==== Front Braz J MicrobiolBraz. J. MicrobiolBrazilian Journal of Microbiology1517-83821678-4405Elsevier S1517-8382(17)30252-610.1016/j.bjm.2017.09.008Veterinary MicrobiologyDetection and genetic characterization of Mamastrovirus 5 from Brazilian dogs Alves Christian D.B.T. aBudaszewski Renata F. aTorikachvili Marcela aStreck André F. bWeber Matheus N. aCibulski Samuel P. aRavazzolo Ana P. cLunge Vagner R. dCanal Cláudio W. claudio.canal@ufrgs.bra⁎a Universidade Federal do Rio Grande do Sul (UFRGS), Faculdade de Veterinária, Laboratório de Virologia, Porto Alegre, RS, Brazilb Universidade de Caxias do Sul (UCS), Faculdade de Medicina Veterinária, Laboratório de Imunologia, Caxias do Sul, RS, Brazilc Universidade Federal do Rio Grande do Sul (UFRGS), Faculdade de Veterinária, Laboratório de Imunologia e Biologia Molecular, Porto Alegre, RS, Brazild Universidade Luterana do Brasil, Pró Reitoria de Pesquisa e Pós Graduação, Laboratório de Diagnóstico Molecular, Canoas, RS, Brazil⁎ Corresponding author. claudio.canal@ufrgs.br02 2 2018 Jul-Sep 2018 02 2 2018 49 3 575 583 16 3 2017 26 9 2017 © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda.2018Sociedade Brasileira de MicrobiologiaThis is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Mamastrovirus 5 (MAstV5), belonging to the Astroviridae (AstV) family, previously known as canine astrovirus or astrovirus-like particles, has been reported in several countries to be associated with viral enteric disease in dogs since the 1980s. Astroviruses have been detected in fecal samples from a wide variety of mammals and birds that are associated with gastroenteritis and extra enteric manifestations. In the present study, RT-PCR was used to investigate the presence of MAstV5 in 269 dog fecal samples. MAstV5 was detected in 26% (71/269) of the samples. Interestingly, all MAstV5-positive samples derived from dogs displaying clinical signs suggestive of gastroenteritis, other enteric viruses were simultaneously detected (canine parvovirus, canine distemper virus, canine coronavirus, canine adenovirus and canine rotavirus). Based on genomic sequence analysis of MAstV5 a novel classification of the species into four genotypes, MAstV5a-MAstV5d, is proposed. Phylogenetic analyses based on the ORF2 amino acid sequences, samples described herein grouped into the putative genotype ‘a’ closed related with Chinese samples. Other studies are required to attempt the clinical and antigenic implications of these astrovirus genotypes in dogs. Keywords Mamastrovirus 5Canine astrovirusDogGastroenteritisMAstV5Associate Editor: Mauricio Nogueira ==== Body Introduction Viruses belonging to the Astroviridae (AstV) family are spherical, non-enveloped, 28–30 nm in size, with a surface that forms a characteristic star-like structure.1 The RNA genome of AstV ranges from 6.8 to 7.9-kb in size, polyadenylated at the 3′ end, and contains three ORFs designated as ORF1a, ORF1b and ORF2. ORF1a encodes a protease, ORF1b encodes an RNA-dependent RNA-polymerase,2, 3 while ORF2 encodes the viral capsid structural polyprotein that is required for virion assembly.4 The viral classification was previously based on the host and consisted of two genera, Avastrovirus and Mamastrovirus. However, recent characterization of novel astroviruses has taken in consideration that isolates from different animal species can be genetically similar, while genetically diverse viruses can be isolated from the same animal species.2 Based on this analysis, the International Committee on Taxonomy of Viruses renamed canine astrovirus as Mamastrovirus 5 (MAstV5).5 Astroviruses have been detected in fecal samples from a wide variety of mammals and birds that are associated with gastroenteritis.2 In children, AstVs are the second most common cause of gastroenteritis after rotaviruses.2, 6 Human AstVs can also cause significant disease in the elderly7 and immune-compromised patients.8, 9 In addition to enteric manifestations, AstVs have been associated with fatal hepatitis in ducks,10 interstitial nephritis in young chickens,11 stunting and pre hatching mortality in duck and goose embryos,12 as well as shaking mink syndrome13. Recently, an AstV was also hypothesized to be the causative agent of nonsuppurative encephalitis in cattle.14 Since the 1980s, astrovirus-like particles have been reported in dogs with and without diarrhea.15, 16, 17 To date, canine astroviruses or astrovirus-like particles infecting dogs have been reported in several countries.15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 Despite the detection of MAstV5 in association with gastroenteritis in dogs, which suggests a possible role for MAstV5 as a canine enteric pathogen, the association of MAstV5 with clinical disease remains obscure in such reports. Here, we investigated the presence of MAstV5 using RT-PCR in fecal samples from dogs of different ages with and without diarrhea. The partial genomes of selected MAstV5 RNA-positive samples were also sequenced to perform a phylogenetic analysis comparing them with the MAstV5 sequences described in the literature as the cause of enteric disease.18, 20, 23, 26 Additionally, MAstV5 was proposed to be classified in four putative genotypes. Materials and methods Samples and nucleic acid extraction A total of 269 dog fecal samples were collected between 2008 and 2014 in veterinary clinics and hospitals by convenience. These samples were obtained from eight Federal States of Brazil (Acre, Mato Grosso do Sul, Paraná, Rio Grande do Sul, Rio de Janeiro, Rondônia, Santa Catarina and São Paulo). The animal's age was recorded and ranked from puppy (equal or less than one-year-old) to adult dog (more than one-year-old); some samples from dogs of unknown age were included. Animals not presenting diarrhea at the time of sampling were considered asymptomatic and those presenting clinical signs of enteric disease diarrhea were classified as symptomatic. Samples were diluted to 20% (w/v) in phosphate buffered saline (PBS, pH 7.4) and stored at −80 °C for further analysis. Subsequently, viral DNA isolation from the supernatant was performed using a commercial kit (NewGene Preamp®, Simbios Biotecnologia, Brazil) based on guanidine isothiocyanate and silica.27 Viral RNA was isolated using TRIzol® LS Reagent (Life Technologies™, USA) according to the manufacturer's instructions. Oligonucleotides for MAstV5 detection and sequencing An initial screening using RT-PCR to detect a larger number of Mamastrovirus species was achieved by amplifying 422 bp of the ORF1b fragment using oligonucleotides, as previously described.28 For the specific detection of MAstV5, 92 nucleotide sequences of this species were retrieved from GenBank database (http://www.ncbi.nlm.nih.gov/nucleotide), and aligned using CLUSTAL W within Molecular Evolutionary Genetics Analysis version 6 (MEGA6).29 The MAstV5 specific RT-PCR was designed with a primer pair targeting the region of ORF2 that amplified a 250 bp fragment selected using Primer3 software.30 In addition, the 16S rRNA gene from Escherichia coli was amplified using the primer pair FC27 and R530 as an endogenous internal control in each fecal sample evaluated for the specific presence of MAstV5.31 For partial genome amplification, sets of 12 pairs of sequencing primers were selected to amplify overlapping fragments of ORF1 (ORF1a and ORF1b) and capsid protein (ORF2) segment representing a consensus sequence of approximately 5000 nucleotides. The primer sequences are shown in Table 1.Table 1 Oligonucleotide sequences applied in the present work. Table 1Primer name Sequence (5′–3′) Target Objective Reference ADS_138F AATGTCACGGGGATACCATC ORF1a Phylogenetic analysis Present study ADS_230F GTGCATCAAACCAACACTGG ADS_690R GGGTCACTCCATTCAGGAAA ADS_367F CAAACCCCAACCTCAAGAGA ADS_941R CATCCTCAGCAGTCCAGTCA ADS_719F TGGGACACATATGGTGATGAA ADS_1022R GCCTAGGCTTGAGGATGTGA ADS_922F TGACTGGACTGCTGAGGATG ADS_1606R AGTCGGCTTCGGTGTCATAG ORF1b ADS_1317F TGATCCGCTCAAATCCCTAC ADS_1669R TTGCTCCGGACATAATCCTC ADS_1565F CTGCCTATCCCAAGATGCTC ADS_2192R GCAAATTCAAAAGCCTGGAG ADS_2173F CTCCAGGCTTTTGAATTTGC ADS_2857R ACTCTCTTGCGACCACGATT ORF2 ADS_2839F ATCGTGGTCGCAAGAGAGTT ADS_3535R AGTGGTTGTCCTGCTTCACC ADS_3415F TTGAGCTTCACTGCACTTGG ADS_4033R CATGGTGGGTTCTGTTGGTA ADS_3963F CCAGCTGTTATTGGGGACAA ADS_4628R TTGGTGGTGTTCTGAGGAAA ADS_4446F GCCCCTGGTTCATTTTTGT ADS_5030R TGAACCTGTACCCTCGATCC ADS_TTTR TTTTTTTTTTTTTTTTTTTT Poli A tail ASTRO 2 GARTTYGATTGGRCKCGKTAYGA ORF 1b Screening 28 ASTRO 3 GGYTTKACCCACATNCCRAA ASTRO 4 CGKTAYGATGGKACKATHCC ASTRO 5 AGGTAYGATGGKACKATHCC ASTRO 6 GARTTYGATTGGRCKAGGTAYGA AstVCan For TCTGATGATGATTCTCTTCTTGATG ORF2 MAstV5 specific Present study AstVCan Rev GGGAACACTTTTCACGAGCA FC27 AGAGTTTGATCCTGGCTCAG 16S RNA E. coli Internal control 31 R530 CCGCGGCTGCTGGCACGTA CPV 555 F CAGGAAGATATCCAGAAG VP2 CPV detection 35 CPV 555 R GGTGCTAGTTGATATGTA HA1 CGCGCTGAACATTACTACCTTGTC E3 CAdV detection 36 HA2 CCTAGAGCACTTCGTGTCCGCTT CCoV 1F TCCAGATATGTAATGTTCGG M CCoV detection 37 CCoV 2R TCTGTTGAGTAATCACCAGCT BEG 9F GGCTTTAAAAGAGAGAATTTCCGTCTGG VP7 CRV detection 38 END 9R GGTCACATCATACAATTCTAATCTAAG CDV 1F ACTGCTCCTGATACTGC NC CDV detection 39 CDV 2R TTCAACACCRACYCCC CDV 3F ACAGRATTGCYGAGGACYTRT 40 CDV 4F CARRATAACCATGTAYGGTGC VP, virus protein; ORF, open read frame; E, early region; M, structural protein M; NC, nucleocapsid protein. Nested RT-PCR for MAstV5 detection The cDNA was synthesized using SuperScript® III Reverse Transcriptase Kit (Life Technologies, USA) using the reverse primers in a total volume of 20 μL, following the manufacturer's instructions. The cDNA amplification was conducted in a final volume of 25 μL containing 1× PCR buffer, 1.5 mM of MgCl2, 0.2 mM of dNTP mix, 0.2 μM of each primer and 1 unit of Platinum® Taq DNA Polymerase (Life Technologies, USA). The first round of RT-PCR screening was carried out with an initial incubation at 94 °C for 3 min, 30 cycles of amplification consisting of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 min, and extension at 72 °C for 1 min. The second round was performed in a final volume of 25 μL that contained 2 μL of the first reaction product and the thermocycler conditions were the same as those used for the first round. The MAstV5-specific RT-PCR with specific and internal control primers was performed as a multiplex protocol. Cycling conditions were an initial cycle at 94 °C for 5 min, 25 cycles of denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s and polymerization at 72 °C for 1 min, which was followed by a final extension cycle at 72 °C for 7 min. To confirm the specific amplification of MAstV5, RT-PCR products were submitted to purification using the NucleoSpin Extract II Kit (Macherey-Nagel, Germany) and sequenced. Both DNA strands were sequenced with an ABI PRISM 3100 Genetic Analyzer using a BigDye Terminator v.3.1 cycle Sequencing Kit (Applied Biosystems, USA). Detection of other enteric viruses All positive MAstV5 samples were also screened for other common enteric viruses through the amplification of cDNA/DNA. The primer pairs used for the detection of canine distemper virus (CDV), carnivore protoparvovirus 1 (canine parvovirus 2, CPV2), canine coronavirus (CCoV), canine rotavirus (CRV) and, canine adenovirus 1 (CAdV1) and CAdV2 are shown in Table 1. The cDNA/DNA amplification of the target sequences was conducted in a total volume of 25 μL containing 1× PCR buffer, 1.5 mM of MgCl2, 0.2 mM of dNTP mix, 0.2 μM of each primer pair and 1 unit of Taq DNA Polymerase (Ludwig Biotecnologia, Alvorada, RS, Brazil). Genome amplification Four MAstV5-positive samples were selected, taking into account their different geographical origins. ORF1a, ORF1b and ORF2 sequences were amplified using a nested touchdown RT-PCR method. The first round of amplification was conducted in a final volume of 25 μL. The cycling conditions included an initial denaturation at 95 °C for 5 min, 20 cycles of 30 s for denaturation at 95 °C, outer primer pair annealing for 30 s at 55–45 °C per the touchdown method, and 7 min of extension at 72 °C, with a final 7 min extension at 72 °C. The same final volume was used in the second round, which contained 2 μL of the amplification product of the first round. The second round cycling conditions were an initial denaturation at 95 °C for 5 min, 30 cycles of 30 s of denaturation at 95 °C, inner primer pair annealing for 30 s at 55–45 °C per the touchdown method, and 1 min of extension at 72 °C, with a 7 min final extension at 72 °C. Sequencing and phylogenetic inferences The RT-PCR products generated with the sets of sequencing primers were purified using the NucleoSpin Extract II Kit (Macherey-Nagel, Germany). Both DNA strands were sequenced with an ABI PRISM 3100 Genetic Analyzer using a BigDye Terminator v.3.1 cycle Sequencing Kit (Applied Biosystems, USA). Overlapping fragments were aligned and assembled using SeqMan software from the DNASTAR package (DNASTAR, USA).32 [The open reading frames were identified using the NCBI ORF Finder software (http://www.ncbi.nlm.nih.gov/gorf/gorf.html).] Sequence alignment was performed using the CLUSTAL W. For the phylogenetic inferences of the MAstV capsid protein region, the MAstV5 sequences that were submitted to genome amplification and 12 MAstV5 representative strains were included. MEGA6 software29 was used for phylogeny inference calculated using “find best DNA/protein model” tool from MEGA6. The Kimura 2-parameter substitution model was selected for the MAstV5 ORF2 nucleotide inference, and the LG substitution model (frequencies +F) was used for the amino acid inference. The substitution-rate variation among sites was modeled with a gamma distribution (shape parameter = 5). Statistical support was provided by 1000 non-parametric bootstrap analyses. A nucleotide distance matrix was calculated using an alignment with ORF2 and partial genome sequences (Table 2). The Mamastrovirus genotypes were distinguished based on the amino acid sequence of the full length ORF2, where the genetic distances (p-dist) 0.378–0.750 and 0.006–0.312 between and within groups, respectively, were used.5 All of the sequence alignments used to construct the phylogenetic trees are available in Figshare (http://figshare.com/) with the DOI number https://doi.org/10.6084/m9.figshare.4596325. The nucleotide sequences obtained in this study were deposited in GenBank under accession numbers KR349488–KR349491.Table 2 Comparison of identity percentage between nucleotide sequence of the partial genomes and amino acid sequence identity percentage of open reading frame 2 (ORF2) from the sequenced MAstV5 compared with sequences available in GenBank. Table 2Strain GenBank accession no. (genome size) Sara/13/BRA 5617/12/BRA GRAV/13/BRA 237/13/BRA (4980 nt, KR349488) (5012 nt, KR349490) (5039 nt, KR349491) (5011 nt, KR349489) Partial genome ORF2 Partial genome ORF2 Partial genome ORF2 Partial genome ORF2 Bari/2008_ITA HM045005 (3120 nt) 82 84 81 84 82 84 81 84 Italy/2005 FM213330 (2756 nt) 79 80 79 80 79 81 79 80 GI.E/Dog/ITA/2010/Zoid JN193534 (2949 nt) 76 77 76 77 75 77 76 77 China/2008_SH8 HQ623147 (2738 nt) 94 97 96 97 95 96 96 97 China/2008_SH15 HQ623148 (2738 nt) 94 97 96 97 95 96 96 97 Gillingham/2012/UK NC_026814 (6617 nt) 86 79 86 79 86 80 86 79 Lincoln/2012/UK KP404150 (6613 nt) 95 97 95 97 94 95 96 97 HUN/2012/2 KX599349 (6587 nt) 94 97 95 97 94 95 94 97 HUN/2012/6 KX599350 (6576 nt) 87 80 87 81 87 81 87 80 HUN/2012/115 KX599351 (6569 nt) 86 78 85 78 85 77 86 78 HUN/2012/126 KX599352 (6535 nt) 76 76 76 76 75 75 76 76 HUN/2012/135 KX599353 (6571 nt) 92 95 92 94 91 93 92 94 Results Detection of MAstV5 in fecal samples The RT-PCR protocol using the screening primers for MAstV5 was positive in 22% (64/269) of the samples, and the protocol using the specific primers for MAstV5 identified 12% (32/269) of the samples tested. The sample was considered MAstV5 positive if the results of at least one of the two RT-PCR protocols were positive, which resulted in 26% (71/269) of the fecal samples being detected as positive. In addition, PCR products generated from both protocols were submitted to DNA sequencing to confirm the results (data not shown). The RT-PCR internal control from the 16S rRNA gene of E. coli was positive in all 269 of the samples tested. Information about clinical signs of enteric disease was available for 49 of the 71 positive samples. Considering only these, in all of the MAstV5-positive samples derived from dogs with clinical signs suggestive of gastroenteritis, other enteric viruses were simultaneously detected. Detailed results for the supposed association with clinical signs and the detection of other enteric viruses are shown in Fig. 1 and Table 3, respectively.Fig. 1 Presumptive association between the MAstV5-positive samples (multiple or single infection) and the presence of clinical signs in the sampled dogs. Table 3 Detection of dog enteric viruses in the 49 MAstV5-positive samples. Table 3Virus n % MAstV5 alone 21 43 CDV+MAstV5 9 18 CPV+MAstV5 3 6 CRV+MAstV5 1 2 CCoV+MAstV5 4 8 CDV+CPV+MAstV5 6 12 CPV+CCoV+MAstV5 1 2 CPV+CAV+MAstV5 1 2 CDV+CPV+CCoV+MAstV5 1 2 CPV+CCoV+CRV+MAstV5 1 2 CDV+CPV+CCoV+CAV+MAstV5 1 1 Total 49 100 Animals were ranked in age category as puppies, adults and unknown age. Adults revealed a higher frequency of MAstV5-positive RT-PCR results than puppies (puppies: 44/166, 26.5%; adults: 6/16, 37.5%; unknown age: 21/91, 23.1%). No significant difference between dogs age and MAstV5 positive samples was observed in the different ranked ages (P = 0.56). MAstV5 genome sequences and phylogenetic inferences Four partial genomes were obtained, namely, MAstV5_Sara/13/BRA, MAstV5_237/13/BRA, MAstV5_GRAV/13/BRA and MAstV5_5617/12/BRA, which were 4980, 5011, 5039 and 5012 nt in length, respectively, excluding the poly(A) tail and the 5′ untranslated regions (UTRs). The three first partial genomes were collected from different cities of Rio Grande do Sul State (Porto Alegre, Viamão and Gravataí, respectively), and one was from Londrina city, Paraná State. All of the four nearly complete genomes contained a typical AstV organization in the three predicted ORFs – ORF1a, ORF1b and ORF2. Further genome sequence comparison revealed that the four partial genomes had greater identities (94–96%) with Chinese strains, considered as the Italy, Hungary and United Kingdom strains identity ranged from 76–82%, 75–95% and 86–96% when compared to the Brazilian strains identified here, respectively (Table 2). In addition, the amino acid sequences of the ORF2 of the HUN/2012/126 (GenBank accession number KX599352), GI.E/Dog/ITA/2010/Zoid (GenBank accession number JN193534) strains showed lower identities (76 and 77%, respectively) compared to the Brazilian strains (Table 2). Phylogenetic inferences were also carried out with the partial and complete sequences of OFR2 at nucleotide and amino acid levels. The partial genome sequences of MAstV5 obtained in the present study and those available in GenBank, together with selected Mamastrovirus reference sequences from other species, generated two evolutionary trees (Fig. 2). Forty-three reference strains and the four sequences from this study corresponding to 19 Mamastrovirus species were delineated with high bootstrap support throughout the entire tree (Fig. 2A). In the MAstV5 clade, all of the present sequences clustered with “Gillingham/2012/UK” (GenBank accession number NC_026814), although with low amino acid identities of approximately 80% (Table 2). Consequently, these four new sequences grouped within Chinese sequences, suggesting a different genotype putatively named as MAsTV5a (Fig. 2B). Through a pairwise comparison of the ORF2 nucleotide sequence, a high degree of nucleotide identity, ranging from 95% to 99%, was detected among the Brazilian type strains of this study. The study sequences showed a closer relationship with the Chinese strains grouping in genotype a. More distant strains were observed among the HUN/2012/126 (GenBank accession number KX599352) Hungary strain composing the genogroup b, Bari/2008_ITA (GenBank accession number HM045005) and Gillingham/2012/UK (GenBank accession number NC_026814) strains from Italy and United Kingdom, respectively, grouping in the genotype c, and finally, forming the genotype d, HUN/2012/115 (GenBank accession number KX599351), HUN/2012/126 (GenBank accession number KX599352) strains from Hungary and GI.E/Dog/ITA/2010/Zoid (GenBank accession number JN193534) strain from Italy. This suggests a distinction of four sub-lineages among the MAstV5 species – MAstV5a to MAstV5d (Fig. 2B).Fig. 2 Evolutionary relationship of MAstV5 with representative MAstV genera. The percentage of replicates in which the associated virus clustered together in the bootstrap test (1000 replicates) is shown next to the branches in each tree. The trees are drawn to scale; bars represent the number of substitutions per site. All positions except ambiguous positions were included. Bootstrap values <50 were excluded. GenBank accession numbers are shown on the tree. MAstV5 sequences obtained in the present study are indicated with a black dot (●). The Kimura 2-parameter substitution model was selected for the MAstV5 ORF2 nucleotide inference, and the LG substitution model (frequencies +F) was used for the amino acid inference. The substitution-rate variation among sites was modeled with a gamma distribution (shape parameter = 5). (A) Evolutionary tree based on the complete amino acid sequences of the ORF2 gene (capsid) of 47 nucleotide sequences of AstVs. (B) Evolutionary tree based on the partial nucleotide sequences of ORF2 from 30 sequences of MAstV5. Discussion Here, in a screening of dog fecal samples, 26% (71/269) of the dogs with and without diarrhea were MAstV5 positive, as determined using RT-PCR. Likewise, non-viral agents and factors such as bacteria, intestinal parasites, malnutrition and intoxications are able to promote enteric disease mainly in the young dog population. The search for other enteric viruses in the MAstV5-positive samples from dogs with gastroenteritis showed that the dogs were also infected with other known pathogens. Moreover, we found that single MAstV5 infection was associated only with the asymptomatic state, although there is a risk that the results will be biased, since the analyzes were conducted on the basis of convenience sampling and we can not exclude the possibility that the long term of viral shedding could be an explanation for the MAstV5-positive samples detected in asymptomatic dogs, based on previous study that demonstrated the comparison between virus load and clinical manifestation26 (Fig. 1 and Table 3). These findings were not unexpected, as mixed infections are common, but more studies will be necessary to real deduce the role of MAstV5 in the cases reported here.15, 16, 17, 18, 19, 20, 21, 22, 23, 24 Several reports of MAstV5 suggest a clinical association of virus molecular detection and diseased dog clinical samples.18, 20, 21, 22, 23, 26, 33 Furthermore, studies of the prevalence of MAstV5 in China showed that 12% (22/183) of the puppies displaying clinical signs of diarrhea were positive for MAstV5, as determined using RT-PCR, compared to none of 138 healthy dogs, although these studies did not look for other viruses that may be associated with diarrhea.19 In a study conducted in Italy, 24% of 110 stool samples collected from dogs with clinical signs tested positive for the presence of MAstV5 RNA, and 9% (10/110) of the samples showed an MAstV5-single infection, although other asymptomatic animals (9% of 75) were also positive for MAstV533. Therefore, the association with clinical signs and the shedding of the virus was described only in a case study of 2 animals, which is apparently an isolated case.26 A prevalence study in France found that 21% (66/316) of the puppies in 42% (14/33) of the breeding kennels surveyed were MAstV5 positive, as determined using RT-PCR.21 In the same report, the authors observed that puppies that were less than 7 weeks old were especially susceptible to MAstV5 infection, although a direct association with clinical signs was not possible.21 Lastly, recent studies found a MAstV5 prevalence of 6% in the United Kingdom and an infection rate of 33% in puppies under three months in Japan.22, 23 The partial genomic sequencing and characterization of selected samples revealed a remarkable genetic heterogeneity of MAstV5 of Brazilian origin. Because it was hypothesized that two strains of human AstV with less than 95% identity at the nucleotide level are serologically distinguishable,34 the lower identities (<85%) shown between the capsid gene sequences analyzed here may reflect the need for a novel species classification into four genotypes – MAstV5a to MAstV5d. Additionally, phylogenetic analysis indicated that the four MAstV5 strains reported here represent a lineage that is more closely related to the Chinese strains than to the others strains, based on the high sequence identity (97%) of ORF2, according to the species demarcation criteria established by the ICTV5 (Table 2). In summary, we found 26% MAstV5-positive fecal samples in dogs with or without gastroenteritis. Based on sequence analysis of the partial genome from four MAstV5-positive samples, we proposed a novel species classification into four genotypes – MAstV5a to MAstV5d. More studies are required to understand the biology and attempt the clinical and antigenic implications of astrovirus genotypes in dogs to elucidate the relative veterinary importance of different canine AstV types. Conflicts of interest The authors declare no conflicts of interest. Acknowledgments The authors would like to express their gratitude to the clinical practitioners who generously provided samples for analysis and to the graduate and post-graduate students of the Laboratório de Virologia for their excellent technical support in this work. ==== Refs References 1 Madeley C.R. Cosgrove B.P. Letter: 28 nm particles in faeces in infantile gastroenteritis Lancet 2 7932 1975 451 452 2 De Benedictis P. Schultz-Cherry S. Burnham A. Cattoli G. Astrovirus infections in humans and animals – molecular biology, genetic diversity, and interspecies transmissions Infect Genet Evol 11 7 2011 1529 1544 21843659 3 Jiang B. Monroe S.S. Koonin E.V. Stine S.E. Glass R.I. RNA sequence of astrovirus: distinctive genomic organization and a putative retrovirus-like ribosomal frameshifting signal that directs the viral replicase synthesis Proc Natl Acad Sci U S A 90 22 1993 10539 10543 8248142 4 Monroe S.S. Jiang B. Stine S.E. Koopmans M. Glass R.I. Subgenomic RNA sequence of human astrovirus supports classification of Astroviridae as a new family of RNA viruses J Virol 67 6 1993 3611 3614 8497068 5 Bosch A. Guix S. Krishna N.K. Family Astroviridae King A.M.Q. Lefkowitz E. Adams M.J. Carstens E.B. Virus Taxonomy: Classification and Nomenclature of Viruses (Ninth Report of the International Committee on the Taxonomy of Viruses) 9th ed. 2011 New York 6 Finkbeiner S.R. Li Y. Ruone S. Identification of a novel astrovirus (astrovirus VA1) associated with an outbreak of acute gastroenteritis J Virol 83 20 2009 10836 10839 19706703 7 Lewis D.C. Lightfoot N.F. Cubitt W.D. Wilson S.A. Outbreaks of astrovirus type 1 and rotavirus gastroenteritis in a geriatric in-patient population J Hosp Infect 14 1 1989 9 14 2570110 8 Wunderli W. Meerbach A. Güngör T. Astrovirus infection in hospitalized infants with severe combined immunodeficiency after allogeneic hematopoietic stem cell transplantation PLoS ONE 6 11 2011 e27483 22096580 9 Gallimore C.I. Taylor C. Gennery A.R. Use of a heminested reverse transcriptase PCR assay for detection of astrovirus in environmental swabs from an outbreak of gastroenteritis in a pediatric primary immunodeficiency unit J Clin Microbiol 43 8 2005 3890 3894 16081927 10 Fu Y. Pan M. Wang X. Complete sequence of a duck astrovirus associated with fatal hepatitis in ducklings J Gen Virol 90 5 2009 1104 1108 19264607 11 Imada T. Yamaguchi S. Mase M. Tsukamoto K. Kubo M. Morooka A. Avian nephritis virus (ANV) as a new member of the family Astroviridae and construction of infectious ANV cDNA J Virol 74 18 2000 8487 8493 10954549 12 Biđin M. Lojkić I. Tišljar M. Biđin Z. Majnarić D. Astroviruses associated with stunting and pre-hatching mortality in duck and goose embryos Avian Pathol 41 1 2012 91 97 22845326 13 Blomström A.L. Widén F. Hammer A.S. Belák S. Berg M. Detection of a novel astrovirus in brain tissue of mink suffering from shaking mink syndrome by use of viral metagenomics J Clin Microbiol 48 12 2010 4392 4396 20926705 14 Bouzalas I.G. Wuthrich D. Walland J. Neurotropic astrovirus in cattle with nonsuppurative encephalitis in Europe J Clin Microbiol 52 9 2014 3318 3324 24989603 15 Williams F.P. Astrovirus-like, coronavirus-like, and parvovirus-like particles detected in the diarrheal stools of beagle pups Arch Virol 66 3 1980 215 226 6778459 16 Vieler E. Herbst W. Electron microscopic demonstration of viruses in feces of dogs with diarrhea Tierarztl Prax 23 1 1995 66 69 7792778 17 Marshall J.A. Healey D.S. Studdert M.J. Viruses and virus-like particles in the faeces of dogs with and without diarrhoea Aust Vet J 61 2 1984 33 38 6329156 18 Toffan A. Jonassen C.M. De Battisti C. Genetic characterization of a new astrovirus detected in dogs suffering from diarrhoea Vet Microbiol 139 1–2 2009 147 152 19477085 19 Zhu a L. Zhao W. Yin H. Isolation and characterization of canine astrovirus in China Arch Virol 156 9 2011 1671 1675 21604183 20 Castro T.X. Cubel Garcia R.C.N. Costa E.M. Leal R.M. Xavier M.D.P.T. Leite J.P.G. Molecular characterisation of calicivirus and astrovirus in puppies with enteritis Vet Rec 172 21 2013 557 21 Grellet A. De Battisti C. Feugier A. Prevalence and risk factors of astrovirus infection in puppies from French breeding kennels Vet Microbiol 157 1–2 2012 214 219 22304762 22 Caddy S.L. Goodfellow I. Complete genome sequence of canine astrovirus with molecular and epidemiological characterization of UK strains Vet Microbiol 177 1–2 2015 206 213 25818578 23 Takano T. Takashina M. Doki T. Hohdatsu T. Detection of canine astrovirus in dogs with diarrhea in Japan Arch Virol 160 6 2015 1549 1553 25824600 24 Choi S. Lim S.-I. Kim Y.K. Cho Y.-Y. Song J.-Y. An D.-J. Phylogenetic analysis of astrovirus and kobuvirus in Korean dogs J Vet Med Sci 76 8 2014 1141 1145 24784439 25 Mihalov-Kovács E. Martella V. Lanave G. Genome analysis of canine astroviruses reveals genetic heterogeneity and suggests possible inter-species transmission Virus Res 2016 26 Martella V. Moschidou P. Catella C. Enteric disease in dogs naturally infected by a novel canine astrovirus J Clin Microbiol 50 3 2012 1066 1069 22189118 27 Boom R. Sol C.J. Salimans M.M. Jansen C.L. Wertheim-van Dillen P.M. van der Noordaa J. Rapid and simple method for purification of nucleic acids J Clin Microbiol 28 3 1990 495 503 1691208 28 Chu D.K.W. Poon L.L.M. Guan Y. Peiris J.S.M. Novel astroviruses in insectivorous bats J Virol 82 18 2008 9107 9114 18550669 29 Tamura K. Stecher G. Peterson D. Filipski A. Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0 Mol Biol Evol 30 2013 2725 2729 24132122 30 Untergasser A. Nijveen H. Rao X. Bisseling T. Geurts R. Leunissen J.a.M. Primer3 Plus, an enhanced web interface to Primer3 Nucleic Acids Res 35 2007 W71 W74 17485472 31 Gontang E.A. Fenical W. Jensen P.R. Phylogenetic diversity of Gram-positive bacteria cultured from marine sediments Appl Environ Microbiol 73 10 2007 3272 3282 17400789 32 Burland T.G. DNASTAR's Lasergene sequence analysis software Methods Mol Biol 132 2000 71 91 10547832 33 Martella V. Moschidou P. Lorusso E. Detection and characterization of canine astroviruses J Gen Virol 92 Pt 8 2011 1880 1887 21471316 34 Walter J.E. Briggs J. Guerrero M.L. Molecular characterization of a novel recombinant strain of human astrovirus associated with gastroenteritis in children Arch Virol 146 12 2001 2357 2367 11811685 35 Buonavoglia C. Martella V. Pratella A. Evidence for evolution of canine parvovirus type 2 in Italy J Gen Virol 82 12 2001 3021 3025 11714979 36 Linné T. Differences in the E3 regions of the canine adenovirus type 1 and type 2 Virus Res 23 1992 119 133 1534956 37 Herrewegh A.A.P.M. Smeenk I. Horzinek M.C. Rottier P.J.M. De Groot R.J. Feline coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination between feline coronavirus type I and canine coronavirus J Virol 72 1998 4508 4514 9557750 38 Gouvea V. Glass R.I. Woods P. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens J Clin Microbiol 28 1990 276 282 2155916 39 Castilho J.G. Brandão P.E. Carnieli P. Molecular analysis of the N gene of canine distemper virus in dogs in Brazil Arq Bras Med Vet Zootec 59 2007 654 659 40 Frisk A.L. König M. Moritz A. Baumgärtner W. Detection of canine distemper virus nucleoprotein RNA by reverse transcription-PCR using serum, whole blood, and cerebrospinal fluid from dogs with distemper J Clin Microbiol 37 1999 3634 3643 10523566