The amplified PCR products were electrophoresed and purified as mentioned above, to determine the nucleotide sequences.

Western blot analysis of canine SIRT1 protein
We conducted to detect canine endogenous SIRT1 protein levels in PBMCs by western blotting. Heparinized blood sample from two client owned dogs was used for the analysis. The samples were
overlaid on Lympholyte-H specific gravity 1.077 (Cedarlane, Burlington, Ontario, Canada) and centrifuged at 900 × g for 30 min. PBMCs were collected and washed in phosphate-buffered saline
(PBS). Human embryonic kidney cells 293 (HEK293) [12] and Madin-Darby canine kidney cells (MDCK) [28] were also
used for western blotting as a source of human and canine SIRT1 protein. Cultured cells were resuspended in PBS and an equal volume of 2x sample buffer [0.125 M Tris-HCl, pH 6.8, 10% (v/v)
2-mercaptoethanol, 4% sodium dodecyl sulfate (SDS), 10% sucrose, 0.01% Bromophenol blue], and incubated at 95°C for 3 min. Samples were stored at −20°C until use. Twenty microliters of each
sample at the concentration of 2.5–5 mg/ml protein concentration (Bradford protein assay kit, Takara) were loaded on 8% polyacrylamide gels and electrophoresed. Samples were
transferred to nitrocellulose membranes (GE NitrocelluloseTM Pure Unsupported Nitrocellulose Membranes, GVS Filter Technology, Emilia-Romagna, Italy) using Trans blot SD Semi-Dry
Transfer Cell (Bio-rad, Hercules, CA, U.S.A.). The membranes were washed with Tris-buffered saline with 0.1% Tween (TBS-T: 0.05 M Tris, 0.138 M NaCl, 0.0027 M KCl and 0.1% Tween20), and then
incubated in 1 x TBS-T supplemented with 5% (w/v) Nonfat Dry milk (Cell Signaling Technology, Danvers, MA, U.S.A.). The membranes were washed with 1 x TBS-T, and then incubated with the
anti-human SIRT1 monoclonal antibody, 1F3 (Cell Signaling Technology), diluted in 1 x TBS-T (1:1,000) at 4°C overnight. The membranes were washed with 1 x TBS-T and incubated with diluted
(1:5,000) horseradish peroxidase-conjugated rabbit anti-mouse IgG (Dako, Glostrup, Denmark) for 1 hr at room temperature. The membranes were washed with TBS-T and chemiluminescence was
detected with ECL Prime Western Blotting Detection System (GE Healthcare, Parsippany, NJ, U.S.A.) using the FUSION SOLO S imaging system (Vilber-Loumat, Collegien, France).

Expression of recombinant canine SIRT1
Canine SIRT1 expression plasmid was constructed to examine canine SIRT1 protein could be detected by flow cytometry using the monoclonal antibody 1F3 against human SIRT1. We detected three
canine SIRT1 mRNA transcript variants Variant1-3. The deduced amino acid sequence of Variant2 and Variant3 was the same . Thus we planned to express the protein coded by
Variant1 and Variant2 (Fig. 1Fig. 1. Schematic view of the structure of the canine SIRT1 mRNA variants. A: Predicted canine SIRT1 mRNA structure (XM_546130.4). B: Putative gene structure
of a canine SIRT1 mRNA transcript variant (variant 1) obtained by RT-PCR using RNA from canine PBMC. C, D: Putative 5′ terminal mRNA structure obtained by 5′ RACE
using RNA from PBMC. The translation start codon was predicted using the ATGpr program.

). Nucleotides corresponding to Variant1 were synthesized at Fasmac, adding a Kozak sequence “ccacc” adjunct to the putative start codon. The codon was modified to optimize protein
expression in human cells. DNA fragments corresponding to Variant1 and Variant2 were amplified by PCR from the synthesized gene using KOD-Plus-Neo polymerase (Toyobo, Osaka, Japan) and
sub-cloned into pcDNA3.1 (+), a mammalian expression plasmid. The Canine SIRT1 expression plasmids, named Dog_Sirt1-long pcDNA3.1, Dog_Sirt1-short pcDNA3.1 was transfected into 293T cells
[9] using X-tremeGENE HP DNA Transfection Reagent (Roche Diagnotics, Basel, Switzerland) and cultured for 48 hr. Then, the culture medium was removed
and the cells were detached using TrypeLE express (Thermo Fisher Scientific). The washed cells were applied for flow cytometry analysis.

Flow cytometry analysis of canine SIRT1 protein
Canine SIRT1 expression was examined in SIRT1 expression plasmids transfected 293T cells and PBMCs. PBMCs were isolated by gradient centrifugation from heparinized blood samples using
Lympholyte-H as mentioned above. PBMCs were collected and washed with PBS. PBMCs and the transfected 293T cells were fixed and permeabilized using FIX & PERM® Cell Permeablization
Reagents (Thermo Fisher Scientific) according to the manufacturer’s instructions. The cells were incubated with 1F3 monoclonal antibody (1:200), anti-β-actin monoclonal antibody (8224,
Abcam; 1:200) as a positive control, or mouse IgG1k isotype Ctrl (MOPC-21, BioLegend, CA, U.S.A.; 1:100) at 4°C for 30 min. The cells were washed and incubated with phycoerythrin conjugated
goat anti-mouse IgG (1: 1,000) for 20 min at room temperature. The cells were then washed with PBS and flow cytometry analysis was performed using FACSCalibur with CellQuest pro software
(Becton Dickinson, Franklin Lakes, NJ, U.S.A.). SIRT1 expression in lymphocytes was represented with the ratio of SIRT1 to β-actin mean fluorescence intensity.

Statistics
The relation between SIRT1 expression (SIRT1/β-actin ratio) and age, gender, degree of obesity was evaluated statistically. Pearson’s correlation coefficient was calculated between SIRT1
and age. Differences of SIRT1 expression among gender was statistically tested by one way analysis of variance with post-hoc Tukey honestly significant difference test. Spearman’s rank
correlation coefficient was calculated between SIRT1 and body condition score. Significant level less than 0.05 was considered statistically significant.

RESULTS
Nucleotide sequence of canine SIRT1 mRNA
In our preliminary experiment, we failed to amplify the cDNA fragment containing the entire coding region of the predicted canine SIRT1 mRNA (XM_546130.4). Thus, we
amplified a 5′-end- and a 3′-end cDNA fragment that covers the entire coding region. Though the 3′-end cDNA fragment was successfully amplified, the 5′-end DNA fragment was amplified only in
one of five blood samples examined. A schematic view of these DNA fragments is shown in Fig. 1. The amplified 5′-end fragment included the putative
initiation codon of the predicted canine SIRT1 mRNA, but nucleotides 108 to 434 of the predicted sequence were not present (named Variant 1, INSD accession No. LC342295).
This deleted region is within exon 1 and does not cause a codon frame shift downstream of the transcript. Because this transcript was amplified only in one sample, 5′ inverse RT-PCR was
conducted to detect other transcript variants. Two DNA fragments were amplified: one variant starts at nucleotide 456 (named Variant 2, INSD accession No. LC342296) of the predicted canine
SIRT1 mRNA (XM_546130.4), and the other starts at nucleotide 626 (named Variant 3, INSD accession No. LC342297; Fig. 1). The
putative translation start codon was predicted using the ATGpr program (http://atgpr.dbcls.jp/), indicating that
the translation start at nucleotide 663 and the frame was the same as that of the predicted canine SIRT1 mRNA (XM_546130.4).

Detection of canine SIRT1 protein by Western blotting
Monoclonal antibodies against canine SIRT1 protein have not been reported. Based on the canine SIRT1 nucleotide sequence, we selected the monoclonal antibody 1F3 (Cell
Signaling Technology), which was produced using the C-terminal region of human SIRT1 as the immunogen. The deduced canine SIRT amino acid sequence (Variant 1) is identical to human SIRT1 in
189 out of 190 amino acids in this region. The deduced molecular size of human SIRT1 is 81.6 kDa. A single band of approximately 128 kDa was detected in HEK293 cells, which are
human-derived, by western blotting (Fig. 2Fig. 2. Western blot analysis of canine SIRT1. Mouse anti-human SIRT1 monoclonal antibody (1F3) was used as the primary antibody. SIRT1 was detected at 128 kDa in human HEK293 cells (white
arrowhead), at 120 kDa in canine MDCK cells (black arrowhead), and at 117 kDa in peripheral blood mononuclear cells from two dogs (gray arrowheads).

). The deduced molecular size of canine SIRT1 was 70.9 kDa for Variant 1, and 62.1 kDa for Variants 2 and 3. In MDCK cells, which are dog-derived, and in canine PBMC, a single band of
approximately 120 kDa was detected in each cell line (Fig. 2).

Flow cytometry analysis of canine SIRT1 in PBMCs
To confirm the reactivity of 1F3 antibody with canine SIRT1 protein, the SIRT1 expression plasmids (Dog_Sirt1-long pcDNA3.1 and Dog_Sirt1-short pcDNA3.1) was transfected into 293T cells.
Canine SIRT1 expression was examined by flow cytometry after fixation and permeabilization. Though this antibody may react with endogenous human SIRT1, the fluorescence intensity increased
in cells transfected with the SIRT1 expression plasmids, compared with the mock-transfected cells (Fig. 3Fig. 3. Flow cytometry analysis of 293T cells transfected with the dog SIRT1 expression plasmids. Intracellular SIRT1 was detected by 1F3 anti-human SIRT1 antibody. A: Histogram of long SIRT1
variant (Variant1) encoding plasmid (Dog_Sirt1-long-pcDNA3.1) transfected cells (gray filled area) and mock-transfected cells (black line). B: Histogram of short SIRT1 variant
(Variant2) encoding plasmid (Dog_Sirt1-short-pcDNA3.1) transfected cells (gray filled area) and mock-transfected cells (black line).

) indicating that 1F3 reacted to canine SIRT1. Next, canine SIRT1 in PBMCs was examined by flow cytometry. PBMCs were fixed and permeabilized, and then incubated with 1F3 as the
primary antibody. SIRT1 expression in representative samples is shown in Fig. 4Fig. 4. Flow cytometry analysis of SIRT1 expression in canine PBMC. Permeabilized PBMCs were reacted with 1F3 anti-human SIRT1 antibody. A: Forward scatter and side scatter dot plot analysis
of a sample. The lymphocyte, monocyte and contaminated granulocyte regions are indicated by polygons. The histogram of the fluorescence intensity of the lymphocyte region (B), the
monocyte region (C) and the granulocyte region (D). The histograms of samples incubated with anti-SIRT1 antibody (filled area), anti-β-actin antibody (gray line), and isotype control
(dashed line) are shown in each panel.

. SIRT1 was detected in lymphocytes, monocytes and contaminated granulocytes. Though SIRT1 was detected in all the dogs tested, the fluorescence intensity varied among individuals
(Fig. 5Fig. 5. SIRT1 expression in peripheral blood lymphocytes from representative cases. PBMCs were collected and permeabilized for intracellular SIRT1 staining with 1F3 anti-human SIRT1 antibody.
A: Blood sample from a 4-year-old clinically healthy Border Collie. B: Blood sample from a 9-year-old Chihuahua receiving long-term glucocorticoid medication to relieve the clinical
signs of a brain tumor. The fluorescent intensity histograms with anti-SIRT1 antibody (filled area), anti-β-actin antibody (gray line), and isotype control (dashed line) are shown in
each panel.

). Relation of SIRT1 expression and age, gender, degree of obesity (body condition score) was examined. Correlation between SIRT1 expression and age or body condition score was not
statistically significant. SIRT1 expression was statistically different among genders (Fig. 6Fig. 6. Flow cytometry analysis of SIRT1 expression in peripheral blood lymphocytes from client-owned dogs (n=34). SIRT1 expression was represented as SIRT1/β-actin mean fluorescence ratio.
A: Comparison of SIRT1 expression in each gender group. Significant differences between each gender group are marked with an asterisk (P<0.05) or two asterisks
(P<0.01). B: Scatter diagram of SIRT1 expression and age with a regression line (r=0.21, P=0.24). C: Comparison of SIRT1 expression in each body
condition score group with a regression line (r=−0.13, P=0.49).

). SIRT1 expression in neutered female dogs was higher than that in intact- female and intact-male dogs (P<0.05).

DISCUSSION
In our knowledge, this is the first report that demonstrates SIRT1 transcription variants in dogs. In this study, three 5′ transcription variants were detected in PBMC from dogs. At least six
variants have been reported in both human and mouse (The AceView genes, NCBI). Most variants in human are shorter with a deletion at exon 1 or exon 2. Though we did not examine the function of
the three transcript variants in dogs, some studies have demonstrated that the SIRT1 transcript variants function differently from the full-length SIRT1,
especially at the interaction point with p53 [27, 45]. We detected three variants by an RT-PCR-based method and
only one band of approximately 120 kDa was observed by western blotting. The deduced molecular size of the canine SIRT1 protein was 70.9 kDa (Variant 1) and 62.1 kDa (Variants 2 and 3). The
deduced molecular size of human SIRT1 was 81.6 kDa. We detected a 128-kDa band using HEK293 cells, as shown in a previous study using muscle samples [7]
and in the 1F3 antibody product data sheet supplied by the manufacturer (CST). The differences in observed SIRT1 molecular sizes are likely due to posttranslational glycosylation. The bands
detected by western blotting in canine PBMCs presumably derived from Variants 2 and 3 mainly because only these variants were detected by inverse RT-PCR. However, the molecular size of SIRT1
derived from each transcript variants should be clarified by the expression of recombinant SIRT1 in canine cells.

To confirm the specificity of 1F3 antibody to canine SIRT1 protein, recombinant canine SIRT1 was expressed in 293T cells. Because this cell line is derived from human, 1F3 also reacted with
the endogenous human SIRT1. However, a marked enhancement of the signal was demonstrated in the canine SIRT1 expression plasmid-transfected cells. These results indicated that intracellular
canine SIRT1 is detectable by flow cytometry using 1F3 antibody. Recently, compounds that activate SIRT1 enzymatic activity have been intensely investigated in association with lifespan
extension. Recombinant canine SIRT1 protein expressed in transfected cells may be useful for screening compounds by measuring the enzymatic activity of canine SIRT1 in cultured cell lines.

Compounds that possibly enhance SIRT1 expression have also been investigated intensively [6, 7, 14, 39, 41]. Though it has not been fully demonstrated that enhancement of
SIRT1 expression is associated with lifespan extension, if it comes to that, measurement of SIRT1 expression level may be valuable for monitoring the patient’s condition and for evaluating the
effect of interventions. In this study, we examined intracellular SIRT1 level in peripheral blood lymphocytes for ease of access in clinical cases. Though some studies measured the serum SIRT1
concentration to evaluate the SIRT1 expression level [10, 24, 29, 32, 52], the significance of the plasma SIRT1 concentration remains to be clarified because SIRT1 localizes mainly in
the nucleus or the cytoplasm. SIRT1 in the cellular lysate and in the serum can potentially be measured by enzyme linked immunosorbent assay (ELISA) in dogs. However, as only one antibody is
available at present, it may be difficult to establish sensitive and specific Sandwich ELISA to measure canine SIRT1. The information on the canine SIRT1 5′-end transcript
variants obtained in this study will be useful for the development of antibodies and ELISA for canine SIRT1 measurement.

Minimally invasive procedures for sample collection make it easier to monitor the fluctuation of SIRT1 expression. Flow cytometry analysis can evaluate SIRT1 expression levels in individual
cells, thus enabling comparison of the expression between leukocyte subsets. In this study, flow cytometry analysis was conducted using a blood sample residues (usually less than 1
ml of blood) obtained from animals in veterinary care. SIRT1 seemed to be expressed in all leukocyte subsets: lymphocytes, monocytes, and contaminated granulocytes. In human
diabetes patients, SIRT1 was detected in monocytes and granulocytes, but not in lymphocytes, by immunocytochemical staining [52]. The discrepancy may be
because of species differences or the high sensitivity of flow cytometry applied in this study. Because the permeability of the cells may differ between the samples, we used β-actin as an
internal control for evaluating SIRT1 protein expression. The compensated SIRT1 expression level markedly varied among individual dogs. Though major factors that influence the SIRT1 expression
were not fully clarified in this study, the level in neutered female dogs was higher than intact-female and intact-male dogs. Variance of SIRT1 protein expression by age and gender has also
been reported in human [22, 25, 34]. But the trend of the variance in human
was study dependent probably reflecting the difference of sample tissue and method applied. While negative correlation between SIRT1 expression and obesity has also been demonstrated in human
[19, 31, 33, 48], significant
correlation between SIRT1 expression and body condition score of the dogs was not found in this study. Because the samples were obtained from dogs admitted for veterinary care, other factors
including disease, medication, as well as circadian change might influence the SIRT1 expression [1]. Comparison of SIRT1 expression among species or
individuals in specific condition may contribute to further understanding the regulation of SIRT1 expression. Transcription factors including HIC1, E2F1 and FOXO are involved in the regulation
in response to environmental change in humans [5, 40, 46]. Most of the
responsive elements to these factors are located within 1kb upstream from SIRT1 initiation codon. Though the promoter/enhancer region of the canine SIRT1 gene
has not been completely analyzed, nucleotide sequence of the region is well conserved between two species. Future studies using a large number of samples in specific condition may clarify
major contributing factors that influence SIRT1 expression in dogs.

In conclusion, herein we report the nucleotide sequence of canine SIRT1 cDNA and the SIRT1 transcript variants in PBMCs. Canine SIRT1 were detectable using a
monoclonal antibody developed for human SIRT1. SIRT1 expression in peripheral leukocytes can be examined by flow cytometry using this antibody. This method is applicable for further research
evaluating the effect of intervention on potentially fluctuating SIRT1 expression in dogs.

This work was supported in part by the Japanese Society of Veterinary Clinical Nutrition, Scholarship program.
==== Refs
REFERENCES
1 Asher G. Gatfield D. Stratmann M. Reinke H. Dibner C. Kreppel F. Mostoslavsky R. Alt F. W. Schibler U.  2008 . SIRT1 regulates circadian clock gene expression through PER2 deacetylation .
Cell 134 : 317 –328 . doi: 10.1016/j.cell.2008.06.050 18662546 
2 Barger J. L. Kayo T. Vann J. M. Arias E. B. Wang J. Hacker T. A. Wang Y. Raederstorff D. Morrow J. D. Leeuwenburgh C. Allison D. B. Saupe K. W. Cartee G. D. Weindruch R. Prolla T. A.  2008 . A low dose of dietary resveratrol partially mimics caloric restriction and retards aging parameters in mice .
PLoS One 3 : e2264 . doi: 10.1371/journal.pone.0002264 18523577 
3 Chang H. C. Guarente L.  2013 . SIRT1 mediates central circadian control in the SCN by a mechanism that decays with aging .
Cell 153 : 1448 –1460 . doi: 10.1016/j.cell.2013.05.027 23791176 
4 Chen D. Steele A. D. Lindquist S. Guarente L.  2005 . Increase in activity during calorie restriction requires Sirt1 .
Science 310 : 1641 . doi: 10.1126/science.1118357 16339438 
5 Chen W. Y. Wang D. H. Yen R. C. Luo J. Gu W. Baylin S. B.  2005 . Tumor suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent DNA-damage responses .
Cell 123 : 437 –448 . doi: 10.1016/j.cell.2005.08.011 16269335 
6 Chen Y. R. Fang S. R. Fu Y. C. Zhou X. H. Xu M. Y. Xu W. C.  2010 . Calorie restriction on insulin resistance and expression of SIRT1 and SIRT4 in rats . Biochem. Cell
Biol. 88 : 715 –722 . doi: 10.1139/O10-010 20651844 
7 Cohen H. Y. Miller C. Bitterman K. J. Wall N. R. Hekking B. Kessler B. Howitz K. T. Gorospe M. de Cabo R. Sinclair D. A.  2004 . Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase .
Science 305 : 390 –392 . doi: 10.1126/science.1099196 15205477 
8 Colman R. J. Anderson R. M. Johnson S. C. Kastman E. K. Kosmatka K. J. Beasley T. M. Allison D. B. Cruzen C. Simmons H. A. Kemnitz J. W. Weindruch R.  2009 . Caloric restriction delays disease onset and mortality in rhesus monkeys .
Science 325 : 201 –204 . doi: 10.1126/science.1173635 19590001 
9 DuBridge R. B. Tang P. Hsia H. C. Leong P. M. Miller J. H. Calos M. P.  1987 . Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system . Mol. Cell.
Biol. 7 : 379 –387 . doi: 10.1128/MCB.7.1.379 3031469 
10 Engin-Ustun Y. Caglayan E. K. Kara M. Gocmen A. Y. Polat M. F. Aktulay A.  2016 . The effect of Ramadan fasting on sirtuin and visfatin levels . Interv. Med. Appl.
Sci. 8 : 14 –19 . 28250976 
11 Grabowska W. Sikora E. Bielak-Zmijewska A.  2017 . Sirtuins, a promising target in slowing down the ageing process .
Biogerontology 18 : 447 –476 . doi: 10.1007/s10522-017-9685-9 28258519 
12 Graham F. L. Smiley J. Russell W. C. Nairn R.  1977 . Characteristics of a human cell line transformed by DNA from human adenovirus type 5 . J. Gen.
Virol. 36 : 59 –74 . doi: 10.1099/0022-1317-36-1-59 886304 
13 Haigis M. C. Sinclair D. A.  2010 . Mammalian sirtuins: biological insights and disease relevance . Annu. Rev.
Pathol. 5 : 253 –295 . doi: 10.1146/annurev.pathol.4.110807.092250 20078221 
14 Hubbard B. P. Sinclair D. A.  2014 . Small molecule SIRT1 activators for the treatment of aging and age-related diseases . Trends Pharmacol.
Sci. 35 : 146 –154 . doi: 10.1016/j.tips.2013.12.004 24439680 
15 Imai S. Armstrong C. M. Kaeberlein M. Guarente L.  2000 . Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase .
Nature 403 : 795 –800 . doi: 10.1038/35001622 10693811 
16 Imai S. Guarente L.  2010 . Ten years of NAD-dependent SIR2 family deacetylases: implications for metabolic diseases . Trends Pharmacol.
Sci. 31 : 212 –220 . doi: 10.1016/j.tips.2010.02.003 20226541 
17 Ishikawa S. Li G. Takemitsu H. Fujiwara M. Mori N. Yamamoto I. Arai T.  2013 . Change in mRNA expression of sirtuin 1 and sirtuin 3 in cats fed on high fat diet . BMC Vet.
Res. 9 : 187 . doi: 10.1186/1746-6148-9-187 24073959 
18 Ishikawa S. Takemitsu H. Habara M. Mori N. Yamamoto I. Arai T.  2016 . Sirtuin 1 suppresses nuclear factor κB induced transactivation and pro-inflammatory cytokine expression in cat fibroblast
cells . J. Vet. Med. Sci. 77 : 1681 –1684 . doi: 10.1292/jvms.15-0245 26165138 
19 Jukarainen S. Heinonen S. Rämö J. T. Rinnankoski-Tuikka R. Rappou E. Tummers M. Muniandy M. Hakkarainen A. Lundbom J. Lundbom N. Kaprio J. Rissanen A. Pirinen E. Pietiläinen K. H.  2016 . Obesity is associated with low NAD(+)/SIRT pathway expression in adipose tissue of BMI-discordant monozygotic twins .
J. Clin. Endocrinol. Metab. 101 : 275 –283 . doi: 10.1210/jc.2015-3095 26574954 
20 Kaeberlein M. McVey M. Guarente L.  1999 . The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms .
Genes Dev. 13 : 2570 –2580 . doi: 10.1101/gad.13.19.2570 10521401 
21 Kanfi Y. Peshti V. Gozlan Y. M. Rathaus M. Gil R. Cohen H. Y.  2008 . Regulation of SIRT1 protein levels by nutrient availability . FEBS
Lett. 582 : 2417 –2423 . doi: 10.1016/j.febslet.2008.06.005 18544345 
22 Kilic U. Gok O. Erenberk U. Dundaroz M. R. Torun E. Kucukardali Y. Elibol-Can B. Uysal O. Dundar T.  2015 . A remarkable age-related increase in SIRT1 protein expression against oxidative stress in elderly: SIRT1 gene variants and longevity in
human . PLoS One 10 : e0117954 . doi: 10.1371/journal.pone.0117954 25785999 
23 Kendrick A. A. Choudhury M. Rahman S. M. McCurdy C. E. Friederich M. Van Hove J. L. Watson P. A. Birdsey N. Bao J. Gius D. Sack M. N. Jing E. Kahn C. R. Friedman J. E. Jonscher K. R.  2011 . Fatty liver is associated with reduced SIRT3 activity and mitochondrial protein hyperacetylation . Biochem.
J. 433 : 505 –514 . doi: 10.1042/BJ20100791 21044047 
24 Lee H. Chu S. H. Park J. Y. Park H. K. Im J. A. Lee J. W.  2013 . Visceral adiposity is associated with SIRT1 expression in peripheral blood mononuclear cells: a pilot study .
Endocr. J. 60 : 1269 –1273 . doi: 10.1507/endocrj.EJ13-0207 23933590 
25 Lee H. J. Yang S. J.  2017 . Aging-Related Correlation between Serum Sirtuin 1 Activities and Basal Metabolic Rate in Women, but not in Men .
Clin. Nutr. Res. 6 : 18 –26 . doi: 10.7762/cnr.2017.6.1.18 28168178 
26 Lin S. J. Defossez P. A. Guarente L.  2000 . Requirement of NAD and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae .
Science 289 : 2126 –2128 . doi: 10.1126/science.289.5487.2126 11000115 
27 Lynch C. J. Shah Z. H. Allison S. J. Ahmed S. U. Ford J. Warnock L. J. Li H. Serrano M. Milner J.  2010 . SIRT1 undergoes alternative splicing in a novel auto-regulatory loop with p53 . PLoS
One 5 : e13502 . doi: 10.1371/journal.pone.0013502 20975832 
28 Madin S. H. Darby N. B. Jr. 1958 . Established kidney cell lines of normal adult bovine and ovine origin . Proc. Soc. Exp. Biol.
Med. 98 : 574 –576 . doi: 10.3181/00379727-98-24111 13567776 
29 Mansur A. P. Roggerio A. Goes M. F. S. Avakian S. D. Leal D. P. Maranhão R. C. Strunz C. M. C.  2017 . Serum concentrations and gene expression of sirtuin 1 in healthy and slightly overweight subjects after caloric restriction or resveratrol
supplementation: A randomized trial . Int. J. Cardiol. 227 : 788 –794 . doi: 10.1016/j.ijcard.2016.10.058 28029409 
30 Marfè G. Tafani M. Fiorito F. Pagnini U. Iovane G. De Martino L.  2011 . Involvement of FOXO transcription factors, TRAIL-FasL/Fas, and sirtuin proteins family in canine coronavirus type II-induced
apoptosis . PLoS One 6 : e27313 . doi: 10.1371/journal.pone.0027313 22087287 
31 Marfè G. De Martino L. Tafani M. Irno-Consalvo M. Pasolini M. P. Navas L. Papparella S. Gambacurta A. Paciello O.  2012 . A multicancer-like syndrome in a dog characterized by p53 and cell cycle-checkpoint kinase 2 (CHK2) mutations and sirtuin gene (SIRT1)
down-regulation . Res. Vet. Sci. 93 : 240 –245 . doi: 10.1016/j.rvsc.2011.07.030 21890154 
32 Mariani S. Fiore D. Basciani S. Persichetti A. Contini S. Lubrano C. Salvatori L. Lenzi A. Gnessi L.  2015 . Plasma levels of SIRT1 associate with non-alcoholic fatty liver disease in obese patients .
Endocrine 49 : 711 –716 . doi: 10.1007/s12020-014-0465-x 25358448 
33 Mariani S. Fiore D. Persichetti A. Basciani S. Lubrano C. Poggiogalle E. Genco A. Donini L. M. Gnessi L.  2016 . Circulating SIRT1 increases after intragastric balloon fat loss in obese patients . Obes.
Surg. 26 : 1215 –1220 . doi: 10.1007/s11695-015-1859-4 26337692 
34 Massudi H. Grant R. Braidy N. Guest J. Farnsworth B. Guillemin G. J.  2012 . Age-associated changes in oxidative stress and NAD+ metabolism in human tissue . PLoS
One 7 : e42357 . doi: 10.1371/journal.pone.0042357 22848760 
35 Mattagajasingh I. Kim C. S. Naqvi A. Yamamori T. Hoffman T. A. Jung S. B. DeRicco J. Kasuno K. Irani K.  2007 . SIRT1 promotes endothelium-dependent vascular relaxation by activating endothelial nitric oxide synthase .
Proc. Natl. Acad. Sci. U.S.A. 104 : 14855 –14860 . doi: 10.1073/pnas.0704329104 17785417 
36 Mendham A. E. Duffield R. Coutts A. J. Marino F. Boyko A. Bishop D. J.  2015 . Rugby-specific small-sided games training is an effective alternative to stationary cycling at reducing clinical risk factors associated with
the development of type 2 diabetes: a randomized, controlled trial . PLoS One 10 : e0127548 . doi: 10.1371/journal.pone.0127548 26030423 
37 Morris B. J.  2013 . Seven sirtuins for seven deadly diseases of aging . Free Radic. Biol.
Med. 56 : 133 –171 . doi: 10.1016/j.freeradbiomed.2012.10.525 23104101 
38 Moschen A. R. Wieser V. Gerner R. R. Bichler A. Enrich B. Moser P. Ebenbichler C. F. Kaser S. Tilg H.  2013 . Adipose tissue and liver expression of SIRT1, 3, and 6 increase after extensive weight loss in morbid obesity .
J. Hepatol. 59 : 1315 –1322 . doi: 10.1016/j.jhep.2013.07.027 23928404 
39 Nisoli E. Tonello C. Cardile A. Cozzi V. Bracale R. Tedesco L. Falcone S. Valerio A. Cantoni O. Clementi E. Moncada S. Carruba M. O.  2005 . Calorie restriction promotes mitochondrial biogenesis by inducing the expression of eNOS .
Science 310 : 314 –317 . doi: 10.1126/science.1117728 16224023 
40 Pediconi N. Guerrieri F. Vossio S. Bruno T. Belloni L. Schinzari V. Scisciani C. Fanciulli M. Levrero M.  2009 . hSirT1-dependent regulation of the PCAF-E2F1-p73 apoptotic pathway in response to DNA damage . Mol. Cell.
Biol. 29 : 1989 –1998 . doi: 10.1128/MCB.00552-08 19188449 
41 Rasbach K. A. Schnellmann R. G.  2008 . Isoflavones promote mitochondrial biogenesis . J. Pharmacol. Exp. Ther. 325 :
536 –543 . doi: 10.1124/jpet.107.134882 18267976 
42 Rehan L. Laszki-Szcząchor K. Sobieszczańska M. Polak-Jonkisz D.  2014 . SIRT1 and NAD as regulators of ageing . Life Sci. 105 :
1 –6 . doi: 10.1016/j.lfs.2014.03.015 24657895 
43 Rogina B. Helfand S. L.  2004 . Sir2 mediates longevity in the fly through a pathway related to calorie restriction . Proc. Natl. Acad. Sci.
U.S.A. 101 : 15998 –16003 . doi: 10.1073/pnas.0404184101 15520384 
44 Satoh A. Brace C. S. Rensing N. Cliften P. Wozniak D. F. Herzog E. D. Yamada K. A. Imai S.  2013 . Sirt1 extends life span and delays aging in mice through the regulation of Nk2 homeobox 1 in the DMH and LH .
Cell Metab. 18 : 416 –430 . doi: 10.1016/j.cmet.2013.07.013 24011076 
45 Shah Z. H. Ahmed S. U. Ford J. R. Allison S. J. Knight J. R. Milner J.  2012 . A deacetylase-deficient SIRT1 variant opposes full-length SIRT1 in regulating tumor suppressor p53 and governs expression of cancer-related
genes . Mol. Cell. Biol. 32 : 704 –716 . doi: 10.1128/MCB.06448-11 22124156 
46 Xiong S. Salazar G. Patrushev N. Alexander R. W.  2011 . FoxO1 mediates an autofeedback loop regulating SIRT1 expression . J. Biol.
Chem. 286 : 5289 –5299 . doi: 10.1074/jbc.M110.163667 21149440 
47 Song R. Xu W. Chen Y. Li Z. Zeng Y. Fu Y.  2011 . The expression of Sirtuins 1 and 4 in peripheral blood leukocytes from patients with type 2 diabetes . Eur. J.
Histochem. 55 : e10 . doi: 10.4081/ejh.2011.e10 21556116 
48 Stefanowicz M. Nikołajuk A. Matulewicz N. Karczewska-Kupczewska M.  2018 . Adipose tissue, but not skeletal muscle, sirtuin 1 expression is decreased in obesity and related to insulin sensitivity .
Endocrine 60 : 263 –271 . doi: 10.1007/s12020-018-1544-1 29417372 
49 Tao R. Wei D. Gao H. Liu Y. DePinho R. A. Dong X. C.  2011 . Hepatic FoxOs regulate lipid metabolism via modulation of expression of the nicotinamide phosphoribosyltransferase gene .
J. Biol. Chem. 286 : 14681 –14690 . doi: 10.1074/jbc.M110.201061 21388966 
50 Tissenbaum H. A. Guarente L.  2001 . Increased dosage of a sir-2 gene extends lifespan in Caenorhabditis elegans .
Nature 410 : 227 –230 . doi: 10.1038/35065638 11242085 
51 Vaziri H. Dessain S. K. Ng Eaton E. Imai S. I. Frye R. A. Pandita T. K. Guarente L. Weinberg R. A.  2001 . hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase . Cell 107 :
149 –159 . doi: 10.1016/S0092-8674(01)00527-X 11672523 
52 Wang Y. Li D. Ma G. Li W. Wu J. Lai T. Huang D. Zhao X. Lv Q. Chen M. Wu B.  2015 . Increases in peripheral SIRT1: a new biological characteristic of asthma .
Respirology 20 : 1066 –1072 . doi: 10.1111/resp.12558 26040995 
53 Wierman M. B. Smith J. S.  2014 . Yeast sirtuins and the regulation of aging . FEMS Yeast Res. 14 :
73 –88 . doi: 10.1111/1567-1364.12115 24164855