==== Front J Insect Sci J Insect Sci jis Journal of Insect Science 1536-2442 Oxford University Press US 10.1093/jisesa/iead043 iead043 Research AcademicSubjects/SCI01382 A C-type lectin in saliva of Aedes albopictus (Diptera: Culicidae) bind and agglutinate microorganisms with broad spectrum https://orcid.org/0000-0003-3409-1513 Lin Zimin The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Parasitology, Guizhou Medical University, Guiyang 550025, China Cheng Jinzhi The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Parasitology, Guizhou Medical University, Guiyang 550025, China Mu Xiaohui The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Parasitology, Guizhou Medical University, Guiyang 550025, China Kuang Xiaoyuan The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Parasitology, Guizhou Medical University, Guiyang 550025, China https://orcid.org/0000-0002-6054-3117 Li Zhiqiang The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Immunology, Guizhou Medical University, Guiyang 550025, China Wu Jiahong The Key and Characteristic Laboratory of Modern Pathogen Biology, College of Basic Medicine, Guizhou Medical University, Guiyang 550025, China Department of Parasitology, Guizhou Medical University, Guiyang 550025, China Yu Xiao-Qiang Subject Editor Corresponding author, mail: jiahongw@gmc.edu.cn These authors contributed equally to this work. 7 2023 03 7 2023 03 7 2023 23 4 122 11 2022 04 4 2023 28 5 2023 © The Author(s) 2023. Published by Oxford University Press on behalf of Entomological Society of America. 2023 https://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Via complex salivary mixture, mosquitos can intervene immune response and be helpful to transmit several viruses causing deadly human diseases. Some C-type lectins (CTLs) of mosquito have been reported to be pattern recognition receptor to either resist or promote pathogen invading. Here, we investigated the expression profile and agglutination function of an Aedes albopictus CTL (Aalb_CTL2) carrying a single carbohydrate-recognition domain (CRD) and WND/KPD motifs. The results showed that Aalb_CTL2 was found to be specifically expressed in mosquito saliva gland and its expression was not induced by blood-feeding. The recombinant Aalb_CTL2 (rAalb_CTL2) could agglutinate mouse erythrocytes in the presence of calcium and the agglutinating activity could be inhibited by EDTA. rAalb_CTL2 also displayed the sugar binding ability to D-mannose, D-galactose, D-glucose, and maltose. Furthermore, it was demonstrated that rAalb_CTL2 could bind and agglutinate Gram positive bacteria Staphylococcus aureus and Bacillus subtilis, Gram negative bacteria Escherichia coli and Pseudomonas aeruginosa, as well as fungus Candida albicans in vitro in a calcium dependent manner. However, rAalb_CTL2 could not promote type 2 dengue virus (DENV-2) replication in THP-1 and BHK-21 cell lines. These findings uncover that Aalb_CTL2 might be involved in the innate immunity of mosquito to resist microorganism multiplication in sugar and blood meals to help mosquito survive in the varied natural environment. C-type lectin agglutinating activity Aedes albopictus saliva mosquito innate immunity National Natural Science Foundation of China 10.13039/501100001809 81971972 81060138 Science and Technology Cooperation Program of Guizhou Province (2015)7355 ==== Body pmcIntroduction The C-type lectins (CTLs), a Ca2+-dependent super family of proteins, have 1 or more carbohydrate recognition domains (CRD) and can regulate a diverse physiological function. According to their phylogeny and function, they are classified into 17 subgroups. Most CTLs contain only 1 carbohydrate recognition domain, which indicates that they can specifically bind to mannose, galactose, glucose, and other sugars (Zelensky and Gready 2005, Brown et al. 2018). According to the characteristics of CRD and carbohydrate binding ability, the classical CTLs include mannose specificity with EPN (Glu-Pro-Asn) motif and galactose specificity with QPD (Gln-Pro-Asp) motif (Zelensky and Gready 2005). In vertebrate, as 1 of the pattern recognition receptors (PRRs), CTLs can recognize pathogen-associated molecular patterns (PAMP) such as lipopolysaccharide (LPS), peptidoglycan (PGN), and flagellin, leading to trigger downstream immune responses (Zhu et al. 2013), which are essential in phagocytosis, agglutination, encapsulation, melanization, and prophenoloxidase activation (Wang et al. 2009a, 2009b, 2011, Zhao et al. 2009). At present, many CTLs have been predicted in the genome of mosquito. A total of 52 CTLs have been predicted in Aedes aegypti, 55 in Culex quinquefasdatus, and 25 in Anopheles gambiae (Christophides et al. 2002, Bartholomay et al. 2010, Adelman and Myles 2018). Different CTLs have been implicated diverse physiological functions. An Ae. aegypti C-type lectin CLSP2, is demonstrated to restrain hemolymph melanization by inhibiting the activation of prophenoloxidase (PPO) (Shin et al. 2011). AsCTLGA5, a C-type lectin from Armigeres subalbatus, can significantly reduce the infection of E. coli (Shi et al. 2014). Two C-type lectins (CTL4 and CTLMA2) in An. gambiae can resist gram-negative bacteria (Osta et al. 2004, Schnitger et al. 2009, Simões et al. 2022). However, some researches have also demonstrated that some CTLs can facilitate virus infection. In Ae. aegypti CTLs, mosGCTL-1 can interact with West Nile virus to promote virus infection, and mosGCTL-3 can contribute to Dengue virus (DENV) infection(Cheng et al. 2010, Liu et al. 2014). Previous studies have shown that the salivary proteins of mosquito have multiple functions such as inhibiting blood coagulation, anti-inflammatory reaction, and promoting pathogen transmission (Calvo et al. 2011, Kaczmarek et al. 2020, Martin-Martin et al. 2020). With the rapid development of genomics and proteomics technology, a variety of mosquito salivary gland cDNA libraries have been constructed (Valenzuela et al. 2003, Calvo et al. 2004, 2007, 2010, Ribeiro et al. 2004, 2007, Arcà et al. 2005), which make it possible and easy to study the function of saliva proteins. Arcà (Arcà et al. 2007) constructed the salivary gland cDNA library of Ae. albopictus in 2007 and identified only 2 CTLs genes named as Aalb_CTL1 and Aalb_CTL2. The rAalb_CTL1 has been proved to be a Ca2+-dependent C-type lectin that can specifically bind to mannose and agglutinate Staphylococcus aureus and Candida albicans (Cheng et al. 2014). However, the function of Aalb_CTL2 is less known. In this study, to investigate the potential functions of Ae. albopictus Aalb_CTL2, we initially cloned and expressed this specifically expressed protein in salivary glands. We found that, in the presence of 40 mM Ca2+, rAalb_CTL2 could exert agglutinative function when co-cultured with mouse erythrocytes, and the agglutination activity could be inhibited by the sugars. And it also agglutinated bacteria and fungi that commonly exist in mosquito saliva. As for the role in mosquito-borne virus DENV-2 transmission, rAalb_CTL2 seems to have no contribution reflected by no effect on DENV-2 replication in THP-1 and BHK-21 cells. All of these suggested that Aalb_CTL2 might be involved in innate immunity to resist microbe infections in mosquito saliva. Materials and Methods Mosquito Maintenance, Microorganisms, Virus, and Cell Lines Ae. albopictus (Guangzhou strain) used in this study were routinely maintained in our lab (Cheng et al. 2014). Gram-positive bacteria: S. aureus (ATCC25923), B. subtilis (ATCC6633), Gram-negative bacteria: E. coli (ATCC25922), P. aeruginosa (ATCC27853), and fungi: C. albicans (ATCC10231) were obtained from the Beijing Institute of Microbiology and Epidemiology and maintained in our laboratory. DENV-2, Baby hamster kidney cell (BHK-21) and human monocytic cell (THP-1) were stored in our laboratory. BHK-21 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, USA) supplemented with 10% FBS, 100 U/ml penicillin, and 100μg/ml streptomycin sulfate at 37°C with 5% CO2. THP-1 cells were passaged in RPMI-1640 medium with 10% heat-inactivated FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin sulfate at 37°C with 5% CO2. Sequence Analysis Aalb_CTL2 gene sequence was obtained from NCBI (https://www.ncbi.nlm.nih.gov/nuccore/AY826069.1). The protein sequences were deduced from the cDNA sequences using the ExPASy program (http://web.expasy.org/translate/). Signal peptide and CRD domain prediction were conducted using SMART software (http://smart.embl-heidelberg.de/). Tissue Distribution and Blood-Feeding Various Time Points Expression Profile of Aalb_CTL2 Tissue samples including salivary glands (SG), mid-guts (MG), and fat bodies (FB) from the sugar-fed adult female mosquitoes at 5 days old were dissected in the normal saline (NS:0.9% NaCl, pH 6.5) and stored in the TRIzol Reagent (Invitrogen, USA) at −80 °C. SGs at different blood-feeding time points were collected as previously described (Cheng et al. 2014). All the samples included 6 biological replicates, each consisted of salivary glands from 6 mosquitoes, midgut, and fat body from 1 mosquito. Total RNA was extracted from SGs, MGs, and FBs of Ae. albopictus according to the TRIzol Reagent manufacturer’s protocols. Genomic DNA was removed and RNA was reversely transcribed to cDNA using RT reagent kit with gDNA Eraser (TaKaRa, #RR047A). Primers listed in Table 1 were used for cloning the mature peptide of Aalb_CTL2 and detecting the expression of Aalb_CTL2 and rsp5 (ribosomal protein 5 gene as an internal control) genes by quantitative real-time PCR (qRT-PCR) (TB Green premix Ex TaqⅡ, #RR820A). Dissociation curve analysis of amplification products was performed. The expression level of Aalb_CTL2 was evaluated by double standard curves method. Table 1. The primers used in the present study Primer Forward primer (5ʹ–3ʹ) Reverse primer (5ʹ–3ʹ) Product length (bp) Purpose Aalb_CTL2 GACCATATGCAGGAGAAGTGTGATTCACAGAAC CGCCTCGAGCTATTTTTTCTTTCTCTCACACACG 411 cloning Aalb_CTL2 GCTTGCCAGGAGAAGTGTGAT ACTGTTGACCACGGCCAGTT 120 qRT-PCR Rsp5 ATTACATCGCCGTCAAGGAG TCATCATCAGCGAGTTGGTC 126 qRT-PCR E-DENV CAGATCTCTGATGAATAACCAACG CATTCCAAGTGAGAATCTCTTTGTCA 121 qRT-PCR β-actin TGACGTGGACATCCGCAAAG CTGGAAGGTGGACAGCGAGG 205 qRT-PCR The underline means restriction digestion enzyme site. Cloning, Expression, and Purification of Recombinant Aalb_CTL2 Specific primers (see Table 1) for mature peptide of Aalb_CTL2 were designed according to the published sequence (Accession No. AY826069.1). The PCR product was cloned into the pET-28a(+) expression vector by double digest with restriction enzymes NdeⅠ/XhoⅠ(TaKaRa, Japan) and transformed into E.coli BL21 (DE3). Then the positive clones were induced to express using 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) at 37 °C for 5 h in LB medium (200 rpm/min, 37 °C). The cells were harvested by centrifugation at 12,000 rpm for 5 min and sonicated, and the inclusion bodies were resuspended in 1× phosphate-buffered saline (PBS) containing 8M urea. Recombinant Aalb_CTL2 (rAalb_CTL2) protein was refolded using a linear urea solution (contain 6, 5, 4, 3, 2, 1, 0.5, and 0 M) gradient in dialysate at 4 °C overnight. rAalb_CTL2 was purified by His Band Purification Kit (Novagen) according to the manufacturer’s instructions. Purified recombinant protein was dialyzed against 1× PBS buffer at 4 °C overnight and was verified by 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Hemagglutination Assay of rAalb_CTL2 The mouse erythrocytes were collected from mice and prepared to be used after being washed 5 times with normal saline. About 12.5 μl of rAalb_CTL2 with a serial 2-fold dilution from 60 μg/ml to 0.93 μg/ml were mixed with different concentrations (0, 10, 20, 30, 40, 50, 60, 70, 90, 100, 200 mM) of CaCl2 at a final volume of 25 μl. Finally, 25 μl of 2% mouse erythrocytes were added, and the mixture was incubated at 25 °C for 30 min. Hemagglutination of erythrocytes was observed by naked eyes. The assay was performed in triplicate. Sugar Binding Specificity Assay of rAalb_CTL2 Lectins exert the agglutinative function via binding certain sugars. In this assay, 12.5 μl of serial dilutions of various carbohydrates including d-mannose, d-galactose, d-glucose, and maltose (from 1 M to 0.195 mM) in normal saline containing 40 mM of Ca2+ were mixed with 12.5 μl of rAalb_CTL2 (7.5 μg/ml) and incubated at 37 °C for 30 min. Then, 25 μl of 2% mouse erythrocytes suspension were added and incubated at room temperature for 30 min. Finally, an inhibitory effect was evaluated by the minimum sugar concentration that was shown to completely inhibit agglutinating activity of the rAalb_CTL2. This experiment was performed in triplicate independently. Microbial Agglutination Assay of rAalb_CTL2 The microorganisms (S. aureus, B. subtilis, E. coli, P. aeruginosa, and C. albicans) in the mid-logarithmic phase were resuspended in tris-buffered saline (TBS) (with or without 40 mM CaCl2, or EDTA plus 40 mM CaCl2), and stained with 4,6-diamidino-2-phenylindole (DAPI) (Thermofisher, #62248). Then the DAPI-stained microorganisms were incubated with rAalb_CTL2 (50 μg/ml) at room temperature for about 20 min. At last, the microbial agglutination was observed by fluorescence microscopy. Microbial Binding Assay of rAalb_CTL2 The microorganisms (S. aureus, B. subtilis, E. coli, P. aeruginosa, and C. albicans) in the mid-logarithmic phase were suspended in TBS (25 mM Tris–HCl, 137 mM NaCl, and 3 mM KCl, pH7.0) and incubated with rAalb_CTL2 (50 μg/ml) for 20 min at 37 °C. After washing 3 times with TBS, the microorganisms were incubated with rat polyclonal antibody againstrAalb_CTL2 (self-made) for 2 h at room temperature. Then they were washed 3 times with TBS again, and incubated with FITC-labeled anti-rat secondary antibodies (Absin, #CL36131) for 1 h at ambient temperature in the dark. Finally, the microorganisms were stained with DAPI at room temperature for 20 min, the results were imaged by confocal laser scanning microscopy. Detection of Dengue Virus Replication THP-1 cells (2 × 105 cells/well) were seeded in a 48-well plate for 12 h and then incubated with different concentrations (0.01, 0.1, 1 μg/ml) of rAalb_CTL2 mixed with DENV-2 (0.25 MOI) for 24 h. BHK-21 cells (1.25 × 105) were cultured in a 24-well plate for 12 h and were treated with 2 μg/ml rAalb_CTL2 or inactivated rAalb_CTL2 (heat treatment at 100 °C for 15 min) mixed with DENV-2 (2 MOI) for 24 h. Total RNA was isolated and reversely transcribed into cDNA to detect DENV-2 envelope gene expression. qRT-PCR was performed on ABI 7300 as followed: 95 °C for 5 min, 40 cycles of 95 °C for 10 s, 60 °C for 34 s. The target gene messenger RNA levels were normalized to human β-actin RNA levels according to 2−ΔΔCt calculations. The qRT-PCR primers sequences are listed in Table 1. Statistical Analysis Significant difference was determined by the unpaired t-test or one way ANOVA followed by a Tukey’s multiple comparison test (GraphPad, San Diego, CA). The quantification was calculated based on the cycle threshold (Ct) value generated by qRT-PCR. All data obtained is presented as the means ± SD from 3 independent experiments. P values ≤ 0.05 represents significant differences between compared groups. Results The mRNA Expression Pattern of Aalb_CTL2 in Tissues and Different Blood-Feeding Stages The mRNA expression pattern of Aalb_CTL2 in 3 different female mosquito parts was detected using qRT-PCR. The result was shown in Fig. 1. The mRNA level of Aalb_CTL2 was much higher in salivary glands than that in midgut and fat body, indicating Aalb_CTL2 would be an important protein component in mosquito saliva (Fig. 1A). And there was no significant difference in the expression level of Aalb_CTL2 during different blood-feeding stages (Fig. 1B). Fig. 1. mRNA expression pattern of Aalb_CTL2 in tissues and different blood-feeding stages. A) The mRNA levels of Aalb_CTL2 in 5-day-old female Ae. albopictus salivary gland (SG), mid-gut (MG), and fat body (FB) (n = 6). B) The mRNA levels of Aalb_CTL2 in female Ae. albopictus salivary gland at different blood-feeding stages. ***P < 0.001. Sequence Analysis of Aalb_CTL2 The cDNA sequence of Aalb_CTL2 had an open reading frame (ORF) of 456bp encoding 151 amino acids with a 15 amino acid N-terminal signal peptide. The calculated molecular mass of the mature Aalb_CTL2 protein (residues 16 to 151) was 15.71 kDa, with an estimated pI of 9.0. Aalb_CTL2 had a single characteristic CRD domain with 4 conserved Cys residues at position 41,118,138 and 146. There was a Ca2+-binding site known as “WND” (Trp-Asn-Asp) motif and galactose-specific carbohydrate-binding motif “KPD” (Lys-Pro-Asp) (Fig. 2). Fig. 2. ORF and deduced amino acid sequence of Aalb_CTL2. The amino acid sequence is derived from the nucleic acid sequence. The termination codon is indicated by an asterisk (*). The signal peptide sequence is underlined, 4 conservative cysteine residues are marked with gray shading, and the sugar-specific recognition site KPD motif and calcium binding site WND motif are in box. The Recombinant Protein of Aalb_CTL2 To investigate the potential function of Aalb_CTL2, a recombinant plasmid pET-28a-Aalb_CTL2 was constructed and expressed successfully in E.coli BL21 (D3). A distinct band with a molecular weight about 15 kDa was detected by SDS-PAGE (Fig. 3). Fig. 3. Cloning, expression, and purification of recombinant Aalb_CTL2 protein. A) Detection of PCR products and enzyme digestion identification of recombinant plasmid pET-28a-Aalb_CTL2, M: DL 2000 Marker, 1: Aalb_CTL2 PCR amplification product; 2: pET-28a-Aalb_CTL2 after double enzyme digestion; 3: pET-28a-Aalb_CTL2 after single enzyme digestion. B) Expression and purification of rAalb_CTL2 in E. coli BL21(DE3) M: standard protein marker; 4: Total protein before empty plasmid induction; 5: Total protein after induction of empty plasmid; 6: Total protein before induction of recombinant plasmid; 7: Total protein induced by recombinant plasmid; 8: Induced supernatant; 9: Induced deposit; 10: The purified rAalb_CTL2. C) Western blotting identification of rAalb_CTL2, 11: anti-his-tag; M: standard protein marker. Hemagglutination Activity of rAalb_CTL2 As shown in Fig. 4, the hemagglutination activity increased with the addition of different concentrations of rAalb_CTL2 in the presence of Ca2+, which suggests the agglutination activity of rAalb_CTL2 was Ca2+dependent, and the optimal concentration of Ca2+ is 40mM. Fig. 4. Agglutination activity of rAalb_CTL2 on mouse red blood cells at a Ca2+-dependent manner. The mouse erythrocytes were added into 96 V-shape plates and incubated with rAalb_CTL2 and Ca2+ at 25 °C for 30 min. Carbohydrate Binding Specificity of rAalb_CTL2 To detect the carbohydrate binding ability of rAalb_CTL2, we investigated the inhibitory activity of rAalb_CTL2 for sugar binding. As shown in Table 2, in the presence of 40 mM Ca2+, the agglutinating activity of rAalb_CTL2 was inhibited by all 4 types of sugars, d-Glucose, d-Mannose, d-Galactose, and Maltose at ­different concentrations. Based on the minimum inhibitory concentration, the sugar inhibitory activity was evaluated to be Maltose < d-Glucose < d-Galactose < d-Mannose. Table 2. Inhibition of agglutination of Aalb_CTL2 by sugars Sugar Minimum inhibitory concentration (mM) d-Glucose 12.5 d-Mannose 3.125 d-Galactose 6.25 Maltose 25 Microbial Agglutination Capacity of rAalb_CTL2 C-Type lectin can recognize the sugar molecular structure on the surface of bacteria and cause bacterial agglutination. To further investigate whether rAalb_CTL2 could agglutinate bacteria, a microbe agglutinating assay (S. aureus, B. subtilis, E. coli, P. aeroginosa, and C. albicans) was performed. As shown in Fig. 5, rAalb_CTL2 significantly agglutinated all the 5 microbes in the presence of Ca2+. When a calcium-chelating agent EDTA was added, the aggregation of bacteria was inhibited. It indicated that the agglutinating activity of rAalb_CTL2 was at a Ca2+-dependent manner. All the 5 microbes could be agglutinated by rAalb_CTL2 which suggesting that rAalb_CTL2 had a broad agglutinating activity on microbes (Fig. 5). Fig. 5. rAalb_CTL2 induced the agglutination to microbes in a Ca2+ dependent manner. (×40) Nuclei of microorganism was stained by DAPI. Microbial Binding Assay of rAalb_CTL2 To determine how rAalb_CTL2 agglutinated microorganisms, we detected whether the rAalb_CTL2 bound them by Indirect Immunofluorescence Assay (IFA). As we expected, the rAalb_CTL2 could agglutinate all the microorganisms in the presence of Ca2+, and rAalb_CTL2 had binding ability to the surface of the microorganisms. The agglutination of all microorganisms disappeared either with EDTA or without Ca2+, however, rAalb_CTL2 still could bind on the surfaces of S. aureus and C. albicans (Fig. 6). Fig. 6. Analysis of binding affinity with microorganisms of rAalb_CTL2 by IFA. rAalb_CTL2 was identified by rat polyclonal antibodies against rAalb_CTL2 (in green); Nuclei of microorganism was stained by DAPI (in blue). A) The bacteria incubated with rAalb_CTL2. B) The bacteria incubated with rAalb_CTL2 and in the presence of 40 mM Ca2+. C) The bacteria incubated with rAalb_CTL2 and in the presence of 40 mM Ca2+ and EDTA. The agglutinate bacteria were viewed at 20× magnification and others were viewed at 40× magnification. rAalb_CTL2 did not Promote DENV-2 Replication As an important protein component of mosquito saliva, we further investigated the virus replication when THP-1 and BHK-21 cell lines were challenged with DENV-2 alone or the mixture of rAalb_CTL2 and DENV-2. Compared with the DENV-2 alone challenge group, the DENV-2 groups challenging with different concentrations of rAalb_CTL2 showed no significant differences on the mRNA level of E gene in both THP-1 and in BHK-21 cell lines (Fig. 7). Fig. 7. rAalb_CTL2 could not promote DENV-2 replication in THP-1 and BHK-21 cell lines. A) The relative mRNA level of E gene in DENV-2 infected THP-1 cell line with different concentration of rAalb_CTL2 at 24 h (MOI = 0.25, n = 6). B) The relative mRNA level of E gene in DENV-2 infected BHK-21 cell line with 2 μg/ml rAalb_CTL2 and 2 μg/ml inactivated rAalb_CTL2 at 24 h (MOI = 2, n = 6). Discussion CTLs have been identified widely in various insects as a result of whole genome sequencing. In mosquito, as important PRRs, some CTLs have been found to play significant roles in innate immunity against microbes. However, some CTLs have also been found to promote pathogen infection (Xia et al. 2018). Aalb_CTL2 is 1 of only 2 CTLs identified in transcriptome of salivary gland of Ae. albopictus. It has a signal peptide which means it can be secreted into saliva and could enter into host skin with saliva. Therefore, we cloned and expressed rAalb_CTL2, and the possible biological function was investigated in this study. The rAalb_CTL2 could agglutinate mouse erythrocytes at 40 mM CaCl2 and the agglutination activity could be inhibited by EDTA, which indicated rAalb_CTL2 was a typical C-type lectin. It is worth mentioning that the rAalb_CTL2 demonstrated a wide sugar binding spectrum by binding not only galactose but also D-mannose and other sugars, although it had a KPD motif indicating galactose specificity. In fact, many studies have shown the motif of invertebrate CTLs is conservative but not the function (Pees et al. 2016). The C-type lectin PtCLec2 from Portunus trituberculatus with a QPD motif, which is predicted to bind galactose, but has also been shown to bind not only galactose, but also d-mannose and sucrose in vitro (Liu et al. 2021). OmLec1, the C-type lectin of the Onychostoma macrolepis, is predicted to have a mannose-specific binding motif ENP, but can also bind d-glucose, PGN, and LPS (Shang-Guan et al. 2021b). As pattern recognition receptors, an important feature of CTLs is that they can recognize and bind the polysaccharides on the surface of pathogens, which can produce agglutination reaction by binding with glycoconjugates on the cell surface and participate in innate immunity in vivo and in vitro (Wang et al. 2018, Bi et al. 2020, Shang-Guan et al. 2021a). A C-type lectin DL1 has been purified from a pupal extract of Drosophila meianogaster, can agglutinate with E. coli and Erwinia chrysanthemi (Tanji et al. 2006), while the other 2 lectins DL2 and DL3 in Drosophila melanogaster can agglutinate E. coli in the presence of Ca2+(Ao et al. 2007). These results demonstrate that different lectins have different agglutinating activity. In this study, rAalb_CTL2 exhibited a wide microbes agglutinated spectrum, including the gram-positive bacteria (S. aureus and B. subtilis), gram-negative bacteria (E. coli and P. aeruginosa), and fungi (C. albicans). While, rAalb_CTL1, another CTL specifical expressed in female salivary gland of Ae. albopictus, can only agglutinate C. albicans and S. aureus, but not E. coli in vitro (Cheng et al. 2014). The difference of bacteria agglutinating activity might be related to their different carbohydrate binding capacity. Furthermore, we found that rAalb_CTL2 could bind to the surface of microorganisms in the presence of Ca2+, which might indicate that rAalb_CTL2 exert the agglutination function by combining with the surface of bacteria to resist invasion. In addition, it is interesting to find rAalb_CTL2 could still bind S. aureus and C. albicans even without Ca2+ but no agglutination. The similar result has been found in MsIML-2 from M. sexta (Yu and Ma 2006). These results suggest that binding of some insect CTLs to ligands may not require calcium, but calcium binding may facilitate formation of lectin oligomers for agglutination. Of course, the different agglutinating microbial activity of Aalb_CTL1 and Aalb_CTL2 in saliva of Ae. albopictus means that there is a redundant function in mosquito saliva involved in controlling bacterial growth in sugar and blood meal, which help mosquito hosts to live in the environment. As mentioned before, mosquito saliva plays an important role in arthropods-disease transmission, and also some researches demonstrated that some CTLs of mosquito could promote pathogen infection (Liu et al. 2014, Jin et al. 2018, Uraki et al. 2019). Therefore, we examined the effect of rAalb_CTL2 on DENV-2 replication in vitro. The results showed the rAalb_CTL2 could not promote the replication of DENV-2 in THP-1 and BHK-21 cell lines. The similar results have also been found in the rAalb_CTL1 (unpublished data). These results further demonstrated that both of the CTLs in mosquito saliva might mainly contribute to mosquito innate immunity. In conclusion, Aalb_CTL2, a C-type lectin specifically expressed in salivary glands of Ae. albopictus, was cloned and expressed in E. coli. The rAalb_CTL2 demonstrates a typical agglutinating activity of erythrocyte in a calcium dependent manner and has a wide spectrum of sugar binding capacity. More importantly, it cannot promote DENV-2 replication in mammal cell lines but exhibit a broader microorganisms agglutination profile toward Gram-positive bacteria S. aureus, B. subtilis, Gram-negative bacteria E. coli, P. aeroginosa, as well as fungus C. albican in a calcium dependent manner. It is also found that rAalb_CTL2 has binding activity only with S. aureus and C. albican without calcium. The results suggest that Aalb_CTL2, as a PRR, might be involved in the innate immunity of mosquito to resist microorganism multiplication in sugar and blood meal, which helps mosquito to survive in the environment. In addition, our findings also provide new insights into the function of saliva protein in Ae. albopictus. Acknowledgments This research was supported by the National Natural Science Foundation of China (No. 81971972, 81060138) and the Science and Technology Cooperation Program of Guizhou Province [No. (2015)7355]. This work was made possible, by Department of Parasitology and the Lab for Modern Pathogen Biology in Guizhou Medical University. Author Contributions Zimin Lin (Data curation-Equal, Project administration-Equal, Writing – original draft-Equal), JIN ZH CHENG (Data curation-Equal, Project administration-Equal, Writing – original draft-Equal), XIAO H MOU (Data curation-Equal), Xiaoyuan Kuang (Investigation-Equal), Zhiqiang Li (Writing – review & editing-Equal), Jianghong Wu (Funding acquisition-Equal, Resources-Equal) ==== Refs References Adelman ZO , MylesKM. The C-Type lectin domain gene family in Aedes aegypti and their role in arbovirus infection. Viruses. 2018:10 (7 ):367. 10.3390/v10070367 30002303 Ao J , LingE, YuXQ. Drosophila C-type lectins enhance cellular encapsulation. Mol Immunol. 2007:44 (10 ):2541–2548. 10.1016/j.molimm.2006.12.024 17287021 Arcà B , LombardoF, FrancischettiIM, PhamVM, Mestres-SimonM, AndersenJF, RibeiroJM. An insight into the sialome of the adult female mosquito Aedes albopictus. Insect Biochem Mol Biol. 2007:37 (2 ):107–127. 10.1016/j.ibmb.2006.10.007 17244540 Arcà B , LombardoF, ValenzuelaJG, FrancischettiIM, MarinottiO, ColuzziM, RibeiroJM. An updated catalogue of salivary gland transcripts in the adult female mosquito, Anopheles gambiae. J Exp Biol. 2005:208 :3971–3986.16215223 Bartholomay LC , WaterhouseRM, MayhewGF, CampbellCL, MichelK, ZouZ, RamirezJL, DasS, AlvarezK, ArensburgerP, et al . Pathogenomics of Culex quinquefasciatus and meta-analysis of infection responses to diverse pathogens. Science. 2010:330 :88–90.20929811 Bi J , NingM, LiJ, ZhangP, WangL, XuS, ZhongY, WangZ, SongQ, LiB. A C-type lectin with dual-CRD from Tribolium castaneum is induced in response to bacterial challenge. Pest Manag Sci. 2020:76 :3965–3974.32519818 Brown GD , WillmentJA, WhiteheadL. C-type lectins in immunity and homeostasis. Nat Rev Immunol. 2018:18 (6 ):374–389. 10.1038/s41577-018-0004-8 29581532 Calvo E , AndersenJ, FrancischettiIM, deL CapurroM, deBianchiAG, JamesAA, RibeiroJM, MarinottiO. The transcriptome of adult female Anopheles darlingi salivary glands. Insect Mol Biol. 2004:13 (1 ):73–88. 10.1111/j.1365-2583.2004.00463.x 14728669 Calvo E , DaoA, PhamVM, RibeiroJM. An insight into the sialome of Anopheles funestus reveals an emerging pattern in anopheline salivary protein families. Insect Biochem Mol Biol. 2007:37 (2 ):164–175. 10.1016/j.ibmb.2006.11.005 17244545 Calvo E , MizuriniDM, Sá-NunesA, RibeiroJM, AndersenJF, MansBJ, MonteiroRQ, KotsyfakisM, FrancischettiIM. Alboserpin, a factor Xa inhibitor from the mosquito vector of yellow fever, binds heparin and membrane phospholipids and exhibits antithrombotic activity. J Biol Chem. 2011:286 (32 ):27998–28010. 10.1074/jbc.m111.247924 21673107 Calvo E , Sanchez-VargasI, FavreauAJ, BarbianKD, PhamVM, OlsonKE, RibeiroJM. An insight into the sialotranscriptome of the West Nile mosquito vector, Culex tarsalis. BMC Genomics. 2010:11 :51. 10.1186/1471-2164-11-51 20089177 Cheng G , CoxJ, WangP, KrishnanMN, DaiJ, QianF, AndersonJF, FikrigE. A C-type lectin collaborates with a CD45 phosphatase homolog to facilitate West Nile virus infection of mosquitoes. Cell. 2010:142 (5 ):714–725. 10.1016/j.cell.2010.07.038 20797779 Cheng J , WangY, LiF, LiuJ, SunY, WuJ. Cloning and characterization of a mannose binding C-type lectin gene from salivary gland of Aedes albopictus. Parasit Vectors. 2014:7 :337. 10.1186/1756-3305-7-337 25051984 Christophides GK , ZdobnovE, Barillas-MuryC, BirneyE, BlandinS, BlassC, BreyPT, CollinsFH, DanielliA, DimopoulosG, et al . Immunity-related genes and gene families in Anopheles gambiae. Science. 2002:298 (5591 ):159–165. 10.1126/science.1077136 12364793 Jin L , GuoX, ShenC, HaoX, SunP, LiP, XuT, HuC, RoseO, ZhouH, et al . Salivary factor LTRIN from Aedes aegypti facilitates the transmission of Zika virus by interfering with the lymphotoxin-β receptor. Nat Immunol. 2018:19 (4 ):342–353. 10.1038/s41590-018-0063-9 29507355 Kaczmarek ME , HerzogNL, NovalMG, ZuzworskyJ, ShahZ, BajwaWI, StaplefordKA. Distinct New York City Aedes albopictus mosquito populations display differences in salivary gland protein D7 diversity and chikungunya virus replication. Viruses. 2020:12 (7 ):698. 10.3390/v12070698 32605312 Liu Y , SuY, ZhangA, CuiZ. A C-type lectin highly expressed in portunus trituberculatus intestine functions in AMP regulation and prophenoloxidase activation. Antibiotics (Basel). 2021:10 (5 ):541. 10.3390/antibiotics10050541 34066980 Liu Y , ZhangF, LiuJ, XiaoX, ZhangS, QinC, XiangY, WangP, ChengG. Transmission-blocking antibodies against mosquito C-type lectins for dengue prevention. PLoS Pathog. 2014:10 (2 ):e1003931. 10.1371/journal.ppat.1003931 24550728 Martin-Martin I , SmithLB, ChagasAC, Sá-NunesA, ShrivastavaG, Valenzuela-LeonPC, CalvoE. Aedes albopictus D7 salivary protein prevents host hemostasis and inflammation. Biomolecules. 2020:10 :1372.32992542 Osta MA , ChristophidesG, Fau – KafatosFC, KafatosFC. Effects of mosquito genes on Plasmodium development. Science. 2004:303 :2030–2032.15044804 Pees B , YangW, Zárate-PotesA, SchulenburgH, DierkingK. High innate immune specificity through diversified C-type lectin-like domain proteins in invertebrates. J Innate Immun. 2016:8 :129–142.26580547 Ribeiro JM , ArcàB, LombardoF, CalvoE, PhanVM, ChandraPK, WikelSK. An annotated catalogue of salivary gland transcripts in the adult female mosquito, Aedes aegypti. BMC Genomics. 2007:8 :6.17204158 Ribeiro JM , CharlabR, PhamVM, GarfieldM, ValenzuelaJG. An insight into the salivary transcriptome and proteome of the adult female mosquito Culex pipiens quinquefasciatus. Insect Biochem Mol Biol. 2004:34 :543–563.15147756 Schnitger AK , YassineH, KafatosFC, OstaMA. Two C-type lectins cooperate to defend Anopheles gambiae against Gram-negative bacteria. J Biol Chem. 2009:284 :17616–17624.19380589 Shang-Guan XY , CaiYJ, XuHZ, ChengX, ZhangRF, LiuHX. A C-type lectin with a single CRD from Onychostoma macrolepis mediates immune recognition against bacterial challenge. Fish Shellfish Immunol. 2021a:115 :160–170. 10.1016/j.fsi.2021.06.007 34147614 Shang-Guan XY , XuHZ, ChengX, ZhangRF, LuYT, LiuHX. A C-type lectin (OmCTL) in Onychostoma macrolepis: binding ability to LPS, PGN and agglutinating activity against bacteria. Mol Immunol. 2021b:132 :21–29. 10.1016/j.molimm.2021.01.021 33524771 Shi XZ , KangCJ, WangSJ, ZhongX, BeerntsenBT, YuXQ. Functions of Armigeres subalbatus C-type lectins in innate immunity. Insect Biochem Mol Biol. 2014:52 :102–114. 10.1016/j.ibmb.2014.06.010 25014898 Shin SW , ZouZ, RaikhelAS. A new factor in the Aedes aegypti immune response: CLSP2 modulates melanization. EMBO Rep. 2011:12 :938–943.21760616 Simões ML , DongY, MlamboG, DimopoulosG. C-type lectin 4 regulates broad-spectrum melanization-based refractoriness to malaria parasites. PLoS Biol. 2022:20 :e3001515.35025886 Tanji T , Ohashi-KobayashiA, NatoriS. Participation of a galactose-specific C-type lectin in Drosophila immunity. Biochem J. 2006:396 :127–138.16475980 Uraki R , HastingsAK, Marin-LopezA, SumidaT, TakahashiT, GroverJR, IwasakiA, HaflerDA, MontgomeryRR, FikrigE. Aedes aegypti AgBR1 antibodies modulate early Zika virus infection of mice. Nat Microbiol. 2019:4 (6 ):948–955. 10.1038/s41564-019-0385-x 30858571 Valenzuela JG , FrancischettiIM, PhamVM, GarfieldMK, RibeiroJM. Exploring the salivary gland transcriptome and proteome of the Anopheles stephensi mosquito. Insect Biochem Mol Biol. 2003:33 (7 ):717–732. 10.1016/s0965-1748(03)00067-5 12826099 Wang W , SongX, WangL, SongL. Pathogen-derived carbohydrate recognition in molluscs immune defense. Int J Mol Sci. 2018:19 (3 ):721. 10.3390/ijms19030721 29510476 Wang XW , XuWT, ZhangXW, ZhaoXF, YuXQ, WangJX. A C-type lectin is involved in the innate immune response of Chinese white shrimp. Fish Shellfish Immunol. 2009a:27 :556–562.19647083 Wang XW , ZhangHW, LiX, ZhaoXF, WangJX. Characterization of a C-type lectin (PcLec2) as an upstream detector in the prophenoloxidase activating system of red swamp crayfish. Fish Shellfish Immunol. 2011:30 :241–247.21059394 Wang XW , ZhangXW, XuWT, ZhaoXF, WangJX. A novel C-type lectin (FcLec4) facilitates the clearance of Vibrio anguillarum in vivo in Chinese white shrimp. Dev Comp Immunol. 2009b:33 :1039–1047.19447130 Xia XF , YouMS, RaoXJ, YuXQ. Insect C-type lectin in innate immunity. Dev Comp Immunol. 2018:83 :70–79. 10.1016/j.dci.2017.11.020 29198776 Yu XQ , MaY. Calcium is not required for immulectin-2 binding, but protects the protein from proteinase digestion. Insect Biochem Mol Biol. 2006:36 (6 ):505–516. 10.1016/j.ibmb.2006.03.010 16731346 Zelensky AN , GreadyJE. The C-type lectin-like domain superfamily. FEBS J. 2005:272 (24 ):6179–6217. 10.1111/j.1742-4658.2005.05031.x 16336259 Zhao ZY , YinZX, XuXP, WengSP, RaoXY, DaiZX, LuoYW, YangG, LiZS, GuanHJ, et al . A novel C-type lectin from the shrimp Litopenaeus vannamei possesses anti-white spot syndrome virus activity. J Virol. 2009:83 (1 ):347–356. 10.1128/JVI.00707-08 18945787 Zhu LY , NieL, ZhuG, XiangLX, ShaoJZ. Advances in research of fish immune-relevant genes: a comparative overview of innate and adaptive immunity in teleosts. Dev Comp Immunol. 2013:39 (1-2 ):39–62. 10.1016/j.dci.2012.04.001 22504163