==== Front BMC Genomics BMC Genomics BMC Genomics 1471-2164 BioMed Central London 9467 10.1186/s12864-023-09467-2 Research RGS4 impacts carbohydrate and siderophore metabolism in Trichoderma reesei Schalamun Miriam miriam.schalamun@ait.ac.at 1 Molin Eva Maria eva-maria.molin@ait.ac.at 1 Schmoll Monika monika.schmoll@univie.ac.at 12 1 grid.4332.6 0000 0000 9799 7097 AIT Austrian Institute of Technology GmbH, Bioresources Unit, Center for Health & Bioresources, Konrad Lorenz Strasse 24, Tulln, 3430 Austria 2 grid.10420.37 0000 0001 2286 1424 Division of Terrestrial Ecosystem Research, Centre of Microbiology and Ecosystem Science, University of Vienna, Djerassiplatz 1, Vienna, 1030 Austria 3 7 2023 3 7 2023 2023 24 37215 12 2022 20 6 2023 © The Author(s) 2023 https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Background Adaptation to complex, rapidly changing environments is crucial for evolutionary success of fungi. The heterotrimeric G-protein pathway belongs to the most important signaling cascades applied for this task. In Trichoderma reesei, enzyme production, growth and secondary metabolism are among the physiological traits influenced by the G-protein pathway in a light dependent manner. Results Here, we investigated the function of the SNX/H-type regulator of G-protein signaling (RGS) protein RGS4 of T. reesei. We show that RGS4 is involved in regulation of cellulase production, growth, asexual development and oxidative stress response in darkness as well as in osmotic stress response in the presence of sodium chloride, particularly in light. Transcriptome analysis revealed regulation of several ribosomal genes, six genes mutated in RutC30 as well as several genes encoding transcription factors and transporters. Importantly, RGS4 positively regulates the siderophore cluster responsible for fusarinine C biosynthesis in light. The respective deletion mutant shows altered growth on nutrient sources related to siderophore production such as ornithine or proline in a BIOLOG phenotype microarray assay. Additionally, growth on storage carbohydrates as well as several intermediates of the D-galactose and D-arabinose catabolic pathway is decreased, predominantly in light. Conclusions We conclude that RGS4 mainly operates in light and targets plant cell wall degradation, siderophore production and storage compound metabolism in T. reesei. Supplementary Information The online version contains supplementary material available at 10.1186/s12864-023-09467-2. Keywords Trichoderma reesei Hypocrea jecorina Regulator of G-protein signaling Cellulase Nutrient sensing Light response Storage carbohydrates Iron homeostasis Siderophore Austrian Science Fund (FWF)Open access funding provided by Austrian Science Fund (FWF). issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2023 ==== Body pmcBackground Fungi have to adapt to their environment to survive and succeed in competition. Such environmental cues might be the available nutrients, light, defense against competitors or finding a mating partner. Therefore, complex sensing and signaling pathways exist, one of the most important one being heterotrimeric G-protein signaling [1], which profoundly impacts physiological reactions and adaptation to the environment of fungi, from growth and reproduction to secondary metabolism and pathogenicity [2, 3]. The steps of signal transmission from sensing at the plasma membrane to the actual output in terms of enzyme or secondary metabolite production, growth or accumulation of storage compounds and other physiological adaptations are complex and integrate reactions to multiple environmental cues. Thereby, the individual connections from receptors to transmitters to kinases and ultimately transcription factors are only known for very few pathways and mostly only in one model organism. Especially the contributions of RNA- and protein stability, posttranscriptional and posttranslational regulations are often difficult to interpret and integrate into a mechanistic model. The filamentous ascomycete Trichoderma reesei [4, 5] is among the most prolific producers of homologous and heterologous enzymes, especially plant cell wall degrading carbohydrate active enzymes (CAZys), and performance proteins in industry [6, 7]. Recent genome sequencing efforts of the prototypical wild-type QM6a yielded a complete high quality genome [8, 9] and evolutionary analyses revealed an unexpectedly high proportion of CAZyme genes to be acquired to Trichoderma through horizontal gene transfer (HGT) [10, 11]. T. reesei has become a model organism for plant cell wall degradation in fungi [4, 12], but also for light modulated substrate degradation and enzyme production [13, 14]. The latter phenomenon was investigated in detail in T. reesei and connections of light response to the heterotrimeric G-protein pathway, growth, sexual development [15] and secondary metabolism were detected [13, 16, 17]. The light response pathway of T. reesei comprises the photoreceptors BLR1 and BLR2, which represent GATA-type transcription factors as well as ENV1, a PAS/LOV domain protein [18, 19]. To achieve its widespread impacts on fungal physiology, diverse signaling pathways are integrated with light response, which involves influences on epigenetic events, posttranscriptional and posttranslational modifications (especially phosphorylation) and protein stability [20, 21]. The function of the G-protein pathway in enzyme biosynthesis was shown to be light dependent [13], which is in agreement with the crucial function of numerous protein kinases, including the cAMP dependent protein kinase A, in light response [22, 23]. The nodes of interaction between the light response pathway and nutrient- and mating partner sensing by the G-protein pathway are still under investigation, although the phosducin-like protein PhLP1 and adenylate cyclase [24] were proposed to play a role in signal integration. As in most ascomycetes, the G-protein complex in T. reesei consists of three alpha-, one beta- and one gamma-subunit [25]. Upon binding of a ligand to a G-protein coupled receptor (GPCRs) the confirmation of the heterotrimeric G-protein complex changes and G-alpha bound GDP is exchanged to GTP [26]. The activated G-proteins dissociate, leading to a free alpha subunit and beta-gamma complex which are now able to transmit downstream signals. The intrinsic GTPase activity of the G-alpha subunits causes GTP hydrolysis to GDP and reassociation of the complex and termination of signal [27, 28]. Regulator of G-protein signaling (RGS) proteins modulate the activity of the heterotrimeric G-protein pathway by accelerating the GTPase activity of the G-alpha subunits [29, 30]. This GTPase activity leads to deactivation of the G-alpha subunit and hence to termination of the transmitted signal [30–32]. RGS proteins are typically regulated at the level of transcription, epigenetic regulation, expression, localization and stability, but not through binding of a ligand. Thereby, phosphorylation by protein kinase A influences localization and stability of RGS proteins. Additionally, feedback mechanisms due to interactions of RGS proteins with their regulating transcription factors are proposed [33]. Besides the impact of RGS proteins on G-alpha subunits, also functions outside this pathway, including activation of MAPkinase signaling are known [34]. In T. reesei, the G-protein signaling cascade is well described with respect to its role in enzyme production with characterizations of the G-alpha, -beta and -gamma subunits and a few GPCRs [35–40]. Additionally, G-protein mediated signaling involves more regulators such as GTPase activating proteins, phosducins and other proteins fine-tuning this pathway [41]. The genome of T. reesei comprises seven RGS domain containing proteins, of which four represent RGS proteins and three proteins are related to RGS-domain containing GprK-type GPCRs [42]. All RGS proteins of T. reesei contain a RGS box (130 amino acid motif; IPR016137) which is important for G-alpha binding [41]. Generally, the functions of RGS proteins in fungi range from pheromone response, growth and sporulation, pathogenicity [43, 44] and toxin production [45] to nematode trapping by Athrobotrys [46]. Due to their central functions in the physiology of fungi, they emerged also as important drug targets [47]. T. reesei RGS4 is related to Aspergillus fumigatus RgsC which is involved in vegetative growth and development, stress tolerance and virulence [48]. The A. fumigatus rgsC deletion mutant shows significantly decreased conidiophore formation and slower colony growth on plates but elevated spore germination on different carbon sources suggesting an involvement in the control of the cAMP/PKA pathway as well as a decreased tolerance to oxidative stress [48]. The down-regulation of gliotoxin (GT) genes and decreased GT production in A. fumigatus in mutants lacking rgsC might be due to the regulation of a global secondary metabolite regulator LaeA by RgsC [48]. In this study, we aimed to gain insight into the network of nutrient sensing and light response in T. reesei. Therefore, we investigated the role of RGS4, as a potential modulator of the activity of one or more of the three G-alpha subunits of T. reesei. We show here, that RGS4 impacts the physiology of T. reesei on multiple levels and that its major function occurs in light. RGS4 supports cellulase production, contributes to regulation of growth on several carbon sources and importantly it is required for proper gene regulation targeting iron homeostasis in light. Results T. reesei RGS4 is a typical member of the SNX/H group of RGS proteins In T. reesei RGS4 (TrG0496W/TR_65607) is the homolog to A. nidulans RgsC and similar to other fungal proteins of this group (Additional file 1, Figure S1). The protein RGS4 contains two transmembrane regions (297–314 and 321–343 aa), a RGS domain (703–843 aa, E-value: 1.65e-19), a coiled coil (1108–1146 aa) and a PhoX homologous (PX) domain (1156–1269 aa, E-value 8.55e-25). This domain structure identifies RGS4 as a member of the subfamily of SNX/H RGS proteins [49]. If the Gs-alpha specificity is conserved in fungi, it is likely specific to the G-alpha s subunit GNA3 of T. reesei [37]. Hence, deletion of RGS4 may lead to enhanced or prolonged activation of GNA3. Checking available transcriptome data showed that rgs4 is not significantly regulated in response to light, different carbon sources or during mating [24, 40, 50–52]. The regulation mechanism via phosphorylation is reflected in the amino acid sequence of RGS4 in that it comprises numerous protein kinase C (PKC) and casein kinase II (CKII) phosphorylation sites, both of which are associated also with light response processes [22, 53, 54]. The presence of four cAMP dependent protein kinase A (PKA) sites supports a potential connection to light signaling, since PKA is known as a priming kinase for casein kinase phosphorylation associated with light response [23]. RGS4 comprises three overlapping sites for PKA and CKII, which suggests a function of PKA as a priming kinase with RGS4, since PKA showed a light dependent function in cellulase regulation as well as generally in gene regulation also in T. reesei [55, 56]. However, this connection remains to be confirmed. RGS4 has its main function in light and is required for proper growth on glucose We deleted rgs4 in the QM6a wild-type background, which resulted in viable deletion strains. G-protein signaling influences growth and the transmission of a cellulose related signal which is received via the class XIII GPCRs CSG1 and CSG2 and regulated by light in T. reesei [35]. Therefore, we analyzed hyphal apical extension rates of Δrgs4 on rich medium (3% malt extract, MEX) versus minimal medium (MA-medium) complemented with carboxymethyl cellulose (CMC) or glucose as the carbon source in constant light and constant darkness (Fig. 1). On malt extract we did not see any difference (Fig. 1A – C), whereas the deletion of rgs4 led to a significantly decreased colony size on cellulose and glucose in light. In darkness, a small decrease (to 90%) in apical extension of Δrgs4 was detected. In light, colony sizes reached 70 to 80% of the wildtype on glucose or cellulose, respectively (Fig. 1D, E).Fig. 1 Influence of RGS4 on growth and asexual development. A-E Hyphal extension of wild-type (QM6a) and Δrgs4 on 3% malt extract (MEX) and Mandels-Adreotti minimal (MA) medium with 1% glucose and 1% carboxymethyl cellulose (CMC) as carbon source after 48 h in constant darkness (DD) and constant light (LL; 1700 lx). F Average sporulation measured after 48 h at 28 °C in DD and LL on 3% MEX. Measurements were taken from 3 biological replicates and statistical significance was calculated for the respective light condition (DD or LL) between WT and mutant using Student’s T-test. * = p-value < 0.05, ** = p-value < 0.01) RGS4 is involved in regulation of asexual development It is well known that the cAMP and the heterotrimeric G-protein pathway play a crucial role in sporulation in fungi [57, 58]. In T. reesei QM6a sporulation is enhanced in light compared to dark grown cultures. We found that deletion of rgs4 led to significantly decreased sporulation in light (Fig. 1F), whereas, in darkness, a negative trend was observed. We conclude that RGS4 is required for normal sporulation in T. reesei. RGS4 is required for proper stress response For the RGS4 homologue in A. fumigatus, RgsC, hypersensitivity to oxidative stress on menadione, a natural organic compound that exerts its toxicity through the generation of reactive oxygen species (ROS), and reduced tolerance to the presence of H2O2 or paraquat was shown [48]. Therefore, we were interested in the role of RGS4 in oxidative stress response in T. reesei and found a significant decrease (p < 0.05) in resistance to menadione. In Δrgs4 the hyphal apical extension was significantly decreased in light and darkness compared to wild-type after 96 h on MA-CMC plates supplemented with 0.25 mM menadione (Fig. 2A). Since the control without menadione (Fig. 1D) did not show a significant growth defect under these conditions in darkness, RGS4 is concluded to contribute to resistance against oxidative stress in darkness. In light, the growth defect of Δrgs4 upon growth in the presence of menadione is in the range of the growth defect without oxidative stress (around 80% in both cases; Fig. 1D). Consequently, if there is a contribution of RGS4 to oxidative stress response in light, it is rather minor.Fig. 2 Relevance of RGS4 for stress response, growth, enzyme production and secondary metabolite biosynthesis. A-C Average hyphal extension after 96 h at 28 °C in constant darkness (DD) and light (LL) on MA-medium with 1% cellulose (CMC) as carbon source and supplemented with A 0.25 mM menadione or B 1 M NaCl or C 1 M sorbitol to test for reaction to oxidative or osmotic stress respectively. D-H Liquid cultivation at 28 °C after 96 h in constant light (LL) and darkness (DD). D Average biomass formation, E specific cellulase activity, F cbh1 transcript levels (RT-qPCR) and G sorbicillin production represented as absorbances at 370 nm [59]. H Specific sorbicillin abundance in supernatant related to biomass formation upon growth on 1% cellulose. Measurements were taken from 3 biological replicates and statistical significance was calculated for the respective light condition (DD or LL) between WT and mutant using Student’s T-test.. * = p-value < 0.05) In T. reesei an involvement in sensitivity to osmotic stress by the G-protein pathway was shown previously [38]. To test the role of RGS4 we measured hyphal extension rates after 96 h on MA-CMC plates supplemented with 1 M NaCl or 1 M sorbitol. Interestingly the deletion of rgs4 caused increased sensitivity to sorbitol but not to NaCl in light (Fig. 2B, C). Comparison with growth in the absence of osmotic stress on CMC (Fig. 1D) showed a more severe growth defect of Δrgs4 in the presence of 1 M sorbitol in both light and darkness. In case of osmotic stress applied by 1 M NaCl, the growth defect seen in the control (Fig. 1D) without stress is alleviated upon deletion of rgs4. Hence RGS4 is involved in the reaction of T. reesei to osmotic stress, particularly in the presence of NaCl (salt stress) in light. RGS4 impacts biomass formation and cellulase activity in constant darkness Environmental sensing in microbes is essential for an optimal distribution of resources between growth (biomass formation), enzyme production and biosynthesis of secondary metabolites, among others. Therefore, we asked whether RGS4 contributes to one or more of these tasks. Upon growth in liquid media with cellulose in light, no difference in growth was observed, whereas in darkness biomass formation of Δrgs4 significantly increased by almost 40% (Fig. 2D). Specific cellulase activity was below the sensitivity limit for all samples in light, indicating that the deletion of rgs4 does not alleviate the block of cellulase formation in light. For dark grown cultures, we found that RGS4 is required for high level cellulase formation (Fig. 2E). Accordingly, transcript abundance of the major cellobiohydrolase cbh1/cel7a showed a negative trend in darkness (p-value 0.108) (Fig. 2F). Trichoderma reesei secretes sorbicillin derivates which are responsible for the characteristic yellow color of cultivation supernatants and plates [60, 61]. Since production of these pigments as well as regulation of the responsible SOR cluster is carbon source and light dependent [16], we tested whether RGS4 might be involved in this regulation. We found that deletion of rgs4 increased the amount of yellow pigment in darkness, however, this increase rather can be explained by the increased biomass formation under these conditions (Fig. 2G, H). Our transcriptome analysis showed that all seven genes of the sorbicillin cluster [16, 36, 60], including the transcription factors ypr1 (TrE0665C/TR_102499) and ypr2 (TrE0663W/TR_102497), were up-regulated between 1.4- and 2.3-fold in Δrgs4 (see below). But this can only be considered a positive trend, because the threshold set for statistical significance was mostly not met (padj < 0.05). This result is hence in agreement with the lack of alteration of yellow pigment formation in Δrgs4. RGS4 impacts gene regulation mainly in light Phenotypic analyses revealed that RGS4 differentially affects physiology of T. reesei in light and darkness. Moreover, clear light dependent effects were shown for the influence of the heterotrimeric G-protein signaling pathway on regulation of plant cell wall degradation [13]. We were hence interested which role RGS4 plays in this mechanism connecting light response and reaction to available nutrients. Therefore, we cultivated Δrgs4 on minimal medium with cellulose as carbon source in constant light and constant darkness and assessed alterations in gene expression compared to the wild-type in both conditions. In Δrgs4 we found a total of 210 genes significantly differentially regulated (> 1.5-fold, padj < 0.05) of which 16 genes were up- and 48 down-regulated in darkness, and 34 up- and 112 down-regulated in light (Fig. 3A). Of those, three genes were regulated both in light and darkness by RGS4: a SANT domain transcriptional regulator TrB0388C/TR_4124 potentially involved in chromatin modification, which is significantly up-regulated on cellulose [35] and strongly down-regulated in light and a mutant lacking the sorbicillin transcription factor YPR2 [62] in darkness; a duf341 domain protein TrC1432W/TR_59368 with a comparable regulation pattern to TrB0388C/TR_4124 in light and on cellulose and an unknown unique secreted protein TrF0745W/TR_121883, which shows only minor light dependent regulation but an up-regulation on cellulose versus repressing/non inducing carbon sources [35].Fig. 3 Gene regulation by RGS4 on cellulose in light and darkness. A Number of differentially expressed genes (DEGs) in Δrgs4. B, C GO enrichment of DEGs visualized with REVIGO. D Number and overlap of DEGs in Δrgs4 and Δypr2 in light For six of the differentially regulated genes, phosphorylation association with induction of plant cell wall degrading enzymes was detected [63]. They include genes encoding two predicted amino acid transporters (TrB0212C/TR_123718 up- and TrA0392C/TR_47175 down-regulated in light), a predicted plasma membrane H + ATPase (TrA2081W/TR_76238 up-regulated in light) and a ribosomal protein (TrB0953C/TR_47795 down-regulated in light). Additionally, four genes which are mutated in RutC30 (TrF004C/TR_79726, TrF0028C/TR_109211 and TrF0013C/TR_43418) including a muconate cycloisomerase gene (TrC0885C/TR_55887) showing regulation specific to cellulase inducing conditions [35] and two genes mutated in QM9123 (TrC0611W/TR_2439 and TrD0796W/TR_43191) were found among the genes down-regulated by RGS4 (Additional file 2). In light, RGS4 is involved in regulation of transcript abundance of ribosomal protein genes. There were six ribosomal protein encoding genes down-regulated around twofold in the deletion mutant in light. Among which there were two 60S ribosomal protein genes rla1 (TrB1847W/TR_123850) and rla2 (TrD0208W/TR_123202), two potential small ribosomal protein genes rps21 (TrB0594C/TR_78233) and rps28 (TrC1311W/TR_106039), a potential mitochondrial ribosomal protein gene (TrC1283C/TR_121219) and a ribosomal protein gene TrB0953C/TR_47795. Additionally, we found a small nuclear ribonucleoprotein (snRNP) (TrA2076W/TR_43225) and a snRNA associated protein TrA1443W/TR_76073. In constant darkness there are less genes differentially regulated in Δrgs4 as compared to in constant light but among those, categories involved in transport and localization stand out and can also be observed in the functional enrichment analysis (Fig. 3B, C). Out of 16 up-regulated genes in darkness, seven are transporters (also permeases or transferases) of which three are annotated as glutathione S-transferases (GST) [64]. Glutathione transferases belong to a protein family conserved across plants and animals, of detoxifying enzymes which are able to catalyze the conjugation of glutathione to form more soluble non-toxic compounds [65]. The number of GSTs in fungi correlates with the ability to degrade complex organic compounds and T. reesei was listed with the second highest number of GST genes present in the genome among fungi [66]. Among the down-regulated genes in darkness are two glycoside hydrolase genes (TrA0299W/TR_47268 (bgl3i) and TrF0168W/TR_65162) which is likely to contribute to the lower specific cellulase activity in Δrgs4. RGS4 regulates a secondary metabolite cluster associated with siderophore production Among the down-regulated genes in light we found all six genes of a siderophore biosynthetic cluster (Fig. 4A, B): TrE0011C/TR_71005, TrE0012W/TR_112590, TrE0013C/TR_71010, TrE0014C/TR_82628, TrE0015W/TR_6085 and TrE0016W/TR_71008 (3.7 – 6.4-fold significantly down-regulated; Fig. 4C-H). TrE0015W is the homologue to A. fumigatus sidH, a mevalonyl CoA dehydratase, annotated in T.reesei as SID8, followed by a transacylase, SID6 (TrE0014C) and the NRPS siderophore synthase SID4 (TrE0011C) in the biosynthetic pathway. The genome of T. reesei does not comprise an N2-transacetylase gene, which would be responsible for acetylation of fusarinine C to triacetylfusarinine C (TAFC) (A. fumigatus sidG). However, for A. fumigatus, the production of fusarinine C seems to be sufficient as the major siderophore [67]. Additionally, also a siderophore transporter (TrE0016W) and an MDR type ABC transporter (TrE0013C) belong to this cluster and were found to be down-regulated as well as the iron transporter TrD0323C/TR_38812, not member of this cluster but indicative of an involvement of RGS4 in iron transport/synthesis in light, which is supported by the enriched functional category “iron transport” as well (Fig. 3B). In support of this hypothesis, also one of the multicopper oxidases of the reductive iron transport system, Fet3b (TrD0040C/TR_5119) was up-regulated in light. Regulation of an RGS protein in association with iron homeostasis has been shown for mammalian RGS19, which possesses a consensus iron-sulfur binding motif (CXXCXXC) [68, 69]. However, such a motif is not present in T. reesei RGS4.Fig. 4 Regulation of a siderophore biosynthetic cluster by RGS4. A Schematic representation of the siderophore cluster in T. reesei. Model designations below the scheme taken from http://genome.jgi.doe.gov/Trire2/Trire2.home.html and if annotated, T. reesei protein names from Druzhinina et al. 2016 [64] and homologues names for A. fumigatus from https://fungidb.org/fungidb/app. NRPS (non-ribosomal peptide synthase), SE (siderophore esterase), ABC (ABC transporter), AT (acetyltransferase), Co (enoyl CoA hydratase), TRA (siderophore transporter). SID4/TrE0011C was former also known as TEX20. B Schematic representation of siderophore pathway and involved enzymes in T. reesei. Carbon sources analyzed by the BIOLOG Phenotype FF microarrays are given in black letters in grey boxes, compounds not analyzed are written in white. Downward pointing triangles indicate decreased growth in Δrgs4, upwards pointing triangles indicate increased growth. Yellow triangles show growth differences in light (LL). Pathways and enzymes were taken from KEGG [64, 70, 71]. Model designations with the gene names taken from http://genome.jgi.doe.gov/Trire2/Trire2.home.html and if annotated, T. reesei protein names from Druzhinina et al. 2016 [64] and homologues names for A. fumigatus from https://fungidb.org/fungidb/app. C-H LogCPM normalized counts of siderophore cluster genes in wild-type and Δrgs4 in constant light (LL). Error bars show standard deviations. Statistical significance was calculated using Student’s T-test. * = p-value < 0.05 On cellulose, already previously a light dependent regulation of this siderophore cluster upon growth on cellulose was found in the ypr2 deletion mutant in T. reesei [62]. Therefore, we were interested if there is an overlap in regulatory targets between RGS4 and YPR2. YPR2 is a transcription factor located in the sorbicillin (SOR) cluster [60] and when deleted, the entire siderophore cluster was up-regulated in light, which contrasts with Δrgs4 where the siderophore cluster was down-regulated in light (Figs. 3D and 4C-H) [62]. Nevertheless, we did not detect mutual regulation of ypr2 by RGS4 or vice versa. Interestingly, the six genes of the siderophore cluster were the only ones up-regulated in Δypr2 and down-regulated in Δrgs4 in light (Fig. 3D). Consequently, the regulatory pathways involving YPR2 and RGS4 act in opposite directions concerning siderophore regulation. To support the relevance of RGS4 for siderophore production we analyzed their presence in the supernatants of cellulose grown cultures. However, we saw that siderophore production upon growth on cellulose appears to be only slightly above the detection limit of the method and while we did observe a negative trend for Δrgs4 in light (data not shown), we consider gene regulation and growth patterns as more relevant evidence (see below). RGS4 impacts growth on diverse carbon sources As our transcriptome analysis indicated that RGS4 is involved in regulation of metabolism, we asked whether this impact extends to regulation of growth. We therefore applied the BIOLOG FF Phenotype microarray system and tested growth on 95 carbon sources in constant light and constant darkness (Additional file 3). Measurements were taken from 72 to 144 h to cover peak biomass values for most of the carbon sources. Results were considered relevant if at least two consecutive measurements showed statistically significant differences to the wild-type (p-value < 0.05). We found that growth on several storage carbohydrates is decreased in Δrgs4. Growth defects in Δrgs4 were observed on dextrin, glycogen and trehalose, as is growth on the intermediate maltose, mostly in light upon lack of RGS4 (Fig. 5A-D). This finding suggests, that RGS4 promotes carbon storage degradation for increasing its biomass production. The decreased growth may hence reflect rerouting of these resources to other metabolic needs.Fig. 5 Biomass formation of Δrgs4 versus WT on carbon sources related to storage and sugar catabolism. A Schematic representation of carbohydrate conversion pathways and involved enzymes. Carbon sources analyzed by the BIOLOG Phenotype FF microarrays are given in black letters in grey boxes, compounds not analyzed are written in white. Downwards pointing triangles indicate decreased growth, upwards pointing triangles indicate increased growth. Blue triangles stand for growth in darkness (DD), while yellow triangles show growth differences in light (LL). Pathways and enzymes were taken from KEGG [71]. Gene model designations taken from http://genome.jgi.doe.gov/Trire2/Trire2.home.html and if annotated, T. reesei protein names from Druzhinina et al. 2016 [64] and homologues names for A. fumigatus from https://fungidb.org/fungidb/app. B-D Growth patterns of WT and Δrgs4 on storage related carbon sources i. e. B glycogen, C D-trehalose and D maltose in constant light (LL) or constant darkness (DD) as revealed by the BIOLOG system. E–G Growth patterns of WT and Δrgs4 on carbon sources representing intermediates of D-galactose, D-xylose or L-arabinose catabolism, i.e. E xylitol, F D-xylose or G D-mannitol. Error bars indicate standard deviation of three biological replicates. Asterisks show statistical significance of the difference between WT and Δrgs4 at a given time point (* = p-value < 0.05, ** = p-value < 0.01) The observed growth patterns further suggest that RGS4 is involved in regulation of D-xylose, L-arabinose and D-galactose catabolism, as Δrgs4 grows more slowly on several intermediate carbohydrates of this pathway (Fig. 5A, E–G). In particular, growth on xylitol decreased in the dark, but increased in light (Fig. 5E), reflecting a light dependent regulation of the involved pathways by RGS4. Interestingly, this is not the case for D-xylose (Fig. 5F), which is converted to xylitol (Fig. 5A), as this shows the opposite effect in light (Fig. 5F). Consequently, we assume that due to the function of RGS4, xylitol conversion is promoted and upon deletion of rgs4, this intermediate is available for biomass production. In case of D-galactose, L-arabitol and D-mannitol (Fig. 5A), decreased growth was observed in both darkness and light, hinting at a more general effect of RGS4 targeting growth on these carbon sources. Screening the transcriptome data for correlations of gene regulation with these growth patterns, we did not find regulations of the genes involved in the degradation pathways of these carbon sources. Consequently, we assume an impact of RGS4 is likely not at the transcriptional level but rather on a posttranscriptional level or that the targeted pathways are not operative or regulated upon growth on cellulose. RGS4 impacts growth on siderophore related carbon sources The most interesting finding of the BIOLOG assay was the detection of carbon source utilization patterns supporting regulation of siderophore biosynthesis and indirectly iron homeostasis by RGS4 (Fig. 6). Importantly, growth on L-ornithine, the central precursor of siderophores, decreased in light, but not in darkness (Fig. 6A). Also, growth on L-proline decreased in light (Fig. 6B), although growth on glutamate only decreased in darkness. Since growth on putrescine, which is the intermediate in the metabolic pathway yielding polyamines, did not change in Δrgs4, we assume that lack of rgs4 decreases the consumption of proline, which may free resources for biomass production on ornithine. As an organic compound, the amino acid proline can be used as carbon and nitrogen source. In A. fumigatus, deletion of rgsC, the homologue of rgs4, resulted in restricted growth with proline as nitrogen source [48]. This is in agreement with our data, considering a role of proline as carbon source as well.Fig. 6 Biomass formation of Δrgs4 versus WT on carbon sources related to ornithine metabolism. A, B Growth patterns of WT and Δrgs4 on siderophore precursor (A) ornithine and amino acid (B) proline in constant light (LL) or constant darkness (DD) as revealed by the BIOLOG system. Error bars indicate standard deviation of three biological replicates. Asterisks show statistical significance of the difference between WT and Δrgs4 at a given time point (* = p-value < 0.05, ** = p-value < 0.01). C Schematic representation of conversion pathways and involved enzymes. Carbon sources analyzed by the BIOLOG Phenotype FF microarrays are given in black letters in grey boxes, compounds not analyzed are written in white. Downwards pointing triangles indicate decreased growth, upwards pointing triangles indicate increased growth; blue triangles stand for growth in darkness (DD), while yellow triangles show growth differences in light (LL). Pathways and enzymes are taken from KEGG [71–73] Additionally, decrease of transcript abundance and hence likely decrease of expression of the siderophore biosynthetic gene cluster and its operation in light also decreases conversion of ornithine for their production, again liberating resources for growth (Fig. 6C). Inspection of the assay plates at the end of the experiment did not indicate significant differences in sporulation on one of the specific carbon sources tested. Discussion It is crucial for fungi to sense and quickly adapt to their environment which relies on efficient signal transmission pathways. One of those pathways involves heterotrimeric G-protein signaling which is conserved in eukaryotes with its main components: the heterotrimeric G-proteins, G-protein coupled receptors (GPCRs) and regulators of G-protein signaling (RGS) [3, 74]. In T. reesei, roles of the G-protein α, β and γ subunits and a few GPCRs in the regulation of carbon or secondary metabolism in a light dependent manner was previously described [36–38, 40, 51]. RGSs on the other hand are still missing in this picture in T. reesei although they play an important role in the termination of signal from the Gα subunits. RGS proteins, just as G-proteins themselves, play important roles in the regulation of basic fungal processes such as vegetative growth, conidiation, secondary metabolite production and mating [41, 43]. In A. fumigatus the RGS proteins have been described in more details over the last years including rgsC which is involved in growth and development, tolerance to oxidative stress, gliotoxin production, expression of transporters and nutrient sensing [48]. To better understand the roles of RGS proteins specifically in light dependent regulation in T. reesei the current study provides insights into physiological changes and differential gene expression of RGS4 (Fig. 7). One of the most interesting findings of this study is the difference of the regulatory targets of RGS4 in light versus darkness, which was not shown before and agrees with the light dependent role of the G-protein pathway shown previously [13, 37, 38].Fig. 7 Schematic representation of the regulatory role of RGS4 in light and darkness. In light, rgs4 is required for normal expression of the siderophore cluster producing fusarinine C and for expression of (iron) transporter genes. Furthermore, rgs4 is positively involved in growth on storage- and galactose metabolism related carbon sources, sporulation and hyphal extension on glucose but negatively effects growth on xylitol as carbon source. In darkness on the other hand rgs4 positively influences growth on xylitol and specific cellulase activity but decreases biomass formation on cellulose. In both, light and darkness, rgs4 contributes to resistance against oxidative stress In a previous study, a light independent regulation of growth by the Gα subunit 1 (gna1) on solid media with glucose as carbon source can be seen (slightly decreased hyphal extension of Δgna1 on glucose) [38]. Interestingly for Δrgs4 the effect is stronger in light and abolished in darkness indicating that RGS4 is light dependently required for the transmission of a glucose signal. In the same study [38] a light dependent involvement of GNA1 in the reaction to oxidative stress by menadione was shown. In constant light, deletion of rgs4 caused a similar phenotype with decreased growth due to menadione, like the constitutive activation of GNA1, whereas in darkness we saw opposite effects: increased tolerance in both mutants of GNA1 and decreased tolerance in Δrgs4. The deletion of an RGS protein should increase the signal strength of a Gα subunit because the intrinsic GTPase activity is not accelerated, however, in T. reesei there are four different free RGS proteins and it is not yet known whether their functions are redundant and how specific their interaction with the respective G-alpha subunits is. Considering the domain composition of RGS4, it would be predicted to act on the G-alpha s protein GNA3 rather than on GNA1 [49]. If this would be the case, strains lacking rgs4 should have a phenotype resembling that of a constitutive activation of GNA3 (GNA3QL), which was reported earlier [37]. However, despite the confirmed function of RGS4 in cellulase regulation, the strong increase in transcript levels of the major cellulolytic enzyme encoding gene cbh1 in light, which was earlier observed for GNA3QL [37] was not observed in Δrgs4. This finding either suggests that the role of RGS protein in fungi is not entirely conserved or rather that investigation of G-protein function in the background of the high-cellulase random mutant QM9414 and its derivative TU-6 may be slightly different from that in the wild-type QM6a. A light and carbon source dependent involvement of a GPCR, i.e. gpr8, in regulation of secondary metabolism was investigated previously, showing a decrease in transcript levels of SOR cluster genes and secondary metabolites produced in darkness on cellulose [36]. In part, the regulation patterns of GPR8 overlap with those of YPR2, a transcription factor located in the SOR cluster, but targeting a broad range of secondary metabolite biosynthesis genes [62]. Interestingly, in darkness two thirds of all of the genes differentially regulated in Δrgs4 are also differentially regulated in Δypr2 but only six genes overlap in light, which all belong to the same siderophore cluster. This indicates a contribution of RGS4 in the initiation of a cascade that involves YPR2. The effect on siderophore regulation in light is opposite in both deletion mutants: RGS4 is required for siderophore gene cluster expression and YPR2 down regulates the cluster. Until now no direct correlation between RGS and iron transport has been shown in fungi, but in HELA cells the role of a RGS protein in the signaling cascade of iron chelation was shown [68]. Iron is essential for all eukaryotes and abundant on earth, but in an aerobic environment usually present in its oxidized form of ferric oxide hydrate complexes (Fe2O3 x nH2O) which has a low solubility of 10–9 to 10–18 M at neutral pH [67, 75]. Therefore, microbes had to develop different strategies for efficient iron uptake. One such a mechanism is siderophore-mediated Fe3+ uptake. Siderophores are low molecular mass iron chelators which help with the transport and storage of iron in the cell [76]. A. fumigatus acquires extracellular iron by a mechanism called reductive iron assimilation (RIA) [70]. During lack of extracellular and intracellular siderophores, A. fumigatus operates the RIA pathway, where ferric iron gets reduced to its ferrous form and is taken up by the FtrA/FetC complex [77, 78]. Defects in the RIA pathway cause an increase of siderophore production in A. fumigatus [79]. The genome of T. reesei comprises two Ftr1/Fet3 pairs, which are each located in vicinity to each other [62]. The respective gene pairs encoding FET3a/FTR1a and FET3b/FTR1b are co-regulated and fet3a/ftr1a show increased transcript levels in light on cellulose, while fet3b/ftr1b transcript abundance is decreased in light [62]. These data indicate that the two distinct gene pairs involved in the reductive iron uptake system in T. reesei confer light dependent specificity of this process, which likely also influence siderophore regulation. In our study, only fet3b was up-regulated in light in Δrgs4. We conclude that an influence of RGS4 on siderophore production and precursor metabolism in light but not in darkness is in agreement with the hypothesis of a light dependent relevance of iron as a nutrient, but also as a signal. Phosphorylation is considered the currency of signal transduction cascades [80]. In recent years it was confirmed that fungi react to the presence of plant cell wall carbohydrates with phosphorylation of diverse proteins, including those within signal transduction cascades [81, 82]. This response happens within minutes of recognition of altered environmental conditions and is both transient and dependent on the sensed carbon source [81, 82]. Although RGS4 does not regulate protein kinases at the transcriptional level, we found several genes encoding proteins specifically phosphorylated upon detection of residues associated with plant cell wall degradation [63] among the targets of RGS4. As generally with phosphorylation [83], this posttranslational modification of transporters may impact activity, stability or conformation/sensitivity in dependence of the substrate to be transported. Interestingly, the S. cerevisiae homologue of one of the predicted amino acid transporters (TrA0390C/ TR_47175), Avt3p, is phosphorylated by the kinase Atg1p [84], hence supporting a conserved relevance of this modification. Considering that for only around 8% of predicted proteins of T. reesei phosphorylation (of one or more peptides) was detected [63], the finding of six genes with plant cell wall degradation associated phosphorylation among the targets of RGS4 only in light (3 up-regulated, 3 down-regulated) is remarkable. With functions in stress response and regulation of the metabolism of storage carbohydrates, RGS4 modulates physiologically crucial mechanisms intimately associated with survival. Moreover, in both cases a role in reaction to changing or deteriorating environmental conditions is implicated by this function and as with other functions of RGS4, it is connected to a light dependent relevance. The decreased growth upon degradation of extracellular glycogen, dextrin or trehalose hints to a lower expression or secretion of the respective enzymes and a function of RGS4 balancing growth with storage of carbohydrates in response to the environment. Materials and methods Strains and cultivation conditions For the genotype of all strains used in this study see Table 1. The wild-type strain referred to in this study is T. reesei QM6a [85] which was used as a parental strain to construct the recombinant strain QM6aΔrgs4.Table 1 Strains used in this study Strain Code Characteristics Source QM6a WT Wild-type [85] FF1 FF1 Female fertile derivative of QM6a (MAT1-1) [86] FF2 FF2 Female fertile derivative of QM6a (MAT1-2) [86] QM6aΔrgs4 Δrgs4 Δrgs4::hph+ in QM6a background This study FF2rgs4_P5, FF2rgs4_P7, FF2rgs4_P11 FF2Δrgs4 backcrossed Δrgs4 with FF1, carrying the deletion This study FF2rgs4_DR_3, FF2rgs4_DR_4 FF2rgs4DR backcrossed Δrgs4 with FF1, not carrying the deletion This study Liquid cultivation was performed in Mandels Adreotti minimal medium (MA medium; [87]) containing 1% (w/v) microcrystalline cellulose (Alfa Aesar, Karlsruhe, Germany) and 0.1% (w/v) peptone to induce germination in constant dark and constant light (1700 lx) for 96 h at 200 rpm and 28° C. Strains for cultivation (QM6a and Δrgs4) were revived from glycerol stocks and then grown on 3% (w/v) malt extract agar (MEX) for 14 days in constant darkness which prevents interference of circadian rhythmicity with the analyses. 109 conidia/L were used for the inoculation of 50 mL MA medium in shake flasks in triplicates. For harvest in darkness a very low red safety light (darkroom lamp, Philips PF712E, red, 15W) was used. Phenotypic plate assays were analyzed after 48 h at 28° C under constant light (1700 lx) and constant darkness. Sporulation was measured in triplicates at 600 nm, which correlates with microscopic spore counts. After excision of an agar piece of defined size (2 × 1.77 cm2) from malt extract plates (3% w/v) spores were collected in 4 mL spore solution (0.8% w/v NaCl and 0.05% w/v Tween 80 in purified water) and photometrically analyzed at 600 nm against a standard curve of pre-counted spores. Hyphal extension assays were analyzed upon growth on MA medium supplemented with either 1% w/v carboxymethyl cellulose (CMC) or 1% w/v glucose (Glc). For growth under stress, MA-CMC was supplemented with either 1 M sorbitol or 1 M NaCl for osmotic stress or 0.25 mM menadione (Sigma-Aldrich, St. Louis, Missouri, USA) for oxidative stress and measured after 96 h. Construction of Δrgs4 The deletion mutant Δrgs4 was created by recombinant cloning using a hygromycin phosphotransferase (hph) marker cassette with 1 kilobases (kb) flanking regions produced by yeast recombination as described previously [88] and protoplast transformation was performed with selection plates supplemented with 50 µg/mL hygromycin B as selection reagent (Roth, Karlsruhe, Germany) [89]. Successful deletion was confirmed by PCR. For primer sequences see Table 2. Copy number determination by qPCR as described previously [52] indicated two copies of the rgs4 deletion cassette. Consequently, we aimed to confirm that the observed effects are due to the deletion of RGS4 rather than random effects of transformation. We performed crosses of Δrgs4 with female fertile FF1 to obtain progeny carrying the deletion. Analysis of these strains lacking rgs4 as well as progeny from this crossing in which the deletion had been restored, confirmed that the characteristic growth defect of Δrgs4 on glucose segregated with the deletion (Additional file 1, Figure S2) hence confirming the validity of the strain used for analyses.Table 2 Oligonucleotides used in this study Name Sequence 5'—3' Purpose Rgs4_65607_5F GTAACGCCAGGGTTTTCCCAGTCACGACGCCTGTTCAGAGCCTTATTCC forward primer for 5' flank Rgs4_65607_5R ATCCACTTAACGTTACTGAAATCTCCAACGTACCGAGTACAAAACGTCG reverse primer for 5' flank Rgs4_65607_3F CTCCTTCAATATCATCTTCTGTCTCCGACGAACCTGGTGTGATTTGAAGG forward primer for 3' flank Rgs4_65607_3R GCGGATAACAATTTCACACAGGAAACAGCGGCATCCGTCCATAGTGAG reverse primer for 3' flank Rgs4_65607_qF CGTGATACAGGAGAGCGATA Internal primer Rgs4_65607_qR TTGGTGCAGTTCGTGAAAC Internal primer EF1-728F CATCGAGAAGTTCGAGAAGG Internal primer TEF1 rev GCCATCCTTGGAGATACCAGC Internal primer SAR RTF1 TGGATCGTCAACTGGTTCTACGA RT qPCR SAR RTR1 GCATGTGTAGCAACGTGGTCTTT RT qPCR RTcbh1F ACCGTTGTCACCCAGTTCG RT qPCR RTcbh1R ATCGTTGAGCTCGTTGCCAG RT qPCR Isolation and manipulation of nucleic acids DNA for screening of mutants was extracted using a rapid mini preparation method for fungal DNA [90]. For the isolation of total RNA, the mycelium from liquid cultivation was filtered through miracloth and frozen in liquid nitrogen prior to extraction with the RNeasy Plant mini kit (Qiagen, Heidelberg, Germany). Quality control of total RNA and RT-qPCR for investigation of cbh1 transcript levels was performed as described earlier [91, 92]. Sar1 was used as reference gene. Oligonucleotide sequences of all primers used in this study are listed in Table 2. Biomass determination and specific cellulase activity Biomass was determined as described earlier [93]. Briefly, frozen mycelia from liquid cultivation were ground in liquid nitrogen, incubated in 0.1 M NaOH and sonicated to break up cells. The liberated protein content was then measured using the Bradford method as a means reflecting biomass content. For the analysis of cellulases in the cultivation supernatant, after centrifugation to remove residual cellulose, the CMC-cellulose kit (S-ACMC-L Megazyme) was used to measure endo-1,4-ß-D-glucanases. For the specific cellulase activity, the cellulase activity was normalized to the biomass produced. Sorbicillin analysis at 370 nm Absorbance at 370 nm reflects sorbicillin content [59] and was hence applied to quantitatively assess the amount of yellow pigment, indicative for sorbicillin and its derivatives in liquid media. Supernatants of liquid cultivation were centrifuged to remove residual cellulose and absorbance at 370 nm indicative for sorbicillin measured from biological triplicates. BIOLOG phenotype microplate assay Growth on different carbon sources were analyzed using BIOLOG FF Microplate assay (Biolog Inc., Hayward, CA) as described previously [94]. Inoculated microplates were incubated at 28 °C in constant dark or constant light (1700 lx) for up to 144 h and absorbances measured at 750 nm reflecting biomass accumulation in 24 h intervals starting at 72 h. Analyses were repeated in triplicates for each strain. Statistical significance of growth differences was analyzed by the T-test (p-value threshold ≤ 0.05) as implemented in Excel 2016 (Microsoft, Redmond, USA). Transcriptome analysis and bioinformatics We submitted total RNA in biological triplicates for each strain and condition. Library preparation, including ribo-depletion for the removal of rRNA and sequencing was conducted at the Next Generation Sequencing Facility (Vienna Biocenter Core Facilities GmbH, Austria) on a NovaSeq 6000 in paired-end (PE) and 150 bp mode, which resulted in an average of 29 million reads per sample. Quality filtering (Q30) and adapter trimming was done using bbduk version 38.18 [95]. For mapping, we used the most recent T. reesei QM6a reference genome [8] using HISAT2 version 2.2.1 [96], with an average overall alignment of 99.0% on average. For further data processing we used samtools version 1.10 [97] and examined the quality of mapping with QualiMap version 2.2.2 before applying featureCounts version 2.0.1 [98]. For differential gene expression (DEG) analysis in R version 4.0.3 [99], DESeq2 version 1.3.1 [100] was used with a threshold for significantly differentially regulated genes of log2fold change |> 0.58| and p-adj < 0.05. Resulting DEGs were further filtered with the LFCshrink function (type: apeglm) [101]. The gene annotations were done using available annotations for T. reesei, T. virens and T. atroviride [42] and T. reesei [64]. For count normalization the DESeq2 variance stabilizing transformation (VST) function was applied. Functional enrichment of a set of DEGs was performed using the Fisher’s exact test using R package topGO version 2.42.0 [102] visualized with REVIGO [103]. Statistics Statistical significance for phenotypic analysis was calculated in R using Student’s T-test (compare means, ggpubr version 0.4.0) ** = p-value < 0.01, * = p-value < 0.05. Phylogenetic analysis was performed using clustalX [104] for the alignment and MEGA11 for minimum evolution analysis [105, 106]. Supplementary Information Additional file 1. Additional file 2. Additional file 3. Acknowledgements We want to thank Tiziano Benocci for technical support with BIOLOG Phenotype microarray analysis. Authors’ contributions MiS performed experimental work and bioinformatic analysis and drafted the manuscript and figures. EMM supported and supervised bioinformatic analysis and edited the manuscript. MoS conceived the study, contributed to analysis and interpretation of results and wrote the final version of the manuscript. All authors read and approved the final manuscript. Funding Open access funding provided by Austrian Science Fund (FWF). Work of MoS and MiS was supported by the Austrian Science Fund (FWF; grant P31464 to MoS). Availability of data and materials The datasets generated and analyzed during the current study are included in this article and its additional files and under GenBank accession number GSE216955 (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE216955). Declarations Ethics approval and consent to participate Not applicable. Consent for publication Not applicable. Competing interests The authors declare no competing interests. Publisher's Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. ==== Refs References 1. Shpakov A. Heterotrimeric G proteins. In: Brenner's Encyclopedia of Genetics: 2nd Edition. 2013: 454–456. 2. Lengeler KB Davidson RC D'Souza C Harashima T Shen WC Wang P Pan X Waugh M Heitman J Signal transduction cascades regulating fungal development and virulence Microbiol Mol Biol Rev 2000 64 4 746 785 10.1128/MMBR.64.4.746-785.2000 11104818 3. Li L Wright SJ Krystofova S Park G Borkovich KA Heterotrimeric G protein signaling in filamentous fungi Annu Rev Microbiol 2007 61 423 452 10.1146/annurev.micro.61.080706.093432 17506673 4. Druzhinina IS Kubicek CP Familiar stranger: ecological genomics of the model saprotroph and industrial enzyme producer Trichoderma reesei breaks the stereotypes Adv Appl Microbiol 2016 95 69 147 10.1016/bs.aambs.2016.02.001 27261782 5. Schmoll M Trichoderma reesei Trends Microbiol 2022 30 4 403 404 10.1016/j.tim.2021.12.008 35039212 6. Tomico-Cuenca I Mach RL Mach-Aigner AR Derntl C An overview on current molecular tools for heterologous gene expression in Trichoderma Fungal Biol Biotechnol 2021 8 1 11 10.1186/s40694-021-00119-2 34702369 7. Bischof RH Ramoni J Seiboth B Cellulases and beyond: the first 70 years of the enzyme producer Trichoderma reesei Microb Cell Fact 2016 15 1 106 10.1186/s12934-016-0507-6 27287427 8. Li WC Huang CH Chen CL Chuang YC Tung SY Wang TF Trichoderma reesei complete genome sequence, repeat-induced point mutation, and partitioning of CAZyme gene clusters Biotechnol Biofuels 2017 10 170 10.1186/s13068-017-0825-x 28690679 9. Li WC, Lee CY, Lan WH, Woo TT, Liu HC, Yeh HY, Chang HY, Chuang YC, Chen CY, Chuang CN, et al. Trichoderma reesei Rad51 tolerates mismatches in hybrid meiosis with diverse genome sequences. Proc Natl Acad Sci U S Am. 2021;118(8):e2007192118. 10. Druzhinina IS Chenthamara K Zhang J Atanasova L Yang D Miao Y Rahimi MJ Grujic M Cai F Pourmehdi S Massive lateral transfer of genes encoding plant cell wall-degrading enzymes to the mycoparasitic fungus Trichoderma from its plant-associated hosts PLoS Genet 2018 14 4 e1007322 10.1371/journal.pgen.1007322 29630596 11. Schalamun M, Schmoll M. Trichoderma – genomes and genomics as treasure troves for research towards biology, biotechnology and agriculture. Front Fungal Biol. 2022;3. 10.3389/ffunb.2022.1002161. 12. Glass NL Schmoll M Cate JH Coradetti S Plant cell wall deconstruction by ascomycete fungi Annu Rev Microbiol 2013 67 477 498 10.1146/annurev-micro-092611-150044 23808333 13. Schmoll M Regulation of plant cell wall degradation by light in Trichoderma Fungal Biol Biotechnol 2018 5 10 10.1186/s40694-018-0052-7 29713489 14. Schmoll M Seibel C Tisch D Dorrer M Kubicek CP A novel class of peptide pheromone precursors in ascomycetous fungi Mol Microbiol 2010 77 6 1483 1501 10.1111/j.1365-2958.2010.07295.x 20735770 15. Seidl V Seibel C Kubicek CP Schmoll M Sexual development in the industrial workhorse Trichoderma reesei Proc Natl Acad Sci USA 2009 106 33 13909 13914 10.1073/pnas.0904936106 19667182 16. Monroy AA Stappler E Schuster A Sulyok M Schmoll M A CRE1- regulated cluster is responsible for light dependent production of dihydrotrichotetronin in Trichoderma reesei PLoS ONE 2017 12 e0182530 10.1371/journal.pone.0182530 28809958 17. Seibel C Tisch D Kubicek CP Schmoll M ENVOY is a major determinant in regulation of sexual development in Hypocrea jecorina (Trichoderma reesei) Eukaryot Cell 2012 11 885 890 10.1128/EC.05321-11 22581525 18. Schmoll M Light, stress, sex and carbon - the photoreceptor ENVOY as a central checkpoint in the physiology of Trichoderma reesei Fungal Biol 2018 122 6 479 486 10.1016/j.funbio.2017.10.007 29801792 19. Schmoll M Esquivel-Naranjo EU Herrera-Estrella A Trichoderma in the light of day - physiology and development Fungal Genet Biol 2010 47 11 909 916 10.1016/j.fgb.2010.04.010 20466064 20. Proietto M Bianchi MM Ballario P Brenna A Epigenetic and posttranslational modifications in light signal transduction and the circadian clock in Neurospora crassa Int J Mol Sci 2015 16 7 15347 15383 10.3390/ijms160715347 26198228 21. Diernfellner ACR Brunner M Phosphorylation timers in the Neurospora crassa circadian clock J Mol Biol 2020 432 12 3449 3465 10.1016/j.jmb.2020.04.004 32305463 22. Franchi L Fulci V Macino G Protein kinase C modulates light responses in Neurospora by regulating the blue light photoreceptor WC-1 Mol Microbiol 2005 56 2 334 345 10.1111/j.1365-2958.2005.04545.x 15813728 23. Huang G Chen S Li S Cha J Long C Li L He Q Liu Y Protein kinase A and casein kinases mediate sequential phosphorylation events in the circadian negative feedback loop Genes Dev 2007 21 24 3283 3295 10.1101/gad.1610207 18079175 24. Tisch D Schuster A Schmoll M Crossroads between light response and nutrient signalling: ENV1 and PhLP1 act as mutual regulatory pair in Trichoderma reesei BMC Genomics 2014 15 425 10.1186/1471-2164-15-425 24893562 25. Schmoll M The information highways of a biotechnological workhorse - signal transduction in Hypocrea jecorina BMC Genomics 2008 9 430 10.1186/1471-2164-9-430 18803869 26. Jastrzebska B GPCR: G protein complexes - the fundamental signaling assembly Amino Acids 2013 45 6 1303 1314 10.1007/s00726-013-1593-y 24052187 27. Cabrera-Vera TM Vanhauwe J Thomas TO Medkova M Preininger A Mazzoni MR Hamm HE Insights into G protein structure, function, and regulation Endocr Rev 2003 24 6 765 781 10.1210/er.2000-0026 14671004 28. Schmoll M, Hinterdobler W. Tools for adapting to a complex habitat: G-protein coupled receptors in Trichoderma. In: Progress in Molecular Biology and Translational Science. Academic Press; 2022: in press. 29. Stewart A Fisher RA Introduction: G Protein-coupled Receptors and RGS Proteins Prog Mol Biol Transl Sci 2015 133 1 11 10.1016/bs.pmbts.2015.03.002 26123299 30. Watson N Linder ME Druey KM Kehrl JH Blumer KJ RGS family members: GTPase-activating proteins for heterotrimeric G-protein alpha-subunits Nature 1996 383 6596 172 175 10.1038/383172a0 8774882 31. Ham D Ahn D Ashim J Cho Y Kim HR Yu W Chung KY Conformational switch that induces GDP release from Gi J Struct Biol 2021 213 1 107694 10.1016/j.jsb.2020.107694 33418033 32. Koelle MR A new family of G-protein regulators - the RGS proteins Curr Opin Cell Biol 1997 9 2 143 147 10.1016/S0955-0674(97)80055-5 9069252 33. Alqinyah M Hooks SB Regulating the regulators: Epigenetic, transcriptional, and post-translational regulation of RGS proteins Cell Signal 2018 42 77 87 10.1016/j.cellsig.2017.10.007 29042285 34. Sethakorn N Yau DM Dulin NO Non-canonical functions of RGS proteins Cell Signal 2010 22 9 1274 1281 10.1016/j.cellsig.2010.03.016 20363320 35. Stappler E, Dattenböck C, Tisch D, Schmoll M. Analysis of light- and carbon-specific transcriptomes implicates a class of G-protein-coupled receptors in cellulose sensing. mSphere. 2017;2(3):e00089–00017. 36. Hinterdobler W Beier S Monroy AA Berger H Dattenbock C Schmoll M The G-protein coupled receptor GPR8 regulates secondary metabolism in Trichoderma reesei Front Bioeng Biotechnol 2020 8 558996 10.3389/fbioe.2020.558996 33251193 37. Schmoll M, Schuster A. do Nascimento Silva R, Kubicek CP. The G-alpha protein GNA3 of Hypocrea jecorina (anamorph Trichoderma reesei) regulates cellulase gene expression in the presence of light. Eukaryot Cell. 2009;8(3):410–20. 38. Seibel C Gremel G Silva RD Schuster A Kubicek CP Schmoll M Light-dependent roles of the G-protein subunit GNA1 of Hypocrea jecorina (anamorph Trichoderma reesei) BMC Biol 2009 7 1 58 10.1186/1741-7007-7-58 19728862 39. Seibel C Tisch D Kubicek CP Schmoll M The role of pheromone receptors for communication and mating in Hypocrea jecorina (Trichoderma reesei) Fungal Genet Biol 2012 49 10 814 824 10.1016/j.fgb.2012.07.004 22884620 40. Tisch D Kubicek CP Schmoll M The phosducin-like protein PhLP1 impacts regulation of glycoside hydrolases and light response in Trichoderma reesei BMC Genomics 2011 12 613 10.1186/1471-2164-12-613 22182583 41. Yu JH Heterotrimeric G protein signaling and RGSs in Aspergillus nidulans J Microbiol 2006 44 2 145 154 16728950 42. Schmoll M Dattenböck C Carreras-Villasenor N Mendoza-Mendoza A Tisch D Aleman MI Baker SE Brown C Cervantes-Badillo MG Cetz-Chel J The genomes of three uneven siblings: footprints of the lifestyles of three Trichoderma species Microbiol Mol Biol Rev 2016 80 1 205 327 10.1128/MMBR.00040-15 26864432 43. Wang Y Geng Z Jiang D Long F Zhao Y Su H Zhang KQ Yang J Characterizations and functions of regulator of G protein signaling (RGS) in fungi Appl Microbiol Biotechnol 2013 97 18 7977 7987 10.1007/s00253-013-5133-1 23917634 44. Park HS, Kim MJ, Yu JH, Shin KS. Heterotrimeric G-protein signalers and RGSs in Aspergillus fumigatus. Pathogens. 2020;9(11):902. 45. Kim Y Lee MW Jun SC Choi YH Yu JH Shin KS RgsD negatively controls development, toxigenesis, stress response, and virulence in Aspergillus fumigatus Sci Rep 2019 9 1 811 10.1038/s41598-018-37124-2 30692551 46. Ma N Zhao Y Wang Y Yang L Li D Yang J Jiang K Zhang KQ Yang J Functional analysis of seven regulators of G protein signaling (RGSs) in the nematode-trapping fungus Arthrobotrys oligospora Virulence 2021 12 1 1825 1840 10.1080/21505594.2021.1948667 34224331 47. O'Brien JB Wilkinson JC Roman DL Regulator of G-protein signaling (RGS) proteins as drug targets: Progress and future potentials J Biol Chem 2019 294 49 18571 18585 10.1074/jbc.REV119.007060 31636120 48. Kim Y Heo IB Yu JH Shin KS Characteristics of a Regulator of G-Protein Signaling (RGS) rgsC in Aspergillus fumigatus Front Microbiol 2017 8 2058 10.3389/fmicb.2017.02058 29109714 49. Xie GX Palmer PP How regulators of G protein signaling achieve selective regulation J Mol Biol 2007 366 2 349 365 10.1016/j.jmb.2006.11.045 17173929 50. Dattenböck C Tisch D Schuster A Monroy AA Hinterdobler W Schmoll M Gene regulation associated with sexual development and female fertility in different isolates of Trichoderma reesei Fungal Biol Biotechnol 2018 5 9 10.1186/s40694-018-0055-4 29785273 51. Stappler E Walton JD Schmoll M Abundance of secreted proteins of Trichoderma reesei is regulated by light of different intensities Front Microbiol 2017 8 2586 10.3389/fmicb.2017.02586 29375497 52. Tisch D Schmoll M Targets of light signalling in Trichoderma reesei BMC Genomics 2013 14 1 657 10.1186/1471-2164-14-657 24070552 53. Allada R Meissner RA Casein kinase 2, circadian clocks, and the flight from mutagenic light Mol Cell Biochem 2005 274 1–2 141 149 10.1007/s11010-005-2943-1 16335534 54. Mehra A Shi M Baker CL Colot HV Loros JJ Dunlap JC A role for casein kinase 2 in the mechanism underlying circadian temperature compensation Cell 2009 137 4 749 760 10.1016/j.cell.2009.03.019 19450520 55. Schuster A Tisch D Seidl-Seiboth V Kubicek CP Schmoll M Roles of protein kinase A and adenylate cyclase in light-modulated cellulase regulation in Trichoderma reesei Appl Environ Microbiol 2012 78 7 2168 2178 10.1128/AEM.06959-11 22286997 56. Hinterdobler W Schuster A Tisch D Ozkan E Bazafkan H Schinnerl J Brecker L Bohmdorfer S Schmoll M The role of PKAc1 in gene regulation and trichodimerol production in Trichoderma reesei Fungal Biol Biotechnol 2019 6 12 10.1186/s40694-019-0075-8 31528353 57. D'Souza CA Heitman J Conserved cAMP signaling cascades regulate fungal development and virulence FEMS Microbiol Rev 2001 25 3 349 364 10.1111/j.1574-6976.2001.tb00582.x 11348689 58. Kronstad J De Maria AD Funnell D Laidlaw RD Lee N de Sa MM Ramesh M Signaling via cAMP in fungi: interconnections with mitogen-activated protein kinase pathways Arch Microbiol 1998 170 6 395 404 10.1007/s002030050659 9799282 59. Derntl C Rassinger A Srebotnik E Mach RL Mach-Aigner AR Identification of the main regulator responsible for synthesis of the typical yellow pigment produced by Trichoderma reesei Appl Environ Microbiol 2016 82 20 6247 6257 10.1128/AEM.01408-16 27520818 60. Derntl C Guzman-Chavez F Mello-de-Sousa TM Busse HJ Driessen AJM Mach RL Mach-Aigner AR In Vivo Study of the Sorbicillinoid Gene Cluster in Trichoderma reesei Front Microbiol 2017 8 2037 10.3389/fmicb.2017.02037 29104566 61. Nakari-Setala T Aro N Kalkkinen N Alatalo E Penttila M Genetic and biochemical characterization of the Trichoderma reesei hydrophobin HFBI European journal of biochemistry / FEBS 1996 235 1–2 248 255 10.1111/j.1432-1033.1996.00248.x 62. Hitzenhammer E Büschl C Sulyok M Schuhmacher R Kluger B Wischnitzki E Schmoll M YPR2 is a regulator of light modulated carbon and secondary metabolism in Trichoderma reesei BMC Genomics 2019 20 1 211 10.1186/s12864-019-5574-8 30866811 63. Nguyen EV Imanishi SY Haapaniemi P Yadav A Saloheimo M Corthals GL Pakula TM Quantitative site-specific phosphoproteomics of Trichoderma reesei signaling pathways upon induction of hydrolytic enzyme production J Proteome Res 2016 15 2 457 467 10.1021/acs.jproteome.5b00796 26689635 64. Druzhinina IS Kopchinskiy AG Kubicek EM Kubicek CP A complete annotation of the chromosomes of the cellulase producer Trichoderma reesei provides insights in gene clusters, their expression and reveals genes required for fitness Biotechnol Biofuels 2016 9 75 10.1186/s13068-016-0488-z 27030800 65. Frova C Glutathione transferases in the genomics era: new insights and perspectives Biomol Eng 2006 23 4 149 169 10.1016/j.bioeng.2006.05.020 16839810 66. Morel M, Ngadin AA, Droux M, Jacquot JP, Gelhaye E. The fungal glutathione S-transferase system. Evidence of new classes in the wood-degrading basidiomycete Phanerochaete chrysosporium. Cell Mol Life Sci. 2009;66(23):3711–3725. 67. Haas H Eisendle M Turgeon BG Siderophores in fungal physiology and virulence Annu Rev Phytopathol 2008 46 149 187 10.1146/annurev.phyto.45.062806.094338 18680426 68. Hwang J Kim HS Kang BS Kim DH Ryoo ZY Choi SU Lee S RGS19 converts iron deprivation stress into a growth-inhibitory signal Biochem Biophys Res Commun 2015 464 1 168 175 10.1016/j.bbrc.2015.06.109 26116529 69. Antonkine ML Koay MS Epel B Breitenstein C Gopta O Gartner W Bill E Lubitz W Synthesis and characterization of de novo designed peptides modelling the binding sites of [4Fe-4S] clusters in photosystem I Biochem Biophys Acta 2009 1787 8 995 1008 19298792 70. Schrettl M Bignell E Kragl C Sabiha Y Loss O Eisendle M Wallner A Arst HN Jr Haynes K Haas H Distinct roles for intra- and extracellular siderophores during Aspergillus fumigatus infection PLoS Pathog 2007 3 9 1195 1207 10.1371/journal.ppat.0030128 17845073 71. Kanehisa M Goto S KEGG: kyoto encyclopedia of genes and genomes Nucleic Acids Res 2000 28 1 27 30 10.1093/nar/28.1.27 10592173 72. Dzikowska A Grzelak A Gawlik J Szewczyk E Mrozek P Borsuk P Koper M Empel J Szczęsny P Piłsyk S KAEA (SUDPRO), a member of the ubiquitous KEOPS/EKC protein complex, regulates the arginine catabolic pathway and the expression of several other genes in Aspergillus nidulans Gene 2015 573 2 310 320 10.1016/j.gene.2015.07.066 26210809 73. Misslinger M, Hortschansky P, Brakhage AA, Haas H. Fungal iron homeostasis with a focus on Aspergillus fumigatus. Biochimica et Biophysica Acta (BBA) - Mol Cell Res. 2021;1868(1):118885. 74. Syrovatkina V Alegre KO Dey R Huang XY Regulation, signaling, and physiological functions of G-proteins J Mol Biol 2016 428 19 3850 3868 10.1016/j.jmb.2016.08.002 27515397 75. Miethke M Marahiel MA Siderophore-based iron acquisition and pathogen control Microbiol Mol Biol Rev 2007 71 3 413 451 10.1128/MMBR.00012-07 17804665 76. Wilson BR Bogdan AR Miyazawa M Hashimoto K Tsuji Y Siderophores in iron metabolism: From mechanism to therapy potential Trends Mol Med 2016 22 12 1077 1090 10.1016/j.molmed.2016.10.005 27825668 77. Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, Dancis A. A permease-oxidase complex involved in high-affinity iron uptake in yeast. Science (New York, NY) 1996; 271(5255):1552–1557. 78. Misslinger M Hortschansky P Brakhage AA Haas H Fungal iron homeostasis with a focus on Aspergillus fumigatus Biochim Biophys Acta Mol Cell Res 2021 1868 1 118885 10.1016/j.bbamcr.2020.118885 33045305 79. Schrettl M Bignell E Kragl C Joechl C Rogers T Arst HN Jr Haynes K Haas H Siderophore biosynthesis but not reductive iron assimilation is essential for Aspergillus fumigatus virulence J Exp Med 2004 200 9 1213 1219 10.1084/jem.20041242 15504822 80. Dickman MB Yarden O Serine/threonine protein kinases and phosphatases in filamentious fungi Fungal Genet Biol 1999 26 2 99 117 10.1006/fgbi.1999.1118 10328981 81. Horta MAC Thieme N Gao Y Burnum-Johnson KE Nicora CD Gritsenko MA Lipton MS Mohanraj K de Assis LJ Lin L Broad substrate-specific phosphorylation events are associated with the initial stage of plant cell wall recognition in Neurospora crassa Front Microbiol 2019 10 2317 10.3389/fmicb.2019.02317 31736884 82. Nguyen QB Kadotani N Kasahara S Tosa Y Mayama S Nakayashiki H Systematic functional analysis of calcium-signalling proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-throughput RNA-silencing system Mol Microbiol 2008 68 6 1348 1365 10.1111/j.1365-2958.2008.06242.x 18433453 83. Humphrey SJ James DE Mann M Protein phosphorylation: A major switch mechanism for metabolic regulation Trends Endocrinol Metab 2015 26 12 676 687 10.1016/j.tem.2015.09.013 26498855 84. Ptacek J Devgan G Michaud G Zhu H Zhu X Fasolo J Guo H Jona G Breitkreutz A Sopko R Global analysis of protein phosphorylation in yeast Nature 2005 438 7068 679 684 10.1038/nature04187 16319894 85. Martinez D, Berka RM, Henrissat B, Saloheimo M, Arvas M, Baker SE, Chapman J, Chertkov O, Coutinho PM, Cullen D et al: Genome sequencing and analysis of the biomass-degrading fungus Trichoderma reesei (syn. Hypocrea jecorina). Nat Biotechnol. 2008;26(5):553–560. 86. Bazafkan H Dattenböck C Böhmdorfer S Tisch D Stappler E Schmoll M Mating type dependent partner sensing as mediated by VEL1 in Trichoderma reesei Mol Microbiol 2015 96 6 1103 1118 10.1111/mmi.12993 25757597 87. Mandels M Andreotti R Problems and challenges in the cellulose to cellulase fermentation Proc Biochem 1978 13 6 13 88. Schuster A Bruno KS Collett JR Baker SE Seiboth B Kubicek CP Schmoll M A versatile toolkit for high throughput functional genomics with Trichoderma reesei Biotechnol Biofuels 2012 5 1 1 10.1186/1754-6834-5-1 22212435 89. Gruber F Visser J Kubicek CP de Graaff LH The development of a heterologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrG-negative mutant strain Curr Genet 1990 18 1 71 76 10.1007/BF00321118 2245476 90. Liu D Coloe S Baird R Pederson J Rapid mini-preparation of fungal DNA for PCR J Clin Microbiol 2000 38 1 471 10.1128/JCM.38.1.471-471.2000 10681211 91. Bazafkan H Beier S Stappler E Böhmdorfer S Oberlerchner JT Sulyok M Schmoll M SUB1 has photoreceptor dependent and independent functions in sexual development and secondary metabolism in Trichoderma reesei Mol Microbiol 2017 106 5 742 759 10.1111/mmi.13842 28925526 92. Tisch D Kubicek CP Schmoll M New insights into the mechanism of light modulated signaling by heterotrimeric G-proteins: ENVOY acts on gna1 and gna3 and adjusts cAMP levels in Trichoderma reesei (Hypocrea jecorina) Fungal Genet Biol 2011 48 6 631 640 10.1016/j.fgb.2010.12.009 21220037 93. Schmoll M Franchi L Kubicek CP Envoy, a PAS/LOV domain protein of Hypocrea jecorina (Anamorph Trichoderma reesei), modulates cellulase gene transcription in response to light Eukaryot Cell 2005 4 12 1998 2007 10.1128/EC.4.12.1998-2007.2005 16339718 94. Druzhinina IS Schmoll M Seiboth B Kubicek CP Global carbon utilization profiles of wild-type, mutant, and transformant strains of Hypocrea jecorina Appl Environ Microbiol 2006 72 3 2126 2133 10.1128/AEM.72.3.2126-2133.2006 16517662 95. Brian B. BBMap. In. https://sourceforge.net/projects/bbmap/: Sourceforge; 2014. 96. Kim D Paggi JM Park C Bennett C Salzberg SL Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype Nat Biotechnol 2019 37 8 907 915 10.1038/s41587-019-0201-4 31375807 97. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. Genome Project Data Processing S: The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25(16):2078–9. 98. Liao Y Smyth GK Shi W featureCounts: an efficient general purpose program for assigning sequence reads to genomic features Bioinformatics 2013 30 7 923 930 10.1093/bioinformatics/btt656 24227677 99. Team RC. R: A language and environment for statistical computing. In. https://www.R-project.org/: R Foundation for Statistical Computing, Vienna. 100. Love MI Huber W Anders S Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genome Biol 2014 15 12 550 10.1186/s13059-014-0550-8 25516281 101. Zhu A Ibrahim JG Love MI Heavy-tailed prior distributions for sequence count data: removing the noise and preserving large differences Bioinformatics 2019 35 12 2084 2092 10.1093/bioinformatics/bty895 30395178 102. Adrian Alexa JR. Enrichment Analysis for Gene Ontology. 2021. 103. Supek F Bosnjak M Skunca N Smuc T REVIGO summarizes and visualizes long lists of gene ontology terms PLoS ONE 2011 6 7 e21800 10.1371/journal.pone.0021800 21789182 104. Thompson JD Gibson TJ Plewniak F Jeanmougin F Higgins DG The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 1997 25 24 4876 4882 10.1093/nar/25.24.4876 9396791 105. Tamura K Stecher G Kumar S MEGA11: Molecular Evolutionary Genetics Analysis Version 11 Mol Biol Evol 2021 38 7 3022 3027 10.1093/molbev/msab120 33892491 106. Rzhetsky A Nei M Statistical properties of the ordinary least-squares, generalized least-squares, and minimum-evolution methods of phylogenetic inference J Mol Evol 1992 35 4 367 375 10.1007/BF00161174 1404422