==== Front J Dent Sci J Dent Sci Journal of Dental Sciences 1991-7902 2213-8862 Association for Dental Sciences of the Republic of China S1991-7902(22)00304-X 10.1016/j.jds.2022.11.020 Original Article Lidocaine intensifies the anti-osteogenic effect on inflammation-induced human dental pulp stem cells via mitogen-activated protein kinase inhibition Lee Sang-Hoon a Kim Cheul-Hong a Yoon Ji-Young a Choi Eun-Ji a Kim Mi Kyoung b Yoon Ji-Uk c Kim Hee Young c Kim Eun-Jung anekej@pusan.ac.kr a∗ a Department of Dental Anesthesia and Pain Medicine, School of Dentistry, Pusan National University, Dental Research Institute, Yangsan, Republic of Korea b Dental and Life Science Institute, School of Dentistry, Pusan National University, Yangsan, Republic of Korea c Department of Anesthesia and Pain Medicine, School of Medicine, Pusan National University, Yangsan, Republic of Korea ∗ Corresponding author. anekej@pusan.ac.kr 01 12 2022 7 2023 01 12 2022 18 3 10621072 1 11 2022 17 11 2022 © 2022 Association for Dental Sciences of the Republic of China. Publishing services by Elsevier B.V. 2022 Association for Dental Sciences of the Republic of China https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Background/purpose Human dental pulp stem cells (hDPSCs) are an emerging source of mesenchymal stem cells (MSCs) for bone tissue regeneration and engineering. In bone regeneration using transplanted MSCs, the extracellular environment or co-injected drugs can affect their success or failure. In this study, we investigated the effects and signaling mechanisms of lidocaine on osteogenic differentiation of hDPSCs after inducing inflammatory conditions with lipopolysaccharide (LPS) and tumor necrosis factor-alpha (TNF-α). Materials and methods To investigate the effect of lidocaine on the osteogenic differentiation of LPS/TNF-α-treated hDPSCs, alkaline phosphatase (ALP) and Alizarin red S (ARS) staining were conducted. The expression of osteogenesis-related genes was assessed using quantitative real-time polymerase chain reaction and western blotting. The expression of mitogen-activated protein kinases was analyzed to evaluate the effect of lidocaine on osteogenic differentiation of LPS/TNF-α-treated hDPSCs. Results Various concentrations of lidocaine (0.05, 0.2, and 1 mM) further decreased ALP and ARS staining of LPS/TNF-α-treated hDPSCs. Similarly, the mRNA and protein expression of osteogenesis-related genes was suppressed via lidocaine treatment in LPS/TNF-α-treated hDPSCs. Lidocaine treatment downregulated the protein expression of p-ERK and p-JNK in LPS/TNF-α-treated hDPSCs. Conclusion Lidocaine intensified the inhibition of osteogenic differentiation on inflammation-induced hDPSCs by inhibiting the ERK and JNK signaling pathways. This in vitro study suggested that lidocaine may have an inhibitory effect on bone regeneration. Keywords Dental pulp stem cell Inflammation Lidocaine Mitogen-activated protein kinases Osteogenic differentiation ==== Body pmcIntroduction In the field of tissue engineering and regenerative medicine, mesenchymal stem cells (MSCs) are gaining attention as a therapeutic tool for bone regeneration during various clinical bone loss conditions, such as osteoporosis, osteomyelitis, osteonecrosis, fracture, and bone defects.1 MSCs are isolated from various tissues, such as the bone marrow, adipose tissue, umbilical cord, and dental pulp.2,3 Among them, bone marrow–derived MSCs have been most widely used for bone regeneration, although the process of collection of MSCs from bone marrow is an invasive and painful procedure.4 Whereas, human dental pulp stem cells (hDPSCs) can be collected from discarded premolars or third molars, and the collection process is easy and minimally invasive.5 hDPSCs have many advantages, such as long in vitro survival time, high proliferation rate, and low immunosuppressive effect, compared to bone marrow–derived MSCs. In addition, several studies have reported that hDPSCs induce osteogenesis and bone regeneration similar to bone marrow–derived MSCs.6, 7, 8 Therefore, the use of hDPSCs for in vitro and in vivo experiments associated with bone tissue regeneration is increasing. For bone tissue engineering and regenerative medicine, various MSCs have been transplanted into diseased or damaged bone tissues via local injection or surgical implantation with bone tissue engineering scaffolds.9,10 The survival rate and regeneration capacity of transplanted MSCs are influenced by various factors, including bone defect size, tissue damage, bacterial infection, inflammation, and co-injectable drugs.11,12 Local anesthetics (LAs) are commonly used for pain treatment in various clinical fields such as regional anesthesia, local infiltration, and nerve blocking.13,14 During cartilage repair operations in orthopedic surgery, intra-articular administration of human MSCs is often performed in the regions surrounding the damaged ligament or tendon, accompanied by intra-articular injection of LAs.15,16 Therefore, it is important to elucidate the effects of LAs on the differentiation and regeneration capacities of MSCs for successful MSC-based regenerative therapy. Previous studies have reported that LAs have cytotoxic effects on various types of MSCs.17,18 However, these studies have some limitations, such as small sample size, heterogeneity of study design, and few studies on the effect of LAs on the cytotoxicity and osteogenic differentiation of hDPSCs.12 Inflammation can affect the osteogenic differentiation of MSCs.19,20 Lipopolysaccharide (LPS), an outer membrane component of gram-negative bacterial cells, is an important pathogenic factor in alveolar bone resorption and can suppress osteogenic differentiation of hDPSCs.21,22 In addition, a previous report stated that tumor necrosis factor-alpha (TNF-α), a proinflammatory cytokine, can impair osteogenic differentiation of hDPSCs.23 Lidocaine is the most widely used amide-type LAs, is known to have anti-inflammatory effects in many experimental studies, and has a cytotoxic effect on MSCs.24,25 These findings raise the question of how lidocaine influences osteogenic differentiation of hDPSCs induced by an inflammatory response, and there is no research yet to clarify this question. In this study, we aimed to investigate the effect of lidocaine on the osteogenic differentiation of hDPSCs after inflammatory stimulation with LPS and TNF-α. We also investigated the signaling mechanisms related to the effect of lidocaine on osteogenic differentiation of LPS/TNF-α-treated hDPSCs. Materials and methods Chemicals and reagents A 2% lidocaine HCL injection was purchased from Jeil Pharmaceutical (Daegu, Republic of Korea). LPS was obtained from Sigma-Aldrich (St. Louis, MO, USA) and recombinant human TNF-α was purchased from PeproTech (Cranbury, NJ, USA). Αlpha Modified Eagle's medium (α-MEM), fetal bovine serum (FBS), and penicillin/streptomycin were purchased from Gibco BRL Co. (Grand Island, NY, USA). Β-glycerophosphate, ascorbic acid, dexamethasone, and Alizarin red S (ARS) were obtained from Sigma-Aldrich. StemTAG™ Alkaline phosphatase (ALP) staining kit CBA-300 was purchased from Cell Biolabs, Inc. (San Diego, CA, USA). Primary antibodies against ALP (sc-27431), OPN (sc-21742), DMP1 (sc-73633), and actin (sc47778) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti- BMP2 (ab14933) antibodies were purchased from abcam (Cambridge, UK). Anti-Runx2 antibody was purchased from MBL (Woburn, MA, USA). Antibodies of extracellular signal regulated kinase (ERK, 9102S), p-ERK (9101S), c-Jun N-terminal kinase (JNK, 9252S), p-JNK (9251S), p38 (9218), and p-p38 (9211) were obtained from Cell Signaling Technology (Beverly, MA, USA). Cell culture hDPSCs (PT-5025, Lonza, Basel, Switzerland) were cultured in α-MEM supplemented with 10% FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin, and maintained in a 5% CO2 incubator at 37 °C. For osteogenic differentiation, hDPSCs were cultured in osteogenic differentiation medium (ODM; α-MEM containing 10 mM β-glycerophosphate, 100 μM ascorbic acid, and 100 nM dexamethasone) for 4, 7, 14, and 21 days. For the control group, hDPSCs were cultured in the growth medium. ODM was changed every 2 days. 3-(4,5-dimethylthiazol)-2,5-diphenyl tetrazolium bromide (MTT) assay To examine the effect of lidocaine treatment on cell viability and proliferation, hDPSCs were seeded in 24-well plates and treated with different concentrations of lidocaine (0, 0.05, 0.2, and 1 mM) and/or LPS (1 ng/mL)/TNF-α (10 ng/mL) for 1, 2, and 3 days. At the end of the culture period, the cells were placed in fresh medium containing 0.5 mg/mL of MTT solution and incubated for 4 h before the addition of 200 μL DMSO. The resultant blue formazan products in the hDPSCs were analyzed using a microplate reader at a wavelength of 570 nm. Alkaline phosphatase (ALP) staining hDPSCs were seeded in 48-well culture plates (5 × 104 cells/well) and incubated for 1 day. Cells were treated with lidocaine (0, 0.05, 0.2, and 1 mM) and LPS (1 ng/mL)/TNF-α (10 ng/mL) in control medium or ODM, and then cultured for 4 and 7 days. The culture medium was replaced with fresh medium every 2 days. ALP staining was performed 4 and 7 days after induction using a CBA-300 ALP staining kit, according to the manufacturer's protocol. Briefly, cultured cells were fixed in 4% paraformaldehyde, washed three times with PBS containing 0.05% Tween-20, and incubated with ALP staining solution for 15–30 min. Next, the ALP solution was removed, the cells were washed with PBS, and the ALP staining cells were observed under a microscope at a magnification. Alizarin red S (ARS) staining After 14 and 21 days of culture, the hDPSCs were washed twice with PBS and fixed in 4% paraformaldehyde for 15 min. Before cell staining, the fixative was removed and the cells were washed three times with distilled water. The cells were then stained with a 2% ARS staining solution (pH 4.2) for 10 min at room temperature. The ARS staining solution was removed and the cells were washed with distilled water. The cells were imaged using a digital camera, and the intensity of staining was quantified using the ImageJ program (NIH, Bethesda, MD, USA). RNA extraction and quantitative real-time polymerase chain reaction (PCR) Total RNA from hDPSCs was isolated using the RiboEx reagent (GeneAll, Seoul, Korea), as described by the manufacturer. One microgram of total RNA was reverse-transcribed into cDNA using a HiSenScript™ RH [-] RT PreMix Kit (INtRON Biotechnology, Seongnam, Korea). The synthesis conditions involved one cycle of 60 min at 42 °C. cDNA synthesis was inactivated by heating the sample for 10 min at 85 °C. Real-time PCR was performed using SYBR Green Q-PCR Master Mix with Low Rox kit (Applied Biosystems, Foster City, CA, USA) for 40 cycles of 15 s denaturation at 95 °C and 1 min amplification at 60 °C for all genes in the QuantStudio 1 real-time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The data are representative of three independent experiments, and the relative mRNA expression was determined using the comparative Ct (ΔΔCt) method. GAPDH was used as the reference gene for normalization. The primer sets used for the real-time PCR are listed in Table 1.Table 1 Primer sequences used for the real-time PCR. Table 1Gene Forward primer Reverse primer ALP GGACGCTGGGAAATCTGTG CCATGATCACGTCAATGTCC BMP2 TTCCACCATGAAGAATCTTTGG AAACCTGAAGCTCTGCTGAG DMP1 TAGGAAGTCTCGCATCTCAG CCAGTGTCTCTGGAGTTGC Runx2 TCCCAGTATGAGAGTAGGTGTCC GGCTCAGATAAGAGGGGTAAGAC OPN GCAACCGAAGTTTTCACTCC ATCAGGGTACTGGATGTCAG GAPDH TATGACTCTACCCACGGCAAGT ATACTCAGCACCAGCATCACC Abbreviations: ALP, alkaline phosphatase; BMP2, bone morphogenetic protein 2; DMP1, dentin matrix protein 1; Runx2, runt-related transcription factor 2; OPN, osteopontin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase. Western blot Cells were treated with a passive lysis buffer (Promega, Madison, WI, USA), followed by gentle sonication, and incubated for 30 min on ice. The supernatants were collected after centrifugation at 13,000 rpm at 4 °C for 10 min. Protein concentration in the lysates was determined using the Bradford protein assay kit (Bio-Rad Laboratories, Hercules, CA, USA). Proteins were mixed with the sample loading buffer and incubated at 100 °C for 5 min. Twenty micrograms of protein was loaded per lane, separated using 8% and 10% polyacrylamide gels, and transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). The blots were blocked with 5% nonfat milk for 30 min at room temperature. Membranes were incubated overnight at 4 °C with the appropriate primary antibodies. The membranes were washed thrice for 10 min using phosphate-buffered saline with Tween-20 (PBST). The membranes were then incubated with horseradish peroxidase-conjugated appropriate secondary antibodies for 60 min at room temperature, and washed with PBST thereafter. The membranes were treated with the enhanced chemiluminescence solution (Millipore) and chemiluminescence was detected using the LAS4000 (GE Healthcare Life Sciences, Buckinghamshire, UK). Actin expression was used as a control. The target protein bands were normalized relative to the control band using the ImageJ software (NIH). Statistics Values are presented as the mean ± standard error of the mean. The data were obtained from at least three independent experiments. Student's t-test was used to determine the significance of the differences between the two groups. Statistical significance was set at P < 0.05. Results Effect of LPS/TNF-α and lidocaine treatment on cell viability and proliferation of hDPSCs As shown in Fig. 1A, the results of the MTT assay showed that there was no cytotoxic effect of LPS/TNF-α and lidocaine (0.05, 0.2, and 1 mM) treatment on hDPSCs. Moreover, there was no significant difference in the proliferation of hDPSCs among lidocaine (0.05, 0.2, and 1 mM) with LPS/TNF-α treatments until day 3 (Fig. 1B).Figure 1 Effect of various concentrations of lidocaine (0, 0.05, 0.2, and 1 mM) and/or LPS (1 ng/mL)/TNF-α (10 ng/mL) on cell viability (A) and proliferation (B) of human dental pulp stem cells (hDPSCs) after 1, 2, and 3 days was evaluated using MTT assay. Fig. 1 Lidocaine has a negative effect on the osteogenic differentiation of LPS/TNF-α-treated hDPSCs To investigate the effect of lidocaine and/or LPS (1 ng/mL)/TNF-α (10 ng/mL) treatment on the osteogenic differentiation potential of hDPSCs, we conducted ALP and ARS staining. For osteogenic differentiation, hDPSCs were cultured in ODM for 7 days, and ALP staining was performed after 4 and 7 days. In the current study, LPS/TNF-α treatment significantly decreased ALP staining compared to the ODM group after 4 and 7 days, and all concentrations of lidocaine (0.05, 0.2, and 1 mM) significantly intensified the inhibitory effect of LPS/TNF-α on ALP staining after 7 days (Fig. 2A and B). In particular, the significant decrease in ALP staining was even greater when hDPSCs treated with LPS/TNF-α were treated with 1 mM lidocaine (P < 0.001). ARS staining was conducted after 14 and 21 days to examine the formation of mineralized calcium nodules related to osteogenic differentiation of hDPSCs. ARS staining showed that LPS/TNF-α treatment led to a significant decrease in mineralized calcium nodules compared with the ODM group after 14 and 21 days. This reduction was induced by lidocaine treatment in a dose-dependent manner compared to LPS/TNF-α group after 14 and 21 days (Fig. 2A, C). The reduction in ARS staining was most remarkable when LPS/TNF-α-treated hDPSCs were treated with 1 mM lidocaine for 21 days (P < 0.001). Therefore, LPS/TNF-α-treated hDPSCs were treated with 1 mM lidocaine for subsequent experiments.Figure 2 Effect of lidocaine on osteogenic differentiation in LPS/TNF-α-treated human dental pulp stem cells (hDPSCs). (A) The hDPSCs were treated with the indicated dose of lidocaine (0, 0.05, 0.2, and 1 mM) and LPS (1 ng/mL)/TNF-α (10 ng/mL) in control media or osteogenic differentiation media (ODM) for 4 and 7 days or 14 and 21 days. The cells were then fixed and stained for alkaline phosphatase (ALP) staining (after 4 and 7 days) or Alizarin red S (ARS) staining (after 14 and 21 days). Representative ALP (upper) and ARS (lower) stained images are shown. (B–C) The intensity of ALP and ARS staining was quantified. Results are presented as percentage of total area. #P < 0.05 versus ODM group, ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001 versus LPS/TNF-α group. Fig. 2 Lidocaine treatment suppressed the mRNA expression of osteogenesis-related genes in LPS/TNF-α-treated hDPSCs Next, we investigated the effect of lidocaine treatment on the mRNA expression of osteogenesis-related genes during the osteogenic differentiation of LPS/TNF-α-treated hDPSCs. The mRNA expression levels of ALP, Runx2, OPN, BMP2, and DMP1 were significantly upregulated in the ODM group compared to those in the control group. The mRNA expression level was elevated after 7 and 14 days, but the degree of increase was highest after 14 days, except for OPN (Fig. 3). LPS/TNF-α treatment significantly downregulated the mRNA expression of ALP, Runx2, OPN, BMP2, and DMP1 compared with the ODM group, and the downregulation of mRNA expression was strengthened using lidocaine treatment (1 mM). Downregulation of ALP, Runx2, BMP2, and DMP1 mRNA expression was significantly strengthened via lidocaine after 7 and 14 days (Fig. 3A, B, D, E). A significant downregulation of OPN mRNA expression via lidocaine was observed after 7 days (Fig. 3C).Figure 3 Effect of lidocaine on the mRNA expression of osteogenesis-related genes in LPS/TNF-α-treated human dental pulp stem cells (hDPSCs). The hDPSCs were treated with lidocaine (1 mM) and LPS (1 ng/mL)/TNF-α (10 ng/mL) in control media or osteogenic differentiation media (ODM) for 4, 7 and 14 days. Total RNA was isolated during osteogenic differentiation and analyzed using quantitative real-time polymerase chain reaction (PCR). The expression levels of human (A) ALP, (B) Runx2, (C) OPN, (D) BMP2, and (E) DMP1 genes were determined using real-time PCR. The expression levels in the control media were considered to be 1.0, and the values were normalized to GAPDH mRNA level. Data are expressed as mean ± standard deviation of three independent experiments in triplicate. #P < 0.05 versus ODM group, ∗P < 0.05, ∗∗P < 0.01 versus LPS/TNF-α group. Fig. 3 Protein expression of osteogenesis-related genes was suppressed by lidocaine treatment in LPS/TNF-α-treated hDPSCs The effect of lidocaine treatment on the protein expression of osteogenesis-related genes in hDPSCs was analyzed using western blotting after 7 and 14 days. As shown in Fig. 4A and B, the protein expression levels of ALP, Runx2, OPN, BMP2, and DMP1 were significantly decreased using LPS/TNF-α treatment compared to those in the ODM group after 14 days. The 1 mM lidocaine treatment significantly decreased the protein expression of osteogenic-related genes compared to that in the LPS/TNF-α group in hDPSCs after 14 days.Figure 4 Effect of lidocaine on the protein expression of osteogenesis-related genes in LPS/TNF-α-treated human dental pulp stem cells (hDPSCs). (A) The hDPSCs were treated with lidocaine (1 mM) and LPS (1 ng/mL)/TNF-α (10 ng/mL) in control media or osteogenic differentiation media (ODM) for 7 and 14 days, and the protein expression of ALP, Runx2, OPN, BMP2, and DMP1 was examined using Western blot. (B) The expression levels in the control media were considered to be 1.0, and the values were normalized to actin protein level. Data are expressed as mean ± standard deviation of three independent experiments in triplicate. #P < 0.05, ##P < 0.01, ###P < 0.001 versus ODM group, ∗P < 0.05, ∗∗P < 0.01 versus LPS/TNF-α group. Fig. 4 Lidocaine inhibited the activation of ERK and JNK signaling pathways in hDPSCs To investigate the role of mitogen-activated protein kinase (MAPK) pathways in the inhibitory effect of lidocaine on the osteogenic differentiation of LPS/TNF-α-treated hDPSCs, the protein expression of p-ERK, ERK, p-JNK, JNK, p-p38, and p38 was analyzed using western blotting. During the osteogenic differentiation of hDPSCs with ODM, the relative protein levels of p-ERK/ERK and p-JNK/JNK were significantly decreased using LPS/TNF-α treatment compared to those in the ODM group. In addition, 1 mM lidocaine treatment on LPS/TNF-α-treated hDPSCs significantly reduced the relative protein levels of p-ERK/ERK and p-JNK/JNK compared to those in LPS/TNF-α group of hDPSCs (Fig. 5A and B). These results were also demonstrated by the downregulation of p-ERK and p-JNK, as shown in Fig. 5D. As shown in Fig. 5C and D, lidocaine treatment significantly reduced the expression of p-p38 and relative protein levels of p-p38/p38 compared to those in LPS/TNF-α-treated hDPSCs, whereas the relative protein level of p-p38/p38 was significantly increased by LPS/TNF-α treatment compared to that in the ODM group.Figure 5 Effect of lidocaine on the expression of mitogen-activated protein kinase pathways in LPS/TNF-α-treated human dental pulp stem cells (hDPSCs) during osteogenesis. The hDPSCs were treated with lidocaine (1 mM) and LPS (1 ng/mL)/TNF-α (10 ng/mL) in control media or osteogenic differentiation media (ODM) for 14 days. The proteins were extracted and subjected to Western blot. (A–D) Immunoblots were developed using antibodies directed against p-ERK, p-JNK, and p-p38. ERK, JNK, and p38 were used as controls. All Western blot analyses were repeated three times. Band densitometry quantified by fluorChem 8900. #P < 0.05 versus ODM group, ∗P < 0.05 versus LPS/TNF-α group. Fig. 5 Discussion In this study, we aimed to evaluate the effects of lidocaine on osteogenic differentiation of LPS/TNF-α-treated hDPSCs. The main findings of our experiments were as follows: (1) LPS (1 ng/mL)/TNF-α (10 ng/mL) treatment had no cytotoxic effect on hDPSCs. Lidocaine treatment (0.05, 0.2, and 1 mM) along with LPS/TNF-α was also not cytotoxic to hDPSCs. (2) Inflammatory stimulation with LPS/TNF-α suppresses osteogenic differentiation of hDPSCs. Lidocaine treatment of LPS/TNF-α-treated hDPSCs amplified the inhibitory effect of LPS/TNF-α on osteogenic differentiation, thereby further diminishing the osteogenic differentiation of hDPSCs. (3) Lidocaine treatment decreases the phosphorylation of ERK and JNK in LPS/TNF-α-treated hDPSCs. This suggests that the inhibitory effect of lidocaine on the osteogenic differentiation of LPS/TNF-α-treated hDPSCs is mediated via the suppression of the ERK and JNK pathways. Several studies have identified the inhibitory effect of LPS or TNF-α on the osteogenic differentiation of MSCs and their associated signaling pathways.21, 22, 23 In vitro and in vivo studies by Li et al. reported that LPS impaired the osteogenic differentiation of human periodontal ligament stem cells via nuclear factor-kappa B (NF-κB) activation and increased alveolar bone loss.26 A study by Yuan et al. showed that administration of LPS decreased the osteogenic differential potential of DPSCs via activation of the HMGA2/PI3K/Akt signaling pathway.21 In addition, previous research has shown that TNF-α suppresses osteogenic differentiation of rat follicle stem cells through activation of the Wnt signaling pathway.27 However, some studies have reported the stimulatory effect of LPS or TNF-α on the osteogenic differentiation of MSCs.28, 29, 30 Therefore, the effect of LPS or TNF-α on the osteogenic differentiation of MSCs is still debated, and the signaling pathways involved remain unclear. To clarify the effect of LPS and TNF-α on the osteogenic differentiation of MSCs and to strengthen the inflammatory stimulation on DPSCs, we used LPS/TNF-α for the inflammatory stimulation on the DPSCs.30 Our results show that LPS/TNF-α suppressed the osteogenic differentiation of hDPSCs. In bone development and homeostasis, MAPKs play a critical role in the proliferation, differentiation, and apoptosis of MSCs, particularly in osteogenic differentiation.31,32 Here, we found that the inhibitory effect of lidocaine on the osteogenic differentiation of LPS/TNF-α-treated hDPSCs was mediated by the inhibition of the ERK and JNK signaling pathways. Several studies have shown a correlation between ERK activation and increased bone mineralization using MSCs, calvarial osteoblasts, and in vivo bone models.33,34 ERK is an upstream stimulator of Runx2, a critical regulator of the osteogenic differentiation of MSCs, and directly phosphorylates Runx2.35 Activated JNKs catalyze the phosphorylation of several substrates for the self-renewal and differentiation of various types of stem cells.36 Additionally, it has been reported that JNK activates AP-1 and ATF2, which are transcription factors involved in bone formation, and inhibition of JNK suppressed the late-stage osteoblast differentiation.37,38 The activation of p38 is also known to play a relevant role in the osteogenic differentiation of MSCs.39 In the present study, even if the phosphorylation of p38 was significantly decreased using lidocaine treatment in hDPSCs compared to the LPS/TNF-α group, the protein expression of p-p38 was increased using LPS/TNF-α treatment, which is inconsistent with the fact that LPS/TNF-α suppressed the osteogenic differentiation of hDPSCs and lidocaine amplified the inhibitory effect of LPS/TNF-α on the osteogenic differentiation of hDPSCs. Therefore, we concluded that the inhibitory effect of lidocaine and LPS/TNF-α on osteogenic differentiation of hDPSCs was not mediated through inhibition of the p38 pathway. In recent years, several studies have demonstrated that lidocaine has anti-inflammatory effects in various inflammatory models.24,40, 41, 42, 43, 44 Chen et al. showed that lidocaine ameliorated LPS-induced lung injury by inhibiting inflammation, which was mediated through suppression of the NF-κB and p38 signaling pathways.40 Zang et al. also reported that lidocaine inhibited the activation of the ERK/NF-κB pathway and led to the inhibition of inflammatory responses in a rat model.43 Previous studies have reported that lidocaine inhibits inflammatory effects through the inhibition of MAPK pathways. The cytotoxic effects of LAs, including lidocaine, have been reported previously. It has been shown that lidocaine has a cytotoxic effect on adipose-derived MSCs during early chondrogenic differentiation and attenuates the fibrogenic, chondrogenic, osteogenic, and adipogenic differentiation of bone marrow–derived MSCs, DPSCs, periodontal ligament stem/progenitor cells, and tendon-derived stem/progenitor cells.45, 46, 47 However, there have been no studies on the effect of lidocaine on the osteogenic differentiation of inflammation-induced MSCs. Therefore, this is the first study to demonstrate that lidocaine attenuates osteogenic differentiation of hDPSCs induced with LPS/TNF-α through the regulation of MAPK pathways. In addition, we demonstrated that the inhibitory effect of lidocaine on the osteogenic differentiation of hDPSCs was not related to cytotoxicity because lidocaine had no cytotoxic effect on the LPS/TNF-α-treated hDPSCs in our experiment. The present study had some limitations. First, the study was performed in vitro. To apply our results to MSC-based regenerative medicine, further in vivo and clinical studies are needed. Second, the inhibitory effect of lidocaine on the osteogenic differentiation of hDPSCs via the inhibition of ERK and JNK pathways was not confirmed through the use of ERK and JNK activators. If we had confirmed that the degree of staining was less reduced when lidocaine was administered after treatment with ERK and JNK activators in ALP or ARS staining, the ERK and JNK pathways associated with the inhibitory effect of lidocaine on osteogenic differentiation could have been more firmly established. In summary, we have shown that lidocaine has no cytotoxic effect on hDPSCs and intensified the inhibition of osteogenic differentiation on LPS/TNF-α-treated hDPSCs. In addition, we suggest that the inhibitory effect of lidocaine on the osteogenic differentiation of hDPSCs was mediated via inhibition of the ERK and JNK pathways. Our results indicated that lidocaine can have a negative effect on bone regeneration in bone tissue engineering and regenerative medicine. For more clarification, further studies on the effect of lidocaine on bone regeneration are required. Declaration of Competing Interest The authors have no conflicts of interest relevant to this article. Acknowledgments This study was supported by 2022 Clinical Research Grant, 10.13039/501100002543 Pusan National University Dental Hospital . ==== Refs References 1 Zomorodian E. Baghaban Eslaminejad M. Mesenchymal stem cells as a potent cell source for bone regeneration Stem Cell Int 2012 2012 980353 2 Zakrzewski W. Dobrzynski M. Szymonowicz M. Rybak Z. Stem cells: past, present, and future Stem Cell Res Ther 10 2019 68 30808416 3 Huang G.T. Gronthos S. Shi S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine J Dent Res 88 2009 792 806 19767575 4 Vezzani B. Pierantozzi E. Sorrentino V. Mesenchymal stem cells: from the perivascular environment to clinical applications Histol Histopathol 33 2018 1235 1246 29733091 5 Laino G. d'Aquino R. Graziano A. A new population of human adult dental pulp stem cells: a useful source of living autologous fibrous bone tissue (LAB) J Bone Miner Res 20 2005 1394 1402 16007337 6 Gan L. Liu Y. Cui D. Pan Y. Zheng L. Wan M. Dental tissue-derived human mesenchymal stem cells and their potential in therapeutic application Stem Cell Int 2020 2020 8864572 7 Lew W.Z. Huang Y.C. Huang K.Y. Lin C.T. Tsai M.T. Huang H.M. Static magnetic fields enhance dental pulp stem cell proliferation by activating the p38 mitogen-activated protein kinase pathway as its putative mechanism J Tissue Eng Regen Med 12 2018 19 29 27688068 8 Jensen J. Tvedesoe C. Rolfing J.H. Dental pulp-derived stromal cells exhibit a higher osteogenic potency than bone marrow-derived stromal cells in vitro and in a porcine critical-size bone defect model SICOT J 2 2016 16 27163105 9 Arinzeh T.L. Peter S.J. Archambault M.P. Allogeneic mesenchymal stem cells regenerate bone in a critical-sized canine segmental defect J Bone Joint Surg Am 85 2003 1927 1935 14563800 10 Mohanty S.T. Bellantuono I. Intra-femoral injection of human mesenchymal stem cells Methods Mol Biol 976 2013 131 141 23400439 11 Yu S.P. Wei Z. Wei L. Preconditioning strategy in stem cell transplantation therapy Transl Stroke Res 4 2013 76 88 23914259 12 Wu T. Shi Z. Song H. Li Y. Li J.H. Cytotoxicity of local anesthetics on rabbit adipose-derived mesenchymal stem cells during early chondrogenic differentiation Exp Ther Med 16 2018 2843 2850 30214505 13 Koyonos L. Yanke A.B. McNickle A.G. A randomized, prospective, double-blind study to investigate the effectiveness of adding DepoMedrol to a local anesthetic injection in postmeniscectomy patients with osteoarthritis of the knee Am J Sports Med 37 2009 1077 1082 19279226 14 Lavelle E.D. Lavelle W. Smith H.S. Myofascial trigger points Med Clin 91 2007 229 239 15 Ballieul R.J. Jacobs T.F. Herregods S. The peri-operative use of intra-articular local anesthetics: a review Acta Anaesthesiol Belg 60 2009 101 108 19594092 16 Buvanendran A. Thillainathan V. Preoperative and postoperative anesthetic and analgesic techniques for minimally invasive surgery of the spine Spine (Phila Pa 1976) 35 2010 274 17 Dregalla R.C. Lyons N.F. Reischling P.D. Centeno C.J. Amide-type local anesthetics and human mesenchymal stem cells: clinical implications for stem cell therapy Stem Cells Transl Med 3 2014 365 374 24436443 18 Breu A. Eckl S. Zink W. Kujat R. Angele P. Cytotoxicity of local anesthetics on human mesenchymal stem cells in vitro Arthroscopy 29 2013 1676 1684 23993145 19 Mountziaris P.M. Tzouanas S.N. Mikos A.G. Dose effect of tumor necrosis factor-alpha on in vitro osteogenic differentiation of mesenchymal stem cells on biodegradable polymeric microfiber scaffolds Biomaterials 31 2010 1666 1675 19963268 20 Tang Y. Liu L. Wang P. Chen D. Wu Z. Tang C. Periostin promotes migration and osteogenic differentiation of human periodontal ligament mesenchymal stem cells via the Jun amino-terminal kinases (JNK) pathway under inflammatory conditions Cell Prolif 50 2017 e12369 21 Yuan H. Zhao H. Wang J. MicroRNA let-7c-5p promotes osteogenic differentiation of dental pulp stem cells by inhibiting lipopolysaccharide-induced inflammation via HMGA2/PI3K/Akt signal blockade Clin Exp Pharmacol Physiol 46 2019 389 397 30575977 22 Kishimoto T. Kaneko T. Ukai T. Peptidoglycan and lipopolysaccharide synergistically enhance bone resorption and osteoclastogenesis J Periodontal Res 47 2012 446 454 22283724 23 Boyle M. Chun C. Strojny C. Chronic inflammation and angiogenic signaling axis impairs differentiation of dental-pulp stem cells PLoS One 9 2014 e113419 24 Caracas H.C. Maciel J.V. Martins P.M. de Souza M.M. Maia L.C. The use of lidocaine as an anti-inflammatory substance: a systematic review J Dent 37 2009 93 97 19058888 25 Nie H. Kubrova E. Wu T. Effect of lidocaine on viability and gene expression of human adipose-derived mesenchymal stem cells: an in vitro study Pharm Manag PM R 11 2019 1218 1227 26 Li C. Li B. Dong Z. Lipopolysaccharide differentially affects the osteogenic differentiation of periodontal ligament stem cells and bone marrow mesenchymal stem cells through Toll-like receptor 4 mediated nuclear factor kappaB pathway Stem Cell Res Ther 5 2014 67 24887697 27 Li X. Ren G. Cai C. TNFalpha regulates the osteogenic differentiation of bone morphogenetic factor 9 adenovirustransduced rat follicle stem cells via Wnt signaling Mol Med Rep 22 2020 3141 3150 32945435 28 Hess K. Ushmorov A. Fiedler J. Brenner R.E. Wirth T. TNFalpha promotes osteogenic differentiation of human mesenchymal stem cells by triggering the NF-kappaB signaling pathway Bone 45 2009 367 376 19414075 29 Huang H. Zhao N. Xu X. Dose-specific effects of tumor necrosis factor alpha on osteogenic differentiation of mesenchymal stem cells Cell Prolif 44 2011 420 427 21951285 30 Croes M. Oner F.C. Kruyt M.C. Proinflammatory mediators enhance the osteogenesis of human mesenchymal stem cells after lineage commitment PLoS One 10 2015 e0132781 31 Rodriguez-Carballo E. Gamez B. Ventura F. p38 MAPK signaling in osteoblast differentiation Front Cell Dev Biol 4 2016 40 27200351 32 Majidinia M. Sadeghpour A. Yousefi B. The roles of signaling pathways in bone repair and regeneration J Cell Physiol 233 2018 2937 2948 28590066 33 Jaiswal R.K. Jaiswal N. Bruder S.P. Mbalaviele G. Marshak D.R. Pittenger M.F. Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen-activated protein kinase J Biol Chem 275 2000 9645 9652 10734116 34 Ge C. Xiao G. Jiang D. Franceschi R.T. Critical role of the extracellular signal-regulated kinase-MAPK pathway in osteoblast differentiation and skeletal development J Cell Biol 176 2007 709 718 17325210 35 Ge C. Xiao G. Jiang D. Identification and functional characterization of ERK/MAPK phosphorylation sites in the Runx2 transcription factor J Biol Chem 284 2009 32533 32543 19801668 36 Semba T. Sammons R. Wang X. Xie X. Dalby K.N. Ueno N.T. JNK signaling in stem cell self-renewal and differentiation Int J Mol Sci 21 2020 2613 32283767 37 Kenner L. Hoebertz A. Beil F.T. Mice lacking JunB are osteopenic due to cell-autonomous osteoblast and osteoclast defects J Cell Biol 164 2004 613 623 14769860 38 Reimold A.M. Grusby M.J. Kosaras B. Chondrodysplasia and neurological abnormalities in ATF-2-deficient mice Nature 379 1996 262 265 8538792 39 Jaiswal R.K. Jaiswal N. Bruder S.P. Mbalaviele G. Marshak D.R. Pittenger M.F. Adult human mesenchymal stem cell differentiation to the osteogenic or adipogenic lineage is regulated by mitogen-activated protein kinase J Biol Chem 275 2000 9645 9652 10734116 40 Chen L.J. Ding Y.B. Ma P.L. The protective effect of lidocaine on lipopolysaccharide-induced acute lung injury in rats through NF-kappaB and p38 MAPK signaling pathway and excessive inflammatory responses Eur Rev Med Pharmacol Sci 22 2018 2099 2108 29687869 41 Feng G. Liu S. Wang G.L. Liu G.J. Lidocaine attenuates lipopolysaccharide-induced acute lung injury through inhibiting NF-kappaB activation Pharmacology 81 2008 32 40 17785997 42 Ma X. Yan W. He N. Lidocaine attenuates hypoxia/reoxygenationinduced inflammation, apoptosis and ferroptosis in lung epithelial cells by regulating the p38 MAPK pathway Mol Med Rep 25 2022 150 35244190 43 Zhang S. Li Y. Tu Y. Lidocaine attenuates CFA-induced inflammatory pain in rats by regulating the MAPK/ERK/NF-kappaB signaling pathway Exp Ther Med 21 2021 211 33500701 44 Yuan T. Li Z. Li X. Yu G. Wang N. Yang X. Lidocaine attenuates lipopolysaccharide-induced inflammatory responses in microglia J Surg Res 192 2014 150 162 24952412 45 Nie H. Kubrova E. Wu T. Effect of lidocaine on viability and gene expression of human adipose-derived mesenchymal stem cells: an in vitro study Pharm Manag PM R 11 2019 1218 1227 46 Kim Y.H. Park G.Y. Rabinovitch N. Tarafder S. Lee C.H. Effect of local anesthetics on viability and differentiation of various adult stem/progenitor cells Stem Cell Res Ther 11 2020 385 32894184 47 Wu T. Shi Z. Song H. Li Y. Li J.H. Cytotoxicity of local anesthetics on rabbit adipose-derived mesenchymal stem cells during early chondrogenic differentiation Exp Ther Med 16 2018 2843 2850 30214505