==== Front Braz J MicrobiolBraz. J. MicrobiolBrazilian Journal of Microbiology1517-83821678-4405Elsevier S1517-8382(17)30200-910.1016/j.bjm.2017.11.002Veterinary MicrobiologypMEX01, a 70 kb plasmid isolated from Escherichia coli that confers resistance to multiple β-lactam antibiotics Hernandez-Flores Jose Luis aPérez Juan Caballero bGutiérrez Carlos Saldaña cHernández Andrés Cruz bAlonso Gerardo Soto cHernández Sergio Pacheco bGómez Sergio Romero bFernández Francisco dLoske Achim M. loske@fata.unam.mxd⁎Guillén Juan Campos juan.campos@uaq.mxb⁎a Unidad Irapuato, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, Departamento de Ingeniería Genética, Irapuato, Guanajuato, Mexicob Universidad Autónoma de Querétaro, Facultad de Química, Querétaro, Mexicoc Universidad Autónoma de Querétaro, Facultad de Ciencias Naturales, Querétaro, Mexicod Universidad Nacional Autónoma de México, Centro de Física Aplicada y Tecnología Avanzada, Querétaro, Mexico⁎ Corresponding authors. loske@fata.unam.mxjuan.campos@uaq.mx03 2 2018 Jul-Sep 2018 03 2 2018 49 3 569 574 20 2 2017 7 11 2017 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Multidrug-resistant microorganisms are of great concern to public health. Genetic mobile elements, such as plasmids, are among the most relevant mechanisms by which bacteria achieve this resistance. We obtained an Escherichia coli strain CM6, isolated from cattle presenting severe diarrheic symptoms in the State of Querétaro, Mexico. It was found to contain a 70 kb plasmid (pMEX01) with a high similarity to the pHK01-like plasmids that were previously identified and described in Hong Kong. Analysis of the pMEX01 sequence revealed the presence of a blaCTX-M-14 gene, which is responsible for conferring resistance to multiple β-lactam antibiotics. Several genes putatively involved in the conjugative transfer were also identified on the plasmid. The strain CM6 is of high epidemiological concern because it not only displays resistance to multiple β-lactam antibiotics but also to other kinds of antibiotics. Keywords Escherichia coliPlasmidAntibiotic resistanceblaCTX-M-14 geneAssociate Editor: Afonso Barth ==== Body Introduction Plasmids play a crucial role in the dissemination of CTX-M type extended-spectrum β-lactamases (ESBLs), and their characterization may provide important insight into understanding multidrug-resistant bacterial strains. β-Lactams are among the most widely used antimicrobial agents for the treatment of bacterial infections. However, the intensive exposure of bacteria to β-lactam antibiotics has induced the emergence of several antibiotic resistance strategies, with the development of β-lactamases capable of inactivating β-lactams being one of the most relevant. In gram-negative bacteria, the production of ESBLs is the principal cause of resistance to β-lactam antibiotics.1, 2 Plasmids encoding CTX-M-type cefotaximase were reported in Germany in the late 1980s,3, 4 and they are currently distributed worldwide, including North America,5 Latin America6 and Asia.7 CTX-M has become so widespread that it is now considered to be the most prevalent β-lactamase among clinical isolates of Escherichia coli worldwide.8 Diverse studies in Hong Kong,9, 10 China,11 and South Korea12 have reported that CTX-M-14 is the most frequently found β-lactamase enzyme in E. coli, Klebsiella pneumoniae, and Shigella isolates. In Mexico, the presence of GES and CTX-M type β-lactamases have been found in Enterobacteriaceae clinical isolates.13 In a previous study, we sampled multidrug-resistant E. coli strains from cattle presenting severe diarrheic symptoms in the State of Querétaro, Mexico, and analyzed their drug resistance spectra, plasmid profiles and conservation using shock waves.14 In this study, we analyzed the complete nucleotide sequence of the pMEX01 plasmid from E. coli strain CM6, which has a high similarity with the previously described pHK01-like plasmids.15 Materials and methods Isolation and identification of bacteria Fecal samples were obtained from cattle presenting severe diarrheic symptoms in the State of Querétaro, Mexico during 2014. Samples from cattle that did not respond to standard antibiotic treatment were selected for further analysis. A total of 10 isolates were identified as E. coli by analyzing 16S ribosomal deoxyribonucleic acid (rDNA) sequences, which were amplified using the primers fD1 (CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG) and rD1 (CCCGGGATCCAAGCTTAAGGAGGTGATCCAGCC)15 and by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry,16 using a MicroFlex LT mass spectrometer (Bruker Daltonics, Bremen, Germany). Antibiotic resistance profile The plasmid pMEX01 was extracted from E. coli strain CM6 and transformed by electroporation (250 V, 20 Ω and 250 μFD) into the E. coli strain BL21 STAR (Invitrogen, Carlsbad, CA, U.S.A.). We then determined the antibiotic resistance profiles of the E. coli strain CM6 and the E. coli strain BL21 STAR containing pMEX01. All antimicrobial testing was performed on agar-solidified LB. The β-lactam antibiotics assayed included carbenicillin, cephalexin, ceftriaxone, cefotaxime and dicloxacillin. Kanamycin, rifampicin, chloramphenicol, polymyxin, spectinomycin and streptomycin were also tested. The minimum inhibitory concentration (MIC) of each E. coli strain were evaluated by the criteria of the Clinical and Laboratory Standards Institute.17 E. coli BL21 STAR without the pMEX01 plasmid was used as a control. Sequencing and bioinformatics E. coli strain CM6 was selected for plasmid isolation and sequencing. The plasmid was extracted from an overnight culture of the selected strain grown in LB broth (BD DIFCO, Mexico) and purified using a Zyppy Plasmid Miniprep Kit (Zymo Research, CA, U.S.A). The plasmid was sequenced with an Illumina HiSeq 2000 sequencing platform at the Macrogen Korea Institute (Seoul, Republic of Korea) using a whole-genome shotgun library strategy. The plasmidic DNA sequence was reconstructed using multiple bioinformatic tools. The sequence reads were assembled using the genome assembler program SPAdes v3.1.1.18 The initial contigs were compared with the Plasmids database from NCBI GenBank (accessed April 2016) using Blast+. The best matches indicated a high similarity with pHK plasmid family, then we use pHK17a as a template to reorder the contigs and reconstruct the full plasmid. Open reading frames (ORFs) were deduced and annotated by using NCBI Glimmer v3.02.19, 20, 21 ORF sequences were analyzed against protein family databases to obtain information about their functionality.22, 23 Nucleotide sequence The nucleotide sequence for the pMEX01 plasmid has been deposited in GenBank under the accession number KU695535. Results Sequence assembly and comparative analysis of the pMEX01 plasmid The plasmid (pMEX01) from E. coli strain CM6 was isolated and sequenced. The sequencing of pMEX01 produced 26,133,370 short-sequences as 2×100 paired-end reads. The initial assembly of the sequence reads produced 1247 contigs, with an average size of 4879 bp, an expected 2119× average coverage and a calculated N50 value of 20,000. The fine assembly using pHK17a sequence as a reference showed the presence of a circular replicon consisting of 70,093 nucleotides, with an average GC content of 52.27% (Fig. 1).Fig. 1 Circular map of pMEX01 (inner map) compared to pHK17a (outer map). The length of pMEX01 is 70,093 bp. Dark green, ORF related to plasmid replication; light green, ORF related to plasmid stabilization; red, CTX-M-14 β-lactamase; gray, ORF related to transposases, insertion sequences; yellow, ORF related ABC transport system; light blue, ORF related to plasmid conjugation, transfer; dark blue, miscellaneous ORF. Inner circle indicates a GC plot, with purple and brown indicating below and above average GC contents, respectively. Asterisks indicate ORF with significant differences. The pMEX01 plasmid is comparable in size and is highly similar to other plasmids isolated and sequenced from E. coli in Asia, including pHK17a (99%), pHK01 (99%), pHK08 (99%), and pHK09 (99%); pKF3-70 (98%) from K. pneumoniae; pEG0356 (99%) (except for the blaCTX-M-14 allele) from S. sonnei; and pO26-L (98%) a plasmid from a Canadian E. coli isolate that carries a tetracycline resistance gene cluster (Fig. 2). Our assembly covers 88.71% of the reference sequence (pHK17a) with an average coverage of 7547×. A sequence analysis of pMEX01 showed that it belongs to the incompatibility group IncFII. Analyses using several algorithms and approaches showed that the pMEX01 plasmid had 98 potential ORFs, with only 8 showing similarities to unknown proteins from the NCBI non-redundant microbial protein database (Supplementary Table S1). pMEX01 contains a number of primary structural features that are highly similar to pHK01-like plasmids. These include a DNA transfer region (tra genes), required for efficient conjugative transfer; the trb genes, which are involved in pilus assembly, the putative plasmid mobility gene (mob); the conjugation gene trwB; and the traT gene, which appears to be responsible for maintaining the regulation of transfer efficiencies. The finO gene is involved in inhibiting the expression of the regulatory gene traJ in a process known as fertility inhibition. In addition, pMEX01 carries genetic information for the control of replication, including a structural gene (rep) that encodes an initiation protein (Rep), as well as a protein involved in the toxin–antitoxin system mechanism that participates in plasmid maintenance (relE/parE). Genes encoding an iron ABC transport system (eit genes) are also present, including a permease, a substrate-binding protein, and an export-associated protein. The plasmid harbors a well-defined potential transposon consisting of IS903, a blaCTX-M-14 gene, and an ISEcp1 element (tnpA gene), which according to the sequence analysis and distance that separates these genetic elements, corresponds to a type II transposon (Fig. 1).Fig. 2 Phylogenetic dendrogram for pMEX01. The assembled sequence was compared with the NCBI Plasmid database (accessed April 2016) with Blastn (megablast) to identify highly similar full plasmid sequences with E-value < 10−10. Plasmid sequences were aligned and a dendrogram was generated using the NJ algorithm in ClustalW v2.1 with the default parameters. Since strain CM6 was isolated from the feces of cattle that did not respond to the standard treatment, we assessed the antibiotic resistance profile of strain CM6 to gain insight into its potential multidrug-resistance. We found that it has a resistance not only to high concentrations of β-lactam antibiotics (Table 1), but also to several other antibiotics, including kanamycin, streptomycin and to spectinomycin, but not rifampicin and polymyxin, to which CM6 is susceptible. To correlate these phenotypic traits with the presence of the pMEX01 plasmid, the E. coli BL21 STAR transformant carrying the plasmid was evaluated. The results showed that the presence of pMEX01 provides the E. coli BL21 STAR strain with resistance to all β-lactam antibiotics analyzed (Table 1). Taken together, our findings suggest that pMEX01 is highly similar to other pHK01-like plasmids disseminated worldwide with an extended-spectrum β-lactamase.Table 1 Minimum inhibitory concentration (μg/mL) of E. coli strain CM6 and E. coli BL21 STAR transformants carrying pMEX01 plasmid. Table 1Antibiotic CM6 BL21 STAR pMEX01 Carbenicillin >400 >400 Dicloxaillin >400 >400 Cephalexin >400 >400 Ceftriaxone >400 >400 Cefotaxime >400 >400 Kanamycin >30 30 Rifampicin 10 10 Chloramphenicol >30 30 Polymyxin 2 2 Spectinomycin >100 100 Streptomycin >50 50 Discussion This study demonstrated the presence of a pHK01-like plasmid (pMEX01) in E. coli strain CM6 that was isolated from fecal samples of cattle in the State of Querétaro, Mexico. Although pMEX01 is high similar to pHK17a (99%), several open reading frames significantly differ between the two plasmids. For instance, CDS10 and 17, which are involved in transposition, have identities of 40.4% and 81.5%, respectively, when compared with their corresponding open reading frames in pHK17a. CDS37, which codes for a putative ydaA, has 62.2% identity and has a premature stop codon. Interestingly, CDS88, which encodes the Type IV conjugative transfer system coupling protein TraD, is 85.5% identical to the corresponding TraD in pHK17a and has a premature stop codon. These changes in this open reading frame may have a significant impact on the fitness of pMEX01 since the last 37 amino acid residues are involved in plasmid specificity and transfer efficiency,24 although this has to be verified experimentally. In the pMEX01 plasmid, blaCTX-M-14 was the only β-lactam resistant determinant found. We compared the antibiotic resistance profile of CM6 against the E. coli BL21 STAR transformant carrying the pMEX01 plasmid. Although both CM6 and the E. coli BL21 STAR transformant exhibited resistance to a wide range of β-lactams, both strains did not exhibit similar resistance to kanamycin, spectinomycin, streptomycin or chloramphenicol, indicating that these resistance traits might be encoded on a different extra-chromosomal element present in the CM6 isolate. Indeed, pMEX01 was not the only plasmid detected when total CM6 DNA was analyzed by PFGE (data not shown). The aminoglycoside and chloramphenicol resistances displayed by CM6, along with the resistance to different generations of β-lactams, may explain why the afflicted cattle were not responsive to standard treatment. The CTX-M enzymes are a subfamily of the extended-spectrum β-lactamases (ESBLs) that confer resistance to β-lactam antibiotics. More than one hundred types of CTX-M enzymes have been reported and are classified into five classes (CTX-M-1, CTX-M-2, CTX-M-8, CTX-M-9 and CTX-M-25); these enzymes are associated with ISEcp1-like insertion sequences (IS) for mobilization and are the most broadly distributed enzymes among a wide range of bacteria, particularly the Enterobacteriaceae family.25, 26 The CTX-M-14 enzyme identified in the E. coli strain CM6 pMEX01 plasmid has been sub-classified into the CTX-M-9 group.27 Although E. coli is recognized as the major source of ESBLs,28 it is accepted that the CTX-M group has a chromosomal origin from Kluyvera georgiana and is the likely source of CTX-M-9 family, of which the pMEX01 CTX-M-14 enzyme is a member.29 Members of the CTX-M-5 family have been reported in North America,25 but to the best of our knowledge, this is the first report of a member of the CTX-M-9 family in this region. This finding suggests that multiple genetic processes are involved in the evolution and persistence of the pHK01-like plasmids in diverse countries.12 The β-lactam resistance gene present in pMEX01 likely emerged from a bacterial lineage with multidrug resistance and maintenance of a pHK01-like plasmid. The pMEX01 plasmid has a potential transposon comprised of an IS903, the blaCTX-M-14 gene and an ISEcp1 element, which has important epidemiological implications for the dissemination of this β-lactamase.30 In fact, diverse studies have demonstrated the wide dissemination of pHK01 plasmid among E. coli isolates obtained from patients with urinary tract infections in Hong Kong.31 Plasmid variants closely related to pHK01 have also been isolated among E. coli isolates from pigs (pHK17a) and human fecal samples (pHK09) in Hong Kong.32 The dissemination of pHK01-like plasmids has also been detected among K. pneumonia isolates from human-fecal samples (pKF3-70) in China26 and among S. sonnei isolates from human fecal samples (pEG356) circulating in southern Vietnam.33 Previous studies have shown that Shiga toxin-producing E. coli (STEC) are medically important foodborne pathogens responsible for diverse outbreaks of hemorrhagic colitis and hemolytic uremic syndrome. These bacteria often carry a variety of plasmids that encode virulence factors and antibiotic-resistance genes, such as the pO26-L plasmid, a closely related variant of pHK01 that has a tetracycline resistance operon; this plasmid was isolated from E. coli 026:H11 strain H30, which was isolated from a child presenting diarrheic symptoms in Canada.34 Considering these studies and the fact that the pMEX01 plasmid has a similar structure as several other plasmids isolated from diverse parts of the world, we can infer that not only are cattle an important reservoir, but also that farm workers could be important for the dissemination of E. coli strains with multidrug resistance and for the persistence of pHK01-like plasmids. The economic importance of cattle in the State of Querétaro, Mexico, as well as the diverse federal regulations for their transport has forced public health authorities to create diverse strategies to reduce the transfer of these multi-drug-resistant bacteria in human and animal populations, and understand the role of these E. coli strains and its plasmids in pathogenesis. Therefore, a detailed molecular characterization of this plasmid from diverse farms and geographical origins in the State of Querétaro, Mexico should be investigated to identify the epidemiologic pattern of pMEX01 plasmid sequences and changes over time. Conflicts of interest The authors declare no conflicts of interest. Appendix A Supplementary data The following are the supplementary data to this article: Acknowledgements The authors would like to thank Paula Bernardino, René Preza and Guillermo Vázquez for technical assistance. This study was partially financed by the Universidad Autónoma de Querétaro, México (PFCE 2016, projects FOFIUAQ 2016 and FOPER 2017 to CSG). Appendix A Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bjm.2017.11.002. ==== Refs References 1 Medeiros A.A. Evolution and dissemination of beta-lactamases accelerated by generations of beta-lactam antibiotics Clin Infect Dis 24 suppl 1 1997 S19 S45 8994778 2 Mulec J. Starcic M. Zgur-Bertok D. F-like plasmid sequences in enteric bacteria of diverse origin, with implication of horizontal transfer and plasmid host range Curr Microbiol 44 4 2002 231 235 11910490 3 Bradford P.A. Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat Clin Microbiol Rev 14 4 2001 933 951 [table of contents] 11585791 4 Bauernfeind A. Grimm H. Schweighart S. A new plasmidic cefotaximase in a clinical isolate of Escherichia coli Infection 18 5 1990 294 298 2276823 5 Moland E.S. Black J.A. Hossain A. Discovery of CTX-M-like extended-spectrum beta-lactamases in Escherichia coli isolates from five US States Antimicrob Agents Chemother 47 7 2003 2382 2383 12821506 6 Bonnet R. Sampaio J.L. Chanal C. A novel class A extended-spectrum beta-lactamase (BES-1) in Serratia marcescens isolated in Brazil Antimicrob Agents Chemother 44 11 2000 3061 3068 11036023 7 Chanawong A. M’Zali F.H. Heritage J. Characterisation of extended-spectrum beta-lactamases of the SHV family using a combination of PCR-single strand conformational polymorphism (PCR-SSCP) and PCR-restriction fragment length polymorphism (PCR-RFLP) FEMS Microbiol Lett 184 1 2000 85 89 10689171 8 Livermore D.M. Canton R. Gniadkowski M. CTX-M: changing the face of ESBLs in Europe J Antimicrob Chemother 59 2 2007 165 174 17158117 9 Ho P.L. Chow K.H. Lai E.L. Extensive dissemination of CTX-M-producing Escherichia coli with multidrug resistance to ‘critically important’ antibiotics among food animals in Hong Kong, 2008–10 J Antimicrob Chemother 66 4 2011 765 768 21393133 10 Duan R.S. Sit T.H. Wong S.S. Escherichia coli producing CTX-M beta-lactamases in food animals in Hong Kong Microb Drug Resist 12 2 2006 145 148 16922633 11 Tian G.B. Wang H.N. Zou L.K. Detection of CTX-M-15 CTX-M-22, and SHV-2 extended-spectrum beta-lactamases (ESBLs) in Escherichia coli fecal-sample isolates from pig farms in China Foodborne Pathog Dis 6 3 2009 297 304 19272004 12 Tamang M.D. Nam H.M. Kim S.R. Prevalence and molecular characterization of CTX-M beta-lactamase-producing Escherichia coli isolated from healthy swine and cattle Foodborne Pathog Dis 10 1 2013 13 20 23210923 13 Barrios H. Garza-Ramos U. Ochoa-Sanchez L.E. A plasmid-encoded class 1 integron contains GES-type extended-spectrum beta-lactamases in Enterobacteriaceae clinical isolates in Mexico Antimicrob Agents Chemother 56 7 2012 4032 4034 22526300 14 Loske A.M. Campos-Guillen J. Fernandez F. Enhanced shock wave-assisted transformation of Escherichia coli Ultrasound Med Biol 37 3 2011 502 510 21316563 15 Weisburg W.G. Barns S.M. Pelletier D.A. 16S ribosomal DNA amplification for phylogenetic study J Bacteriol 173 2 1991 697 703 1987160 16 Lartigue M.F. Matrix-assisted laser desorption ionization time-of-flight mass spectrometry for bacterial strain characterization Infect Genet Evol 13 2013 230 235 23159555 17 Clinical and Laboratory Standards Institute [CLSI] Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Third Informational Supplement. CLSI Document M100-S23 2013 Clinical and Laboratory Standards Institute Wayne, PA 18 Bankevich A. Nurk S. Antipov D. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing J Comput Biol 19 5 2012 455 477 22506599 19 Salzberg S.L. Delcher A.L. Kasif S. Microbial gene identification using interpolated Markov models Nucleic Acids Res 26 2 1998 544 548 9421513 20 Delcher A.L. Harmon D. Kasif S. Improved microbial gene identification with GLIMMER Nucleic Acids Res 27 23 1999 4636 4641 10556321 21 Wheeler D.L. Church D.M. Federhen S. Database resources of the National Center for Biotechnology Nucleic Acids Res 31 1 2003 28 33 12519941 22 de Castro E. Sigrist C.J. Gattiker A. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins Nucleic Acids Res 34 Web Server issue 2006 W362 W365 16845026 23 Finn R.D. Bateman A. Clements J. Pfam: the protein families database Nucleic Acids Res 42 Database issue 2014 D222 D230 24288371 24 Sastre J.I. Cabezon E. de la Cruz F. The carboxyl terminus of protein TraD adds specificity and efficiency to F-plasmid conjugative transfer J Bacteriol 180 22 1998 6039 6042 9811665 25 Canton R. Coque T.M. The CTX-M beta-lactamase pandemic Curr Opin Microbiol 9 5 2006 466 475 16942899 26 Yi H. Xi Y. Liu J. Sequence analysis of pKF3-70 in Klebsiella pneumoniae : probable origin from R100-like plasmid of Escherichia coli PLoS One 5 1 2010 e8601 20066042 27 Bonnet R. Growing group of extended-spectrum beta-lactamases: the CTX-M enzymes Antimicrob Agents Chemother 48 1 2004 1 14 14693512 28 Valverde A. Coque T.M. Sánchez-Moreno M.P. Dramatic increase in prevalence of fecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae during nonoutbreak situations in Spain J f Clin Microbiol 42 10 2004 4769 4775 29 Olson A.B. Silverman M. Boyd D.A. Identification of a progenitor of the CTX-M-9 group of extended-spectrum beta-lactamases from Kluyvera georgiana isolated in Guyana Antimicrob Agents Chemother 49 5 2005 2112 2115 15855541 30 Poirel L. Lartigue M.F. Decousser J.W. ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli Antimicrob Agents Chemother 49 1 2005 447 450 15616333 31 Ho P.L. Lo W.U. Wong R.C. Complete sequencing of the FII plasmid pHK01, encoding CTX-M-14, and molecular analysis of its variants among Escherichia coli from Hong Kong J Antimicrob Chemother 66 4 2011 752 756 21393220 32 Ho P.L. Lo W.U. Yeung M.K. Dissemination of pHK01-like incompatibility group IncFII plasmids encoding CTX-M-14 in Escherichia coli from human and animal sources Vet Microbiol 158 1–2 2012 172 179 22386670 33 Nguyen N.T. Ha V. Tran N.V. The sudden dominance of blaCTX-M harbouring plasmids in Shigella spp. circulating in Southern Vietnam PLoS Negl Trop Dis 4 6 2010 e702 20544028 34 Fratamico P.M. Yan X. Caprioli A. The complete DNA sequence and analysis of the virulence plasmid and of five additional plasmids carried by Shiga toxin-producing Escherichia coli O26:H11 strain H30 Int J Med Microbiol 301 3 2011 192 203 21212019