==== Front Med Sci MonitMed. Sci. MonitMedical Science MonitorMedical Science Monitor : International Medical Journal of Experimental and Clinical Research1234-10101643-3750International Scientific Literature, Inc. 3001302210.12659/MSM.908133908133Animal StudyDexmedetomidine Protects Against Traumatic Brain Injury-Induced Acute Lung Injury in Mice Wang Yuanyuan 12BCE*Wang Changli 1BCE*Zhang Dan 12CDWang Huihui 2DFBo Lulong 1AEGDeng Xiaoming 12AG 1 Faculty of Anesthesiology, Changhai Hospital, Naval Medical University, Shanghai, P.R. China 2 Jiangsu Province Key Laboratory of Anesthesiology, Xuzhou Medical University, Xuzhou, Jiangsu, P.R. ChinaCorresponding Authors: Xiaoming Deng, e-mail: deng_x@yahoo.com and Lulong Bo, e-mail: nbastars@126.comA Study Design B Data Collection C Statistical Analysis D Data Interpretation E Manuscript Preparation F Literature Search G Funds Collection * Yuanyuan Wang and Changli Wang contributed equally in this work 2018 17 7 2018 24 4961 4967 20 11 2017 18 3 2018 © Med Sci Monit, 20182018This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)Background Traumatic brain injury (TBI) leads to acute lung injury (ALI), in which the inflammatory response plays an important role in its pathophysiology. Recent studies suggest that dexmedetomidine (Dex) plays a protective role in acute inflammatory diseases. However, whether Dex has a protective effect on TBI-induced ALI is not clear. The aim of this study was to investigate the effect of Dex on TBI-induced ALI in mice. Material/Methods Mice were randomly divided into 5 groups: 1) sham group; 2) TBI group; 3) TBI+Dex group; 4) TBI+atipamezole (Atip) group; and 5) TBI+Dex+Atip group. Dex (50 μg/kg) was intraperitoneal injected immediately after TBI. The α2 adrenergic antagonist Atip (250 μg/kg) was intraperitoneal injected 15 minutes prior to Dex treatment. Then 24 hours later, the protein concentration in the bronchoalveolar lavage fluid (BALF), lung wet to dry weight ratio, hematoxylin and eosin (H&E) staining of lungs, the level of high-mobility group box protein 1(HMGB1) in serum, and the receptor for advanced glycation end products (RAGE) expression in lung were detected. Results Dex ameliorated the score of lung histological examination, as well as the severity of pulmonary edema and permeability. Moreover, Dex was observed to significantly suppress the expression of HMGBI and RAGE. However, the protective effects of Dex were partially reversed by the administration of Atip. Conclusions Dex may protect against TBI-induced ALI via the HMGB1-RAGE signal pathway, and this protective effect is partly dependent on its α2 adrenoceptor agonist action. MeSH Keywords Acute Lung InjuryBrain InjuriesDexmedetomidine ==== Body Background Traumatic brain injury (TBI) is caused by mechanical forces applied to the brain, including subdural hematoma, subarachnoid hemorrhage, and brain contusion [1]. Every year, the increased incidence of craniocerebral injury leads to high mortality of unfavorable outcomes and shares the largest source of donor lungs [2]. Besides, patients with TBI always suffer peripheral organs dysfunction such as lung, liver, kidney, or intestine. Evidence has shown that these complications are associated with an increased incidence of mortality [3,4]. Acute lung injury (ALI) [5], as well as other pulmonary complications including ventilator-associated pneumonia (VAP), acute respiratory distress syndrome (ARDS), and neurogenic pulmonary edema (NPE) are the most prevalent non-neurologic organ dysfunctions in the TBI population [6,7]. However, the pathophysiological mechanism remains unclear. Dexmedetomidine (Dex), a kind of α2 adrenergic receptor agonist, was often used in craniotomy and associated with fewer respiratory adverse events in previous research [8]. Dex is considered to confer protective effects on ALI induced by intestinal ischemia reperfusion, sepsis, orthotopic autologous liver transplantation, or other diseases [9,10]. However, as there are limited reports investigating the effect of Dex on TBI-induced ALI, we would like to determine whether Dex could improve TBI-induced ALI in mice and explore its potential mechanisms. Previous studies demonstrated that many inflammatory cytokines were involved in the inflammatory responses after TBI, including IL-1β, IL-6, TNF-α, and damage related molecular patterns (DAMPs) [11–13]. Though the specific mechanism remains unknown, the release of DAMPs by the nervous system was involved in immune responses [13]. High-mobility group box protein 1 (HMGB1) is a type of DAMPs whose receptors are receptor for advanced glycation end products (RAGE) and Toll-like receptor 4 (TLR4). During endotoxin shock and severe sepsis, RAGE signal could activate downstream signaling pathways such as promoting the activation of MAPK and NF-κB, mediating pro-inflammatory responses [14,15]. In addition, RAGE is a direct index of lung inflammation in experimental lung inflammation models [16]. It has reported that Dex could alleviate CLP-stimulated ALI via downregulating the expression of HMGB1-RAGE and reducing NF-κB and MAPK phosphorylation [17]. Therefore, in our research, we hypothesized that whether Dex attenuates the TBI-induced lung injury in mice and whether Dex interacts with the HMGB1-RAGE signaling pathway. Material and Methods Animals Healthy 6–8-week-old C57BL/6 male mice, weighing 18–22 g, were used in our study. All mice were purchased from the Experimental Animals Center of Naval Medical University (Shanghai, China). They were housed in cages under standard conditions at a temperature of 18–22°C with a relative humidity of 50–60%, a 12 h light-dark cycle, and allowed free access to water and food. All the animals used were approved by the Animal Care and Use Committee of Naval Medical University. Experiment procedure C57BL/6 mice were randomly assigned to the following groups (n=8, each): 1) sham group; 2) TBI group; 3) TBI+Dex group; 4) TBI+atipamezole (Atip) group; and 5) TBI+Dex+Atip group. To establish the severe traumatic brain injury, a validated controlled cortical impact was performed by Feeney’s weight-drop model [18]. After being anesthetized with sevoflurane, mice were placed in a stereotaxic frame and underwent a craniotomy with a diameter of 3 mm over the left parietal cortex with the center between the bregma and lambdoid suture. After TBI, the bone flap was repositioned and the skin was closed with continuous sutures. Each mouse was intraperitoneally injected the same volume (200 μL) of vehicles phosphate-buffered saline (PBS) or Dex (50 μg/kg) immediately [19]. In the TBI+Atip group and the TBI+Dex+Atip group, Atip (250 μg/kg) was intraperitoneally injected 15 minutes before TBI. This model is generally associated with 40% mortality within the first 5 minutes after injury and neurological deficit scores of III within 24 hours after injury [20]. Histology and lung injury scoring At 24 hours after TBI challenge, mice were anesthetized with sevoflurane and underwent cardiac perfusion with 50 mL 4% paraformaldehyde to remove the blood in lungs and to fix lung tissues. Then, the left lung was fixed in 4% paraformaldehyde for 48 hours and embedded in paraffin. Sections were cut at a thickness of 4–5 μm for hematoxylin and eosin (H&E) staining. Lung sections were scanned and evaluated blindly by 2 experienced pathologists under light microscopy. Alveolar congestion, hemorrhage, aggregation of inflammatory cells, and the thickness of the alveolar walls were assessed, according to the criteria described previously [21]. Detection of proteins in the bronchoalveolar lavage fluid (BALF) To obtain the bronchoalveolar lavage fluid (BALF), lungs were lavaged twice with 1 mL of ice-cold PBS and the recovery ratio of the total fluid maintained at about 90%. Both aliquots were pooled and centrifuged at 12 000 rpm for 10 minutes at 4°C. The cell-free supernatant was used for albumin measurement using the BCA Protein Assay kit (Thermo Scientific, IL, USA). Lung wet-to-dry (W/D) weight ratio measurement At 24 hours after the TBI challenge, mice were sacrificed, and lung tissues were excised and weighed. Then the lung tissues were placed in an oven at 80°C wrapped with a tinfoil for 72 hours to achieve dry weight [22]. And the wet-to-dry (W/D) weight ratio was calculated to assess edema. Enzyme-linked immunosorbent assay (ELISA) analysis for HMGB1 in serum Mice were anesthetized by isoflurane 24 hours after the TBI challenge and blood was collected by heart puncture. Serum was separated by centrifugation at 12 000 rpm for 10 minutes at 4°C. The concentration of HMGB1 in serum was detected by enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, MN, USA) according to the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) Total RNA was extracted from lung tissues using TRIzol reagent (Takara Biotechnology, Dalian, China). The concentration and purity of the total RNA were determined at 260/280 nm. Complementary DNA (cDNA) was reverse-transcribed using a Prime Script RT Reagent Kit (Takara Biotechnology, Dalian, China). The quantification of relative messenger RNA (mRNA) concentrations were conducted using a StepOnePlus™ Real Time PCR System (Applied Biosystems, CA, USA). Specific primers were as follows: RAGE: forward, ACCACTCCCAACAGACCTG; reverse, GGTACTCCAGAAGACCAGAGG; GAPDH: forward, ACCACAGTCCATGCCATCAC; reverse, TCCACCACCCTGTTGCTGTA. Normalized by the amount of GAPDH, the levels of RAGE mRNA were expressed as fold-changes. Western blot analysis At 24 hours after the TBI challenge, the lung samples were homogenized in protein extract solution and protease inhibitors (Beyotime Biotechnology, Shanghai, China) and centrifuged at 12 000 rpm for 10 minutes at 4°C. The total protein concentration was evaluated by the BCA protein assay kit (Thermo Scientific, IL, USA). Equal amounts of total protein were loaded per well on a 12% sodium dodecyl sulfate-polyacrylamide gel and transferred into a polyvinylidene difluoride membrane. The membranes were blocked with 5% BSA for 2 hours at room temperature. Then the membranes were incubated with appropriate dilution of specific primary antibodies (anti-RAGE 1: 1000 and anti-GAPDH 1: 1000) for 12 hours at 4°C. Then the membranes were incubated with the horseradish peroxidase-linked secondary antibody (1: 1000; Beyotime Biotechnology, Shanghai, China). Protein bands were demonstrated by enhanced chemiluminescence Western blot kit (Thermo Scientific, IL, USA). Signals were densitometrically assessed and normalized to GAPDH signals. Statistical analysis All data were normally distributed and analyzed statistically with GraphPad Prism 5 (GraphPad Software Inc., CA, USA). Results are expressed as means ± standard error of the mean (SEM). Differences between groups were analyzed by unpaired t-tests and analysis of variance and Tukey post hoc test. P<0.05 was considered statistically significant. Results Dexmedetomidine (Dex) ameliorated the severity of TBI-induced ALI At 24 hours after the TBI challenge, mice in the TBI group showed apparent pathological changes in lungs as evidenced by thickened alveolar wall, disordered lung tissues, and obvious inflammatory cells infiltration. And the histopathologic changes were significantly ameliorated with the treatment of Dex (Figure 1A). Compared with TBI+Dex group, the TBI group had higher ALI pathological scores (Figure 1B). The protein concentration in the BALF was decreased after Dex administration (Figure 1C). Compared with the TBI group, Dex also alleviated the severity of pulmonary edema as evidenced by the lower W/D ratio (Figure 1D). Collectively, our results showed that Dex was able to ameliorate the severity of TBI-induced ALI in mice. It is well known that Dex is a highly selective α2 adrenergic receptor agonist. Therefore, we used Atip, an α2 adrenergic receptor antagonist, to determine whether the protective effect of Dex on TBI-induced ALI in mice was related to its α2 adrenergic receptor activating effect. Results showed that, compared with the TBI+Dex group, the pathological changes (Figure 1A, 1B), total protein concentrations in the BALF (Figure 1C), and lung W/D ratio (Figure 1D) were significantly increased after the administration of Atip. In addition, there was no difference between the TBI group and the TBI+Atip group. These results suggested that Atip partly reversed the protective effect of Dex on TBI-induced ALI in mice. Dexmedetomidine (Dex) negatively regulated HMGB1-RAGE pathway Since HMGB1-RAGE pathway plays a vital role in TBI-induced lung injury in mice [16], we then examined whether Dex ameliorated TBI-induced lung injury in mice through regulating the HMGB1-RAGE pathway. Compared with the sham group, the level of HMGB1 in serum of mice in the TBI group was significantly elevated, which was largely decreased by the administration of Dex (Figure 2A). Results from real-time PCR and western blot analysis suggested that the expression of RAGE was increased significantly in the TBI group. However, all these changes were reversed by the administration of Dex (Figure 2B–2D). Compared with the TBI+Dex group, the serum HMGB1 level (Figure 2A) and the expression of RAGE in lung tissues (Figure 2B–2D) were increased in the Atip administrated group. Collectively, these results indicated that Dex negatively regulated the HMGB1-RAGE pathway in the TBI-induced ALI in mice and that Atip partly reversed the effect of Dex through the HMGB1-RAGE pathway. Discussion Depending on the severity of the trauma, TBI patients may suffer from complications of non-neurologic organ dysfunction (NNOD). Pulmonary complications are among the most prevalent NNOD encountered in the TBI population [23]. In this study, Feeney’s weight-drop model was used to imitate the pathogenesis of acute lung injury after TBI. The total protein concentration in the BALF and lung W/D ratio are sensitive indicators of ALI, and lung pathological change is one of the main classical characteristics of ALI [24]. In this study, mice were sacrificed at 24 hours after TBI and the total protein concentration in the BALF, the lung W/D ratio, and the pathological changes were measured to assess the severity of ALI induced by TBI. Previous studies have suggested that Dex has an organ protective effect in addition to its sedation and anxiolytic activity [25,26]. In this study, our results showed that Dex decreased lung W/D ratio and the total protein concentration in the BALF, and ameliorated lung pathological changes in TBI mice, which indicated that Dex could alleviate TBI-induced ALI in mice. Although the pathophysiology of TBI-induced ALI is unclear, it may relate specifically to the release of the DAMPs in nervous system. DAMPs are a family of molecules that are released in response to sterile inflammation, such as TBI [27]. A previous study illustrated that TBI causes injury of the cerebral vasculature resulting in the disruption of the blood-brain barrier. The secreted inflammatory mediators, such as DAMPs released by injured cells, trigger further brain inflammation and affect distal organs including the lungs [2]. HMGB1, a type of DAMPs, belongs to a family of non-histone chromosomal proteins. When it is not acetylated, HMGB1 remains localized in the nucleus, and is not secreted or released regardless of injury or insult [28]. However, hyper-acetylation of the molecule results in cytosolic relocation, allowing for further secretion into the cellular milieu under proper signaling stimulation [29]. HMGB1 leads to the activation of the nuclear factor (NF)-κB pathway with the generation of inflammatory cytokines through binding to the RAGE receptor [23]. HMGB1-RAGE signal pathway plays a pivotal role in the development of TBI-induced ALI [16]. In this study, compared with the administration of Dex, serum HMGB1 level and the expression of RAGE in lung tissues were significantly increased after TBI. Previous studies showed that the neutralization of HMGB1 or genetic knockout of the RAGE receptor has been shown to attenuate post-TBI lung injury and hypoxia [16,30]. Since our results proved that Dex negatively regulated HMGB1-RAGE pathway, it can be inferred that the mechanism of Dex in TBI-induced ALI may be partly through the regulation of HMGB1-RAGE pathway. It is well known that Dex is a highly selective α2 adrenergic receptor agonist. Therefore, we used Atip, an α2 adrenergic receptor antagonist, to determine whether the protective effect of Dex on TBI-induced ALI in mice was related to its α2 adrenergic receptor activating effect [31]. Results showed that Atip partly reversed serum HMGB1 levels and the expression of RAGE in lung tissues. Accordingly, TBI-induced ALI was also partly reversed by Atip. These results suggested that Atip partly reversed the protective effect of Dex. Based on these findings, we concluded that Dex may protect against TBI-induced ALI in mice via the HMGB1-RAGE signal pathway, and this protective effect is partly dependent on its α2 adrenoceptor agonist action. Our study had several limitations. First, although we found the protective effects of Dex on TBI-induced acute lung injury, we did not further study how Dex interacted with the HMBG1-RAGE pathway. Second, we adopted only 1 time point (24 hours after TBI) and 1 dosage of Dex (50 μg/kg). We did not further discuss whether changing the dose of Dex or the time points will lead to different results. At last, our study only put focus on the activation of the HMBG1-RAGE pathway. However, whether other pathways, such as NF-κB and MAPK signals, was involved needs to be clarified in future studies. Conclusions Our study suggested that Dex administration could decrease TBI-induced ALI in mice models. The protective effects may act through the regulation of the HMGB1-RAGE pathway, which is partly dependent on the α2 adrenoceptor agonist action of Dex. Further studies are warranted to investigate the detailed molecular pathways of Dex in protecting against TBI-induced ALI. Conflict of interests None. Source of support: This work was supported by the National Natural Science Foundation of China (No. 81471845; 81671887) and Shanghai Outstanding Youth Medical Professionals Training Program (2017YQ015). Figure 1 Dexmedetomidine (Dex) ameliorated TBI-induced ALI in mice. After 24 hours of TBI, lung tissue and the BALF in each group were collected. (A) The example of micrographic images (200×) from the sham group, the TBI group, the TBI+Dex group, the TBI+Atip group, and the TBI+Dex+Atip group. (B) Histopathological lung injury scores in each group. (C) Total protein concentration in the BALF of mice in each group. (D) The lung wet-to-dry ratio. The values are presented as the means ±SEM. * P<0.05, ** P<0.01 versus the sham group, # P<0.05, ## P<0.01 versus the TBI group, @ P<0.05, @@ P<0.01 versus the TBI+Dex group. Figure 2 Dexmedetomidine (Dex) negatively regulated HMGB1-RAGE pathway. At 24 hours of TBI, lung tissues and blood in each group were collected. (A) HMGB1 level in serum of mice in each group. (B) The mRNA expression of RAGE in lung tissues. (C) Western blot analysis for RAGE in lung tissues. (D) Density quantification of RAGE. The values are presented as the means ±SEM. ** P<0.01 versus the sham group, ## P<0.01 versus the TBI group, @@ P<0.01 versus the TBI+Dex group. ==== Refs References 1 Saatman KE Duhaime AC Bullock R Classification of traumatic brain injury for targeted therapies J Neurotrauma 2008 25 719 38 18627252 2 Nicolls MR Laubach VE Traumatic brain injury: Lungs in a RAGE Sci Transl Med 2014 6 252fs34 3 Dai SS Wang H Yang N Plasma glutamate-modulated interaction of A2AR and mGluR5 on BMDCs aggravates traumatic brain injury-induced acute lung injury J Exp Med 2013 210 839 51 23478188 4 Holland MC Mackersie RC Morabito D The development of acute lung injury is associated with worse neurologic outcome in patients with severe traumatic brain injury J Trauma 2003 55 106 11 12855888 5 Baumann A Audibert G McDonnell J Mertes PM Neurogenic pulmonary edema Acta Anaesthesiol Scand 2007 51 447 55 17378783 6 Rincon F Ghosh S Dey S Impact of acute lung injury and acute respiratory distress syndrome after traumatic brain injury in the United States Neurosurgery 2012 71 795 803 22855028 7 Mrozek S Constantin JM Geeraerts T Brain-lung crosstalk: Implications for neurocritical care patients World J Crit Care Med 2015 4 163 78 26261769 8 Goettel N Bharadwaj S Venkatraghavan L Dexmedetomidine vs . propofol-remifentanil conscious sedation for awake craniotomy: A prospective randomized controlled trial Br J Anaesth 2016 116 811 21 27099154 9 Xie C Li Y Liang J The effect of dexmedetomidine on autophagy and apoptosis in intestinal ischemia reperfusion-induced lung injury Zhonghua Jie He He Hu Xi Za Zhi 2015 38 761 64 [in Chinese] 26703944 10 Chi X Wei X Gao W Dexmedetomidine ameliorates acute lung injury following orthotopic autologous liver transplantation in rats probably by inhibiting Toll-like receptor 4-nuclear factor kappa B signaling J Transl Med 2015 13 190 26070954 11 Goodman JC Van M Gopinath SP Robertson CS Pro-inflammatory and pro-apoptotic elements of the neuroinflammatory response are activated in traumatic brain injury Acta Neurochir Suppl 2008 102 437 39 19388362 12 Helmy A Carpenter KL Menon DK The cytokine response to human traumatic brain injury: temporal profiles and evidence for cerebral parenchymal production J Cereb Blood Flow Metab 2011 31 658 70 20717122 13 Oppenheim JJ Yang D Alarmins: Chemotactic activators of immune responses Curr Opin Immunol 2005 17 359 65 15955682 14 Christaki E Opal SM Keith JC A monoclonal antibody against RAGE alters gene expression and is protective in experimental models of sepsis and pneumococcal pneumonia Shock 2011 35 492 98 21263385 15 Qin YH Dai SM Tang GS HMGB1 enhances the proinflammatory activity of lipopolysaccharide by promoting the phosphorylation of MAPK p38 through receptor for advanced glycation end products J Immunol 2009 183 6244 50 19890065 16 Weber DJ Gracon AS Ripsch MS The HMGB1-RAGE axis mediates traumatic brain injury-induced pulmonary dysfunction in lung transplantation Sci Transl Med 2014 6 252ra124 17 Hu H Shi D Hu C Dexmedetomidine mitigates CLP-stimulated acute lung injury via restraining the RAGE pathway Am J Transl Res 2017 9 5245 58 29312480 18 Li W Dai S An J Genetic inactivation of adenosine A2A receptors attenuates acute traumatic brain injury in the mouse cortical impact model Exp Neurol 2009 215 69 76 18938161 19 Xu Y Zhang R Li C Dexmedetomidine attenuates acute lung injury induced by lipopolysaccharide in mouse through inhibition of MAPK pathway Fundam Clin Pharmacol 2015 29 462 71 26211495 20 Jin W Zhu L Guan Q Influence of Nrf2 genotype on pulmonary NF-kappaB activity and inflammatory response after traumatic brain injury Ann Clin Lab Sci 2008 38 221 27 18715849 21 Bao S Zou Y Wang B Ginsenoside Rg1 improves lipopolysaccharide-induced acute lung injury by inhibiting inflammatory responses and modulating infiltration of M2 macrophages Int Immunopharmacol 2015 28 429 34 26122136 22 Yan X Wu L Li B Cyanidin-3-O-glucoside attenuates acute lung injury in sepsis rats J Surg Res 2015 199 592 600 26152793 23 Weber DJ Allette YM Wilkes DS White FA The HMGB1-RAGE inflammatory pathway: Implications for brain injury-induced pulmonary dysfunction Antioxid Redox Signal 2015 23 1316 28 25751601 24 Matalon S A critical review of the American Journal of Physiology-Lung Cellular and Molecular Physiology: 2012–2015 Am J Physiol Lung Cell Mol Physiol 2014 307 L911 16 25381028 25 Jiang L Li L Shen J Effect of dexmedetomidine on lung ischemia-reperfusion injury Mol Med Rep 2014 9 419 26 24345905 26 Gao S Wang Y Zhao J Su A Effects of dexmedetomidine pretreatment on heme oxygenase-1 expression and oxidative stress during one-lung ventilation Int J Clin Exp Pathol 2015 8 3144 49 26045831 27 Banjara M Ghosh C Sterile neuroinflammation and strategies for therapeutic intervention Int J Inflam 2017 2017 8385961 28127491 28 Lotze MT Tracey KJ High-mobility group box 1 protein (HMGB1): Nuclear weapon in the immune arsenal Nat Rev Immunol 2005 5 331 42 15803152 29 Diener KR Al-Dasooqi N Lousberg EL Hayball JD The multifunctional alarmin HMGB1 with roles in the pathophysiology of sepsis and cancer Immunol Cell Biol 2013 91 443 50 23797067 30 Okuma Y Liu K Wake H Anti-high mobility group box-1 antibody therapy for traumatic brain injury Ann Neurol 2012 72 373 84 22915134 31 Hara M Zhou ZY Hemmings HC a2-adrenergic receptor and isoflurane modulation of presynaptic Ca2+ influx and exocytosis in hippocampal neurons Anesthesiology 2016 125 535 46 27337223