==== Front Breed Sci Breed Sci jsbbs Breeding Science 1344-7610 1347-3735 Japanese Society of Breeding JST.JSTAGE/jsbbs/22079 10.1270/jsbbs.22079 22079 Research Paper Effects of SpsNAC042 transgenic Populus hopeiensis on root development, leaf morphology and stress resistance Phenotypic analysis and stress resistance identification of SpsNAC042 transgenic Populus Fan Lijiao 1† Wei Dongshan 1† Yu Xingwang 1 Yu Fengqiang 2 Wang Jiameng 1 Sun Guirong 3 Alatengsuhe 3 Zhang Li 3 Zhang Guosheng 1 Yang Haifeng 1* 1 College of Forestry, Inner Mongolia Agricultural University, Hohhot 010018, China 2 Development Center of Forestry and Grassland, Ordos 017000, China 3 General Headquarters of Ordos Afforestation, Ordos 017000, China * Corresponding author (e-mail: haifeng@imau.edu.cn) Communicated by Masahiro Nishihara † These authors contributed equally to this work 4 2023 13 4 2023 73 2 180192 3 10 2022 12 12 2022 Copyright © 2023 by JAPANESE SOCIETY OF BREEDING 2023 https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution (BY) License (CC-BY 4.0: https://creativecommons.org/licenses/by/4.0/). To identify the function of the SpsNAC042 gene and its response to salt and drought stress, the SpsNAC042 gene was transformed into Populus hopeiensis by the Agrobacterium-mediated leaf disc method, and the phenotypic, physiological changes and related genes expression of transgenic lines were analyzed. The results showed that the number and length of roots of transgenic lines increased significantly. The leaves of transgenic lines curled inward. Under salt and simulated drought stress, the transgenic lines showed improved tolerance to salt and drought. The activities of SOD, POD, CAT and proline content in the transgenic lines were significantly increased, and the reduction rates of total chlorophyll and MDA content were significantly decreased, which indicated that the transgenic lines showed strong physiological responses under stress. Meanwhile, the gene expression of MPK6, SOS1, HKT1 and P5CS1 were significantly upregulated, and the gene expression of PRODH1 was significantly downregulated, which preliminarily verified the stress regulation mechanism that SpsNAC042 might activate. The above results showed that the SpsNAC042 gene could promote root development, make leaf morphology curl, and enhance P. hopeiensis tolerance to stress. SpsNAC042 gene stress tolerance ==== Body pmcIntroduction NAC is one of the unique transcription factor families unique to higher plants. The name of NAC family is composed of the first letters of NAM (no apical meristem) (Souer et al. 1996), ATAF1/2 and CUC (cup-shaped cotyledon) (Aida et al. 1997). Among this gene family, NAM was cloned from Petunia hybrida primitively, and ATAF1/2 and CUC2 were found in Arabidopsis. In recent years, more NAC transcription factors have been identified in Oryza sativa (Ooka et al. 2003), Arabidopsis (Nuruzzaman et al. 2010), Nicotiana tabacum (Rushton et al. 2008), Glycine max (Le et al. 2011) and other plants. Through statistical analysis, they were subdivided into different subfamilies, providing a research basis for future exploration and validation of the NAC family. Studies have shown that NAC transcription factors play an important regulatory role in plant growth and development (Olsen et al. 2005), and are also involved in abiotic stress responses of plants to drought, salinity and low temperature (Sun et al. 2012). Whole-genome identification of NAC transcription factors was performed in many plants, including cultivated peanuts and two wild ancestral species of peanut, Arachis duranensis and Arachis ipaensis. At the same time, the stress response-related NAC transcription factors AhNAC127, AhNAC87 and AhNAC117 were screened from RNA-seq data in cultivated peanuts, and were identified in response to drought and salt stress (Lu 2020). The NAC1 gene of Arabidopsis is a homologous sequence of SpsNAC042, and the function of NAC1 gene in more species has been gradually verified (Yu 2020). The stress-responsive NAC transcription factor gene GhSNAC1 cloned from Gossypium hirsutum was transformed into Nicotiana tabacum, and the drought and salt tolerance of transgenic lines were significantly improved (Wang et al. 2019). MdNAC1 was cloned in Malus domestica ‘Golden Delicious’, and overexpression of this gene in GL-3 apple enhanced the antioxidant capacity of the plant under drought stress conditions and alleviated the damage caused by drought stress suffered by the plant. The MdNAC1 expression in Lycopersicon esculentum similarly enhanced the resistance of the transgenic lines to drought stress (Jia 2019). Arabidopsis with VvNAC1 overexpressing exhibit enhanced tolerance to osmotic, salt and cold stresses (Le Hénanff et al. 2013). At the transcriptional level, the expression of TaNAC1 gene was induced by abiotic stress conditions such as PEG, ABA, low temperature and high salt (Ai et al. 2016). By heterologously expressing of the pumpkin transcription factor CmoNAC1 in Arabidopsis, it was found that transgenic lines got better salt tolerance (Cao 2020). With the more research works on abiotic stress resistance, the more stress resistance genes were verified in many plants. Research on transgenic salt-tolerant and drought-tolerant trees is an effective way to deal with soil salinization and desertification. The stress resistance research on woody plants has become an important reference for afforestation in frigid regions as to ecological construction. In 1994, salt-tolerant transgenic poplar was first obtained in China (Tian and Tan 2009). In 2000, the salt-tolerant gene mtl-D was transferred into Poplar × xiaozhannica and obtained the first batch of transgenic plants with high salt tolerance (Liu et al. 2000). In 2006, through the field release afforestation test, it was proven that the growth of Poplar × xiaozhannica was significantly increased and showed tough traits in medium saline soil, and it could be widely used in saline soil environmental governance (Yin et al. 2006). In 2014, the ZxZF transcription factor gene acted a significant role in improving the drought resistance of transgenic poplar and had important breeding value in cultivating excellent varieties of drought-resistant trees (Zhang et al. 2014). The overexpression of the chlAPX gene in Populus tomentosa showed higher stress resistance (antioxidant, drought resistance, salt tolerance) (Lang 2014). In 2015, P. simonii × P. euphratica ‘Liaohu 1’ and P. simonii × P. euphratica ‘Liaohu 2’ obtained by hybridization were tolerant to medium and mild saline alkali (Wang and Peng 2015a, 2015b). At present, the distribution of arid or semiarid regions in China has seriously hindered the development of the ecological environment, and research on drought-resistant and salt-resistant plants is of great importance. Populus hopeiensis is a unique natural hybrid of Populus davidiana × P. tomentosa in China. It is one of the main afforestation tree species in gully region and sandy region of the Loess Plateau, and is also an important tree species for soil and water conservation and timber forests (Liu 1998). However, the application of P. hopeiensis in some fragile habitats in northern China was still restricted. The tolerance of P. hopeiensis to adversity should be further improved, which is conducive to its great role in ecological construction and shelter forest construction. Salix psammophila is an important shrub species for sand-fixation afforestation in Northwest China and own the characteristics of drought resistance, salt-alkali resistance and sand resistance (Lu et al. 2020). In our study, the NAC042 gene isolated from S. psammophila was transformed into P. hopeiensis, and the phenotypic physiological and biochemical changes of transgenic lines under salt and simulated drought stress were analyzed to confirm their stress resistance. Materials and Methods Evolutionary tree construction of genes in Salix, Arabidopsis, and Populus The complete genome annotation information and sequences of Salix, Arabidopsis, and Populus were obtained from the Phytozome database (https://phytozome-next.jgi.doe.gov/). Multiple sequence alignment of NAC proteins was carried out using the Clustal Omega online (https://www.ebi.ac.uk/Tools/msa/clustalo/). The phylogenetic tree was constructed with MEGA X (MEGA X 10.2.5) using the neighbor-joining (NJ) method with 1000 bootstrap test replicates. Experimental materials and vector construction S. psammophila was sampled at the Germplasm bank of S. psammophila in Ordos Dalad, the Inner Mongolia Autonomous Region of China. The 1-year-old branches of S. psammophila clone (No. 11-30) were collected to clone the SpsNAC042 gene. The tissue culture seedlings of P. hopeiensis were cultured in the forest genetics and breeding department of Forestry College, Inner Mongolia Agricultural University. The SpsNAC042 gene was cloned into the overexpression vector pMDC32 driven by the 2 × 35s promoter and transformed into P. hopeiensis (Yu 2020). Agrobacterium tumefaciens strain GV3101 carrying the CaMV 35S::SpsNAC042 plasmid was stored in a refrigerator at –80°C. Agrobacterium-mediated transformation of P. hopeiensis leaf discs and PCR assay and relative expression levels of SpsNAC042 in positive lines Agrobacterium tumefaciens containing the 35S:SpsNAC042 recombinant plasmid was activated and transformed into wild-type P. hopeiensis by leaf discs (Horsch et al. 1985, Yu 2020). The CTAB method (Chen et al. 2004) was used to extract total DNA from leaves of resistant P. hopeiensis. Based on the CDS of SpsNAC042, the optimal primers were designed on primer 5 as SpsNAC042-F and SpsNAC042-R (Table 1). The SpsNAC042 gene fragment was amplified by PCR. The PCR amplification procedure was 94°C for 5 min, 35 cycles (94°C for 30 s, 62°C for 30 s, and 72°C for 1 min), and 72°C for 7 min. The samples were tested with 1% agarose gel. The whole plants of 17 positive lines (including shoots, leaves, and stems) were collected. RNA was extracted from plant samples by RNAprep Pure Plant Plus Kit (Polysaccharides & Polyphenolics-rich) (Tiangen, China). Complementary DNA (cDNA) is synthesized from the RNA template with a Super Script IV First-Strand Synthesis System kit (Invitrogen, USA). Real-time fluorescence quantitative PCR (RT-qPCR) was performed on a Roche Light Cycler 480 II with SYBR® Premix Ex TaqTM II (Tli RNaseH Plus). Each reaction was repeated three times and the quantitative data were calculated by 2–ΔΔCt method (Livak and Schmittgen 2001). Tissue-specific expression of SpsNAC042 in S. psammophila and relative expression levels of SOS1, MPK6, HKT1, P5CS1 and PRODH1 in overexpression lines Six different tissue parts of S. psammophila, including leaves, roots, shoots, soft stems, semi-lignified stems and mature stems, were collected. RNA was extracted from the six different tissue parts of S. psammophila and reverse transcribed to cDNA, and qRT-PCR was performed to detect expression of the SpsNAC042 gene. The primers for quantitative detection of the SpsNAC042 gene were qN1-F and qN1-R, and the primers for the internal reference gene were UBQ-F and UBQ-R (Yang et al. 2021). The primers for the internal reference gene of P. hopeiensis were ACT-F and ACT-R (Table 1). The expressions of the SOS1, MPK6, HKT1, P5CS1 and PRODH1 genes under different treatments were detected via qRT-PCR. The primers for gene quantification were SOS1-F1, SOS1-R1, MPK6-F1, MPK6-R1, HKT1-F1, HKT1-R1, P5CS1-F1, P5CS1-R1, PRODH1-F1 and PRODH1-R1 (Table 1), and the internal reference gene primer for the P. hopeiensis genes were ACT-F and ACT-R. The primer sequences of the SOS1, MPK6, HKT1, P5CS1 and PRODH1 genes were designed by Primer 3 input (Whitehead Institute for Biomedical Research, Massachusetts, USA, https://bioinfo.ut.ee/primer3-0.4.0/). Transplantation before plant stress, phenotypic observation and determination of growth indexes Tissue culture seedlings of transgenic P. hopeiensis and wild-type were transferred to the pots, and cultured in the mixed substrate with peat soil and vermiculite (2:1) in it at 25°C with 16 h/8 h light/dark cycle. The seedlings were moved into the greenhouse (25°C) after 2 weeks. The root and leaf morphology of wild-type and transgenic lines cultured for 60 d were observed and counted, and the number of roots, root length and fresh weight were measured. The stress treatment was kept for 7 days, with water as the control group, 0.9% NaCl solution and 10% PEG solution as the experimental group, and each treatment was repeated three times. After 7 days, the phenotypic changes of each line were observed, and the functional leaves (3–6 pieces) of each line were sampled and preserved. Each treatment was repeated three times. Salt and drought treatments and determination of total chlorophyll, SOD, POD, CAT, MDA and Pro The 3 different treatments on the transgenic lines and wild-type, including water, salt and simulated drought stress, were performed and kept for 7 days. The fresh leaves of wild-type and transgenic P. hopeiensis lines under water, salt and simulated drought stress were collected and cut into filaments with a width of 2 mm. The filaments were extracted with a mixture of acetone and ethanol (volume ratio 1:1) for 24 h. The absorbance was measured at 663 nm, 645 nm, and 470 nm by spectrophotometer, and the total chlorophyll content was calculated (Zhang 2016). A superoxide dismutase (SOD) activity, peroxidase (POD) activity, catalase (CAT) activity, malondialdehyde (MDA) content, and proline (PRO) content detection kit (BC0170, BC0090, BC0200, BC0020, and BC0290 Solarbio, China). Statistical analysis All statistical data were subjected to three biological replicates. Excel 2019, F-test (two-sample ANOVA), t-test (two-sample equal/heteroscedasticity hypothesis) and one-way ANOVA for randomized block design (Ning 2012). The results of one-way ANOVA for randomized block design are labeled using lowercase letters. Other significance was designated as follows: *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Results Functional prediction of the SpsNAC042 gene To preliminarily predict the function of SpsNAC042 gene, the SpsNAC042 protein motif and comparative analysis of its homologous genes were performed. SpsNAC042 was cloned from S. psammophila and named after NAC gene classification in Populus trichocarpa (Hu et al. 2010). Subdomain A, subdomain B, subdomain C, subdomain D and subdomain E were the typical structural domains of NAC proteins with highly conserved NAM structural domains (Fig. 1A). SpsNAC042 contains a complete NAM domain (A–E) (Supplemental Fig. 1). According to the phylogenetic tree of NAC proteins between Arabidopsis and S. psammophila published by our research group, we found that SpsNAC042 was clustered into the NAC-a subfamily, and the typical gene in this subfamily was CUC (Yang et al. 2022). Our study reanalyzed the evolution of some NAC proteins in Arabidopsis, Salix, and Populus based on the clustering of NAC-a subfamilies (Fig. 1B). Transcription factor CUC involves in the coordination of ovule formation (Guo et al. 2005), which can limit leaf growth through cell cycle inhibition (Li et al. 2020), construct plant structure and morphogenesis (Bouré et al. 2022), and negatively regulate cell growth factors (Serra and Perrot-Rechenmann 2020). SpsNAC042 was obtained from homologous cloning of AT1G56010.2 (NAC1), Potri.007G065400.1 and Sapur.007G058700.1 (Yu 2020). We can predict the function of SpsNAC042 gene by homologous genes (Supplemental Fig. 2). Overexpression of ZmNAC1 in Arabidopsis increased lateral roots (Li et al. 2012). Arabidopsis with VvNAC1 overexpressing exhibit enhanced tolerance to osmotic, salt and cold stresses (Le Hénanff et al. 2013). According to the existing studies on the function of homologous genes, we predicted that SpsNAC042 gene might affect the growth of plant lateral roots and respond to abiotic stress and stress from some pathogens. Tissue-specific expression of the SpsNAC042 gene in S. psammophila In order to explore the tissue-specific expression of SpsNAC042 gene, the relative expression levels of NAC042 gene in leaves, roots, shoots, soft stems, semi-lignified stems and mature stems were determined. The results showed that SpsNAC042 had the highest expression level in shoots and the lowest expression level in semi-lignified stems (Fig. 2). Data analysis showed that the relative expression levels of SpsNAC042 in shoots, leaves and soft stems were significantly different (p < 0.05). However, there was no significant difference among the roots, semi-lignified stems and mature stems among the three tissues (p > 0.05). Acquisition of SpsNAC042 gene overexpression lines, PCR identification, and SpsNAC042 gene relative expression level in transgenic P. hopeiensis To obtain SpsNAC042 gene in overexpression lines, the constructed overexpression vector CaMV 35S::SpsNAC042 (Fig. 3A) was transformed into wild-type P. hopeiensis by the Agrobacterium-mediated leaf disc method. The resistant shoots (Fig. 3B) were obtained by antibiotic screening, and the resistant lines (Fig. 3C) were identified by PCR. The size of the bands obtained by PCR was the same as the expected band size (Fig. 3D). To select the high-expression transgenic lines, the relative expression level of the SpsNAC042 gene was analyzed in 17 positive lines of P. hopeiensis by qRT-PCR (Fig. 3E). The results showed that the expression of OE-11 was the highest, followed by OE-7 and OE-12. The relative expression levels of OE-3, OE-5, OE-7, OE-9, OE-11, OE-12, OE-15 and OE-18 were significantly higher. The OE-11, OE-7 and OE-12 lines with high expression were selected for stress treatment. Changes of root growth in SpsNAC042 overexpression P. hopeiensis In order to identify the SpsNAC042 gene influences on root phenotypic changes, the root’s number and length of OE-11, OE-7, OE-12 and wild-type plants cultured for 60 days were measured. The statistical results showed that the average root number of OE-11, OE-7 and OE-12 increased by 60.42%, 35.42% and 8.33% compared with wild-type (Fig. 4A). The average root length of OE-11, OE-7 and OE-12 increased by 135.45%, 99.09% and 48.18% compared with wild-type (Fig. 4B). The above results showed that the root’s number and length of transgenic lines was significantly higher than those of wild-type (Fig. 5). Among them, the number and length of roots of OE-11 and OE-7 were very significant, and OE-12 was significant. Changes of leaf morphology in SpsNAC042 overexpression P. hopeiensis To explore the effects of SpsNAC042 on leaf morphology, we compared the leaf morphology between transgenic lines and wild-type. The results showed that the mature leaves of OE-11, OE-7 and OE-12 were curled inward and the leaf margin was shrunk, while the leaves of wild-type grown in the same culture environment were flat without curl phenotype (Fig. 6). The results showed that SpsNAC042 overexpression affected the development of leave morphology. Morphological changes of SpsNAC042-overexpressing P. hopeiensis under stress treatment To study the effect of stress on plant growth, the transgenic lines and wild-type were subjected to salt and simulated drought stress, and the changes in plant phenotype were observed. 7 days later, the leaves of transgenic lines remained alive under salt stress, but the leaves of wild-type gradually turned yellow from leaf margin to petiole (Fig. 7A). Most leaves of transgenic lines remained alive under simulated drought stress, while the leaves of wild-type turned dehydrated and shrunk (Fig. 7B). The above results showed that the transgenic lines enhanced their tolerance to salt and drought environments. The aboveground fresh weight and underground fresh weight of SpsNAC042-overexpressing P. hopeiensis under stress In order to explore the effect of SpsNAC042 gene on plant water loss under stress, the aboveground and underground fresh weights of P. hopeiensis under stress treatment were measured. The statistical data showed that the aboveground fresh weight of the OE-11, OE-7 and OE-12 was 1.33, 1.24 and 1.18 times higher than that of wild-type under salt treatment. Under simulated drought stress, the aboveground fresh weight of the OE-11, OE-7 and OE-12 was 1.48, 1.53 and 1.46 times higher than that of wild-type. Among them, the aboveground fresh weight of each transgenic line was significantly higher than control group (Fig. 8A). The results showed that the water loss of transgenic lines was lower than that of wild-type under stress, SpsNAC042 gene reduced the water loss of transgenic lines. The data showed that under salt stress, the underground fresh weight of OE-11, OE-7 and OE-12 was 2.19, 2.11 and 1.83 times than that of wild-type. The underground fresh weight of OE-11, OE-7 and OE-12 was 2.39, 2.32 and 1.95 times than that of wild-type under simulated drought stress. The results showed that the underground biomass of transgenic lines was significantly higher than that of wild-type under stress (Fig. 8B), and this conclusion is consistent with the phenotype of lateral roots significantly increasing in transgenic lines. It was verified again that SpsNAC042 gene has growth-promoting effect on lateral root development of P. hopeiensis, and has positive effect on the increase of underground biomass. The total chlorophyll content of SpsNAC042-overexpressing P. hopeiensis under stress To explore the effect of SpsNAC042 gene on photosynthesis in transgenic lines under stress, the total chlorophyll contents of P. hopeiensis under stress treatment were determined. Non-stress treatment, the total chlorophyll contents were significantly decreased by 19.15%, 24.43% and 15.76% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. Under salt stress, the total chlorophyll contents were significantly increased by 18.68%, 22.25% and 15.93% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. Under simulated drought stress, the total chlorophyll contents were significantly increased by 22.59%, 29.60% and 36.73% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. The results showed that the total chlorophyll contents of transgenic lines increased significantly compared with wild-type under stress, however and the chlorophyll contents of transgenic lines decreased significantly in non-stress treatment (Fig. 9). The results showed that salt and drought stress caused obvious damage to the normal synthesis of chlorophyll in plants, and SpsNAC042 gene may play protective role in maintaining the normal operation of chlorophyll synthesis or chlorophyll structure in plants to some extent. The activities of SOD, POD and CAT of SpsNAC042-overexpressing P. hopeiensis under stress To confirm the adaptation of transgenic lines to stresses, the SOD, POD and CAT activities of stress-treated plants were determined. Under salt stress, the SOD activities were significantly increased by 103.04%, 87.88% and 74.29% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the POD activities were significantly increased by 87.11%, 57.42% and 43.75% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the CAT activities were significantly increased by 142.31%, 61.54% and 55.77% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. Under simulated drought stress, the SOD activities were significantly increased by 50.06%, 35.26% and 27.92% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the POD activities were significantly increased by 69.49%, 54.66% and 23.31% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the CAT activities were significantly increased by 123.40%, 53.19% and 46.81% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. The above results showed that the SOD, POD and CAT activities of transgenic lines were significantly higher than those of wild-type under stress (Fig. 10). Meanwhile, SpsNAC042 can enhance the activity of SOD, POD and CAT to maintain the normal physiological process of transgenic lines under stress and reduce damage to plants. Changes of the Pro and MDA contents of SpsNAC042-overexpressing P. hopeiensis under stress To further explore the damage degree’s differences between transgenic lines and wild-type of P. hopeiensis under stress, we measured the content of Pro and MDA in plants. Proline is one of the most important osmoregulatory substances in plants and can scavenge free radicals and improve antioxidant enzyme protection. MDA is the final decomposition product of membrane lipid peroxidation, and its content can reflect the degree of stress injury to plants. Under salt stress, the Pro content were significantly increased by 2.81, 1.80 and 2.08 times in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the MDA content were significantly decreased by 27.39%, 16.88% and 10.63% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. Under simulated drought stress, the Pro content were significantly increased by 1.66, 1.17 and 1.12 times in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the MDA content were significantly decreased by 46.59%, 41.36% and 37.16% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. The results showed that the content of Pro in transgenic lines increased significantly under stress (Fig. 11A), but the MDA content of transgenic lines was significantly lower than those of wild-type under stress (Fig. 11B). This conclusion indicates that the membrane system of cells in transgenic lines was protected, the degradation of protein in cells slowed down, and the adaptability to stress became stronger. We could infer that the overexpression of the SpsNAC042 gene reduced the damage to plant cells under osmotic stress and made transgenic lines improved tolerance. Upregulated and downregulated expression of MPK6, SOS1, HKT1, P5CS1 and PRODH1 genes in transgenic P. hopeiensis under stress To analyze the possible regulatory pathways of SpsNAC042 gene, changes in the expression levels of MPK6, SOS1, HKT1, P5CS1 and PRODH1 were examined. Under salt stress, the MPK6 relative expression levels were significantly increased by 199.39%, 132.91% and 116.43% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the SOS1 relative expression levels were significantly increased by 113.46%, 77.62% and 69.33% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the HKT1 relative expression levels were significantly increased by 532.66%, 411.06% and 397.13% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the P5CS1 relative expression levels were significantly increased by 168.46%, 78.03% and 77.74% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the PRODH1 relative expression levels were significantly decreased by 60.32%, 44.00% and 43.25% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. Under simulated drought stress, the MPK6 relative expression levels were significantly increased by 161.97%, 118.73% and 90.94% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the SOS1 relative expression levels were significantly increased by 108.20%, 74.10% and 48.30% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the HKT1 relative expression levels were significantly increased by 416.98%, 313.99% and 318.73% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the P5CS1 relative expression levels were significantly increased by 234.81%, 211.37% and 129.60% in OE-11, OE-7 and OE-12 compared with wild-type, respectively; the PRODH1 relative expression levels were significantly decreased by 50.62%, 38.65% and 45.38% in OE-11, OE-7 and OE-12 compared with wild-type, respectively. These results indicate that the expression levels of MPK6, SOS1, HKT1 and P5CS1 in transgenic lines were significantly increased, but the expression level of PRODH1 in transgenic lines was significantly decreased (Fig. 12). Therefore, SpsNAC042 promoted the expression of the MPK6, SOS1, HKT1 and P5CS1, but repression of PRODH1 gene expression maintained the ion balance in plants and activated a series of metabolic reactions to alleviate the damage caused by stress to plants. Discussion SpsNAC042 gene promotes the root development of plants SpsNAC042 gene promotes the growth and development of plant roots. In our study, the root number, root length and underground fresh weight of SpsNAC042 transgenic lines increased significantly. Xie first proposed that NAC1 has been proven was a lateral root regulatory factor, and its expression was related to auxin signaling pathway during lateral root development (Xie et al. 2000). It was found that GUS driven by the upstream regulatory region of NAC1 was specifically expressed in root meristem, lateral root primordium base and lateral root, which may be involved in auxin and gibberellin signaling pathways to promote lateral root development (Wang et al. 2006a, 2006b). NAC1 was proven to be independent of auxin in adventitious root regeneration of leaf explants, and it was speculated that NAC family genes may have different roles in organ formation and regeneration, while NAC1 may have roles in lateral root and adventitious root formation in response to different upstream regulators (Chen et al. 2016). According to the above studies on NAC1 gene function verification and regulation mechanism, it has been proved that NAC1 transcription factor can positively regulate the lateral root development of plants. In our study, we also demonstrated that SpsNAC042 gene promotes root development, the increase in root number, root length and underground fresh weight in transgenic lines was significantly higher than those of wild-type. It was further verified that NAC042 gene also promoted lateral root development in woody plants. Effect of SpsNAC042 gene on leaf morphological development of plants We found the leaves of SpsNAC042 transgenic lines showed curled phenotype. Then we think SpsNAC042 gene influences morphological development of transgenic poplar leaves. In Arabidopsis, the overexpression of TaNAC1 gene would cause the transgenic plants to have abnormal leaf development and slow growth, plant dwarfing and stem fusion (Ai et al. 2016). The overexpression of ATAF2 gene in Arabidopsis led to leaf yellowing and dwarfing of transgenic plants. The reason may be that ATAF2 gene activated the expression of NIT gene which changed the synthesis of auxin in transgenic plants, thus affecting the development of plants (Huh et al. 2012). The above studies confirmed that genes have a significant impact on the morphological development of different organs by regulating hormone levels in plants. We can also speculate that the leaf rolling of transgenic poplars is the result of plant hormone response. The poplar leaves overexpressing SpsNAC042 showed an inward curling phenotype, which may also be due to the influence of plant gravity regulation, but there is no relevant research to prove it. In our study, although NAC042 transgenic lines have different degrees of abnormal leaf development, due to too many factors affecting plant leaf morphogenesis, whether the SpsNAC042 gene is directly involved in regulating plant leaf morphogenesis needs to be further confirmed. SpsNAC042 enhances tolerance of plants to salt and simulated drought stress Our study confirmed the SpsNAC042 showed improved tolerance to salt and simulated drought stress. Yue found that the StNAC1-overexpressing transgenic tobacco with salt-treated had more proline content, and accumulated less ROS with higher seed germination rate and green leaf rate, which improved the salt tolerance of transgenic tobacco (Yue et al. 2021). HcNAC1 has been identified to play an important regulatory role in response to drought stress in Hibiscus cannabinus (Deng et al. 2021). PeNAC1 can be used to improve the salt tolerance and quality of oat through molecular breeding (Liang et al. 2021). The quantitative results showed that the expression of AcoNAC1 gene in pineapple was induced by low temperature and drought stress, which was involved in the stress response of pineapple (Tan et al. 2021). In combination with the above studies, we found that the ability of the NAC1 gene to resist abiotic stresses has gradually been verified in more plants. Our results showed that under salt and simulated drought treatment, the aboveground fresh weight, total chlorophyll content, SOD, POD, CAT activity and Pro content of SpsNAC042-overexpressing transgenic poplar were significantly higher than those of wild-type, and MDA content was significantly lower than that of wild-type. Under stress, excessive NaCl and PEG destroy the chlorophyll structure, thereby increasing the activity of related chlorophyll enzymes and ultimately hindering chlorophyll synthesis (Gao et al. 2018). However, in our study, the total chlorophyll content of the transgenic lines under stress was higher, the plant damage was lighter, and the tolerance was stronger. We further determined three different antioxidant enzyme activities (SOD, POD and CAT) and MDA content in SpsNAC042-overexpressing transgenic poplar. The analysis of SOD, POD and CAT activities showed that the overexpressing lines produced more SOD, POD and CAT enzymes under stress than control group, which could eliminate reactive oxygen species and weaken the toxic effect of H2O2 on plant cells, so transgenic lines could protect the plasma membrane system, thereby enhanced the ability of plants to resist stress. However, the MDA content in transgenic plants was significantly lower than that of wild-type, which directly reflected SpsNAC042-overexpression poplar had less damage to biofilm structure and get back to normal physiological and biochemical processes soon. The above analysis results showed that the SpsNAC042 played a positive regulatory role in salt and drought resistance, which made up for the research gap of SpsNAC042 gene in woody plants and provided more choices for the salt-tolerant and drought-tolerant tree species. Regulatory mechanism of Na+ transporter pathway, proline synthesis and decomposition genes by SpsNAC042 in alleviating stress We analyzed the expression changes of a series of genes related to stress regulatory mechanisms such as MPK6, SOS1, HKT1, P5CS1 and PRODH1. The SpsNAC042 gene enhanced the expression of the MPK6, SOS1, HKT1 and P5CS1 genes, but inhibited PRODH1 gene expression in transgenic poplars. MPK6 is a mitogen-activated protein kinase, and MAPK cascade pathway can be activated by various stresses and plays an important role in the response of plants to abiotic stresses (Zhang and Liu 2001). SOS pathway is a signal transduction pathway of abiotic stresses in plants that encodes plasma membrane Na+/H+ reverse transporter and is closely related to salt tolerance of plants (Zhu 2000). Its main function is responsible for intracellular Na+ efflux (Qiu et al. 2002). In the SOS pathway, MAPK6 (mitogen-activated protein kinase 6) is also involved in this signal transduction pathway. MAPK6 binds to phosphatic acid and is then activated. Activated MAPK6 binds to SOS1 and completes the activity of Na+ efflux from cells (Yu et al. 2010). HKT1 plays a role in plant physiological Na+ toxicity (Rubio et al. 1995). P5CS is a key enzyme in proline biosynthesis (Kishor et al. 2005). PRODH is a rate-limiting enzyme in the proline decomposition pathway (Funck et al. 2010). MPK6 (Yu et al. 2010), SOS1 (Chang 2019) and HKT1 (Berthomieu et al. 2003) play a crucial role in plant tolerance to salt. P5CS1 gene in Arabidopsis is induced by high salt and drought stress (Yoshiba et al. 1995). The antisense inhibition of PRODH gene improves the drought and salt tolerance of Arabidopsis (Nanjo et al. 1999). In our study, the expression of MPK6, SOS1, HKT1 and P5CS1 genes were significantly increased under salt stress and drought stress, and the expression of PRODH1 gene was significantly decreased under stress, indicating that SpsNAC042 gene may positively regulate MPK6, SOS1, HKT1 and P5CS1 genes, and negatively regulate PRODH1 gene, which contribute to ion balance within plants under stress, and accumulate proline content, maintain plant stability and enhance plant resistance. Relationship between root development and tolerance improvement in transgenic lines The overexpression of SpsNAC042 gene has a significant effect on the increase of plant root number and root length. The developed root system is an important guarantee for plants to obtain water and nutrients, and it is also a direct contact part of the soil. In the case of soil water deficit, the growth and development of plants depend on the water stored in the soil, which makes the roots grow rapidly under stress conditions to absorb water (Price et al. 2002). Therefore, the root number and length of plants are closely related to the establishment of plant tolerance. With the aggravation of drought stress, Potentilla ansrina and Potentilla bifurca responded to the damage caused by stress by increasing total root length, total surface area, volume and average root diameter (Zhang 2020). Under drought stress, root tip number, root dry weight, total root length, total root surface area and xylem area, as well as vascular bundle diameter and area of vascular bundles and bast in roots were significantly higher in strongly drought-tolerant alfalfa (Longzhong) than in medium drought-tolerant (Longdong) and drought-sensitive (Gannon No.3) alfalfa (Zhang et al. 2019). All of the above studies have shown that plants can improve water transport capacity and ensure plant survival under stress conditions by altering root morphology and internal conduction tissues. In our study, the increase in the root number and root length of SpsNAC042-overexpressing poplar may absorb more water for plants in environmental adversity to maintain plant vitality and make an important contribution to plant resistance to stress. Therefore, SpsNAC042 gene may directly or indirectly improve plant resistance by regulating the root number and root length. In addition, although SpsNAC042-overexpressing poplar had well-developed roots, transgenic poplar was somewhat stunted under non-stress condition. That maybe imply SpsNAC042 influenced the height growth of overexpression lines. So we are considering it would be a good solution that root-specific expression vectors are used to drive the SpsNAC042 gene in poplar transformation. Then well-developed root system will provide more nutrients and water for plant growth, and the aboveground part of transgenic poplar would escape from the developmental disadvantage. Alternatively, grafting may be a viable option to eliminate SpsNAC042 negative effect on the aboveground part of transgenic poplar. SpsNAC042-overexpressing poplar could be used as the rootstock in grafting of near-source species. With the rapid development of plant genetic engineering technology, resistant plants bred using transgenic technology will be one of the important choices for future afforestation projects. In conclusion, the study of SpsNAC042 provides a research basis for the subsequent excavation of NAC genes and provides ideas for exploring other resistance genes from S. psammophila. Conclusion The NAC042 gene was cloned from S. psammophila and eventually obtained in SpsNAC042-overexpressing P. hopeiensis. Expression of the SpsNAC042 gene promoted root development, affected leaf morphology, and enhanced tolerance to salt and simulated drought stresses. Under non-stress, the root length of SpsNAC042-overexpressing P. hopeiensis increased significantly and the leaves showed curled phenotype. Under salt and drought stress, the overexpression of SpsNAC042 gene effectively increased SOD activity, POD activity, CAT content and Pro content, and reduced MDA accumulation to maintain the normal physiological state of plants to resist the damage caused by stress. At the same time, it was found that SpsNAC042 gene could positively regulate the expression of SOS1, MPK6, HKT1 and P5CS1 genes, and negatively regulate the expression of PRODH1 gene. SpsNAC042 plays an important role in the regulation of Na+ transporter pathway, proline synthesis and decomposition during stress. Author Contribution Statement FLJ was a major contributor in writing the manuscript. WDS analyzed the data and make figures. YXW completed the vector construction. WJM assisted in the sample collection. YFQ, SGR, Alatengsuhe, ZL provided plant material (S. psammophila). ZGS and YHF provided guidance and advice on stress methods in earlier stages of this study. Supplementary Material Supplemental Figures Acknowledgments This work was supported by the Key Technology Research Project of Inner Mongolia Autonomous Region (2021GG0075), the National Key Program on Transgenic Research (2018ZX08020002-005-005) and the National Natural Science Foundation of China (31660216). Fig. 1. Evolution and protein structure of SpsNAC042 homologous gene. (A) Schematic diagram of NAC transcription factor structure (Puranik et al. 2012); (B) Phylogenetic analysis of NAC-a proteins from Salix, Arabidopsis, and Populus. Fig. 2. Tissues relative expression level of SpsNAC042 in S. psammophila. Error bars represent ± SD from three biological repeats. These samples used the One-way ANOVA for a randomized block design. As long as there was one same marked letter, the difference was not significant, and the difference was significant if there was a different marked letter. Generally, lowercase letters indicate the significance level α = 0.05. Fig. 3. Identification of resistant lines of P. hopeiensis. (A) The overexpression vector CaMV 35S::SpsNAC042; (B) The resistant shoots of P. hopeiensis; (C) The rooting plants of P. hopeiensis; (D) Agarose gel assay of PCR amplified target genes from P. hopeiensis resistant lines; (E) Determination of relative gene expression in SpsNAC042 positive lines. These samples used the One-way ANOVA for a randomized block design. As long as there was one same marked letter, the difference was not significant, and the difference was significant if there was a different marked letter. Generally, lowercase letters indicate the significance level α = 0.05. Fig. 4. Root growth changes of transgenic P. hopeiensis. (A) Statistics of root number of transgenic P. hopeiensis; (B) Statistics of root length of transgenic P. hopeiensis. (Means ± S.D.) These averages are the average of three individual measurements. The significance of differences was determined based on t-test and F-test. *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Fig. 5. Root status of transgenic P. hopeiensis. Root scale = 10 cm. Fig. 6. Leaf morphological changes of transgenic P. hopeiensis. Scale = 3 cm. Fig. 7. Morphological changes in P. hopeiensis under stress. (A) Morphological changes under salt stress; (B) Morphological changes under simulated drought stress, Scale = 10 cm. Fig. 8. Biomass statistics of transgenic P. hopeiensis under stress. (A) The aboveground fresh weight of P. hopeiensis under stress; (B) The underground fresh weight of P. hopeiensis under stress. (Means ± S.D.) These averages are the average of three individual measurements. The significance of differences was determined based on t-test and F-test. *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Fig. 9. Total chlorophyll content of P. hopeiensis under stress. (Means ± S.D.s) These averages are the average of three individual measurements. The significance of differences was determined based on t-test and F-test. *** p < 0.001, extremely significant. Fig. 10. Changes in physiological indicators of P. hopeiensis transgenic lines under stress. (A) SOD activities of P. hopeiensis under stress; (B) POD activities of P. hopeiensis under stress; (C) CAT contents in P. hopeiensis under stress treatment. Values are the mean ± standard deviation of three independent experiments. The significance of differences was determined using t-test and F-test. *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Fig. 11. Changes in physiological indicators of P. hopeiensis transgenic lines under stress. (A) Pro contents of P. hopeiensis under stress; (B) MDA contents in P. hopeiensis under stress treatment. Values are the mean ± standard deviation of three independent experiments. The significance of differences was determined using t-test and F-test. *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Fig. 12. Expression analysis of MPK6, SOS1, HKT1, P5CS1 and PRODH1 genes in P. hopeiensis under salt and drought stress. (A) The relative expression level of SOS1 in P. hopeiensis; (B) The relative expression level of MPK6 in P. hopeiensis; (C) The relative expression level of HKT1 in P. hopeiensis; (D) The relative expression level of P5CS1 in P. hopeiensis; (E) The relative expression level of PRODH1 in P. hopeiensis. Values are the mean ± standard deviation of three independent experiments. The significance of differences was determined using t-test and F-test. *** p < 0.001, extremely significant; ** 0.001 ≤ p < 0.01, very significant; * 0.01 ≤ p < 0.05, significant. Table 1. The related genes primer of qPCR Primer name Primer sequence (5ʹ-3ʹ) SpsNAC042-F ATGAGCAACATAAGTTTTGTGGAGGC SpsNAC042-R ATTGTGGCAGAAGAGAAACCCT qN1-F GCAACTGGACTAAGAACGAATCG qN1-R ACGACCCAGTACTGGCCCTT UBQ-F GCATCATCACAATCACTCTCCGA UBQ-R ACCACCAGCCTTCTGGTAAA ACT-F AAACTGTAATGGTCCTCCCCG ACT-R GCATCATCACAATCACTCTCCGA SOS1-F1 GGCTGTTGTTGCTCTGTTGA SOS1-R1 TTATGGCACCCGAGGTAAAG MPK6-F1 CTGCAAACGTCCTGCATAGA MPK6-R1 AACACACAACCCACTGACCA HKT1-F1 TGGTTCAGTGCCTGTTGTTC HKT1-R1 CATCCTTGCACGAGCTATCA P5CS1-F1 GTGTTGGCACCCTCTTTCAT P5CS1-R1 CATCAGCTACGTCCAGCAAA PRODH1-F1 ATGGCACGATTCAAGCCTAC PRODH1-R1 TTCAAGCATGAACGAAGCAC ==== Refs Literature Cited Ai, K.J., Y. Zhu and H.S. Hou (2016) Expression of TaNAC1 gene in common wheat and genetic transformation in Arabidopsis. Bulletin of Botanical Research 36 : 886–894 (in Chinese with English summary). Aida, M., T. Ishida, H. Fukaki, H. Fujisawa and M. Tasaka (1997) Genes involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cell 9 : 841–857.9212461 Berthomieu, P., G. Conéjéro, A. Nublat, W.J. Brackenbury, C. Lambert, C. Savio, N. Uozumi, S. Oiki, K. Yamada, F. Cellier et al. (2003) Functional analysis of AtHKT1 in Arabidopsis shows that Na+ recirculation by the phloem is crucial for salt tolerance. EMBO J 22 : 2004–2014.12727868 Bouré, N., A. Peaucelle, M. Goussot, B. Adroher, L. Soubigou-Taconnat, N. Borrega, E. Biot, Z. Tariq, M.-L. Martin-Magniette, V. Pautot et al. (2022) A cell wall-associated gene network shapes leaf boundary domains. Development 149 : dev200359.35575098 Cao, H.S. (2020) Transcriptomic analysis of Cucumber and Pupkin graftfttrd combinations in response to salt stress and functional analysis of CmoNAC1 gene. Huazhong Agricultural University 89–91 (in Chinese). Chang, P.J. (2019) Cloning and functional identification of MdeSOSl gene in Magnolia denudata. Zhejiang A&F University 37–38 (in Chinese). Chen, K.S., F. Li, C.J. Xu, S.L. Zhang and C.X. Fu (2004) An efficient macro-method of genomic DNA isolation from Actinidia chinensis leaves. Hereditas 26 : 529–531.15640056 Chen, X., J. Cheng, L. Chen, G. Zhang, H. Huang, Y. Zhang and L. Xu (2016) Auxin-independent NAC pathway acts in response to explant-specific wounding and promotes root tip emergence during de novo root organogenesis in Arabidopsis. Plant Physiol 170 : 2136–2145.26850273 Deng, J.L., G.Y. Zhang, Z.L. Zhang, C. Zhang, J.T. Xu, J.M. Qi, Y.B. Wu and G. Wang (2021) Isolation of HcNAC1 transcription factor gene and its expression patterns under drought stress in kenaf (Hibiscus cannabinus). Journal of Agricultural Biotechnology 29 : 251–257 (in Chinese with English summary). Funck, D., S. Eckard and G. Müller (2010) Non-redundant functions of two proline dehydrogenase isoforms in Arabidopsis. BMC Plant Biol 10 : 70.20403182 Gao, M.Y., H.H. Gan, Q.H. Li, B. Li and J.M. Zhu (2018) The effect of exogenous salicylic acid on the physiological characteristics of Ulmus pumila plantlet under NaCl stress. Forest Research 31 : 138–143 (in Chinese with English summary). Guo, H.-S., Q. Xie, J.-F. Fei and N.-H. Chua (2005) MicroRNA directs mRNA cleavage of the transcription factor NAC1 to downregulate auxin signals for Arabidopsis lateral root development. Plant Cell 17 : 1376–1386.15829603 Horsch, R.B., J.E. Fry, N.L. Hoffmann, M. Wallroth, D. Eichholtz, S.G. Rogers and R.T. Fraley (1985) A simple and general method for transferring genes into plants. Science 227 : 1229–1231.17757866 Hu, R., G. Qi, Y. Kong, D. Kong, Q. Gao and G. Zhou (2010) Comprehensive analysis of NAC domain transcription factor gene family in Populus trichocarpa. BMC Plant Biol 10 : 145.20630103 Huh, S.U., S.-B. Lee, H.-H. Kim and K.-H. Paek (2012) ATAF2, a NAC transcription factor, binds to the promoter and regulates NIT2 gene expression involved in auxin biosynthesis. Mol Cells 34 : 305–313.22965747 Jia, D.F. (2019) Regulation of NAC transcription factors on drought stress response and dwarfing character in Malus. Northwest A&F University 109–110 (in Chinese). Kishor, P.B.K., S. Sangam, R.N. Amrutha, P.S. Laxmi, K.R. Naidu, K.R.S.S. Rao, S. Rao, K.J. Reddy, P. Theriappan and N. Sreenivasulu (2005) Regulation of proline biosynthesis, degradation, uptake and transport in higher plants: Its implications in plant growth and abiotic stress tolerance. Current Science 88 : 424–438. Lang, H.Y. (2014) Study on the response of chlAPX-overexpressed Populus tomenentose to stress. Shandong Normal University 58–60 (in Chinese). Le, D.T., R. Nishiyama, Y. Watanabe, K. Mochida, K. Yamaguchi-Shinozaki, K. Shinozaki and L.-S.P. Tran (2011) Genome-wide survey and expression analysis of the plant-specific NAC transcription factor family in Soybean during development and dehydration stress. DNA Res 18 : 263–276.21685489 Le Hénanff, G., C. Profizi, B. Courteaux, F. Rabenoelina, C. Gérard, C. Clément, F. Baillieul, S. Cordelier and S. Dhondt-Cordelier (2013) Grapevine NAC1 transcription factor as a convergent node in developmental processes, abiotic stresses, and necrotrophic/biotrophic pathogen tolerance. J Exp Bot 64 : 4877–4893.24043850 Li, J., G. Guo, W. Guo, G. Guo, D. Tong, Z. Ni, Q. Sun and Y. Yao (2012) miRNA164-directed cleavage of ZmNAC1 confers lateral root development in maize (Zea mays L.). BMC Plant Biol 12 : 220.23171309 Li, X., Y. Zheng, Q. Xing, R. Ardiansyah, H. Zhou, S. Ali, T. Jing, J. Tian, X.S. Song, Y. Li et al. (2020) Ectopic expression of the transcription factor CUC2 restricts growth by cell cycle inhibition in Arabidopsis leaves. Plant Signal Behav 15 : 1706024.31900029 Liang, X.-D., M. Shalapy, S.-F. Zhao, J.-H. Liu and J.-Y. Wang (2021) A stress-responsive transcription factor PeNAC1 regulating beta-d-glucan biosynthetic genes enhances salt tolerance in oat. Planta 254 : 130.34817644 Liu, F.H., Z.X. Sun, D.C. Cui, B.X. Du, C.R. Wang and S.Y. Chen (2000) Cloning of E. coli mtl-D gene and its expression in transgenic Balizhuangyang (Populus). Acta Genetica Sinica 27 : 428–433 (in Chinese with English summary).10979189 Liu, L.P. (1998) Woody Flora of Ziwuling. Lanzhou: Lanzhou University press 37–47 (in Chinese) Livak, K.J. and T.D. Schmittgen (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2–ΔΔCT method. Methods 25 : 402–408.11846609 Lu, D.Y., G.S. Zhang, L. Zhang, L. Hao and H.G. Huang (2020) Progress in the research of Salix psammophila. Mol Plant Breed 18 : 3427–3432 (in Chinese with English summary). Lu, X.D. (2020) Genome-wide identification of peanut NAC transcription factors and expression analysis of drought and salt tolerance genes. Zhongkai University of Agriculture and Engineerin 49–50 (in Chinese). Nanjo, T., M. Kobayashi, Y. Yoshiba, Y. Kakubari, K. Yamaguchi-Shinozaki and K. Shinozaki (1999) Antisense suppression of proline degradation improves tolerance to freezing and salinity in Arabidopsis thaliana. FEBS Lett 461 : 205–210.10567698 Ning, H.L. (2012) Field experiment and statistical methods. Beijing: Science Press 64–90 (in Chinese). Nuruzzaman, M., R. Manimekalai, A.M. Sharoni, K. Satoh, H. Kondoh, H. Ooka and S. Kikuchi (2010) Genome-wide analysis of NAC transcription factor family in rice. Gene 465 : 30–44.20600702 Olsen, A.N., H.A. Ernst, L.L. Leggio and K. Skriver (2005) NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Sci 10 : 79–87.15708345 Ooka, H., K. Satoh, K. Doi, T. Nagata, Y. Otomo, K. Murakami, K. Matsubara, N. Osato, J. Kawai, P. Carninci et al. (2003) Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana. DNA Res 10 : 239–247.15029955 Price, A.H., K.A. Steele, B.J. Moore and R.G.W. Jones (2002) Upland rice grown in soil-filled chambers and exposed to contrasting water-deficit regimes: II. Mapping quantitative trait loci for root morphology and distribution. Field Crops Res 76 : 25–43. Puranik, S., P.P. Sahu, P.S. Srivastava and M. Prasad (2012) NAC proteins: regulation and role in stress tolerance. Trends Plant Sci 17 : 369–381.22445067 Qiu, Q.-S., Y. Guo, M.A. Dietrich, K.S. Schumaker and J.-K. Zhu (2002) Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proc Natl Acad Sci USA 99 : 8436–8441.12034882 Rubio, F., W. Gassmann and J.I. Schroeder (1995) Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 270 : 1660–1663.7502075 Rushton, P.J., M.T. Bokowiec, S. Han, H. Zhang, J.F. Brannock, X. Chen, T.W. Laudeman and M.P. Timko (2008) Tobacco transcription factors: novel insights into transcriptional regulation in the solanaceae. Plant Physiol 147 : 280–295.18337489 Serra, L. and C. Perrot-Rechenmann (2020) Spatiotemporal control of cell growth by CUC3 shapes leaf margins. Development 147 : dev183277.32094116 Souer, E., A. van Houwelingen, D. Kloos, J. Mol and R. Koes (1996) The No Apical Meristem gene of petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cell 85 : 159–170.8612269 Sun, L.J., D.Y. Li, H.J. Zhang and F.M. Song (2012) Functions of NAC transcription factors in biotic and abiotic stress responses in plants. Hereditas 34 : 993–1002 (in Chinese with English summary).22917904 Tan, Q.L., Y.B. Cai, X.Y. Yang, M. Li, J.D. Li, S.J. Huang, Q. Chen, X.H. Pang, P.J. Zhu and Q.G. Zhou (2021) Bioinformatics and expression analysis of a NAC transcription factor gene AcoNAC1 in Ananas comosus. Chinese Journal of Tropical Crops 42 : 310–316 (in Chinese with English summary). Tian, X.M. and X.F. Tan (2009) Research progress and prospect of transgenic populus. Hunan Forestry Science & Technology 36 : 71–73 (in Chinese with English summary). Wang, L.G., M.C. Fu, H. Li, R.Z. Liu and Z.J. Liu (2019) Cloning of NAC transcription factor gene GhSNAC1 and its drought and salt resistance in upland cotton (Gossupium hirsutum). J Agric Biotechnol 27 : 571–580 (in Chinese with English summary). Wang, S.D. and R.S. Peng (2015a) The fast-growing and salt-alkali tolerant poplar elite variety of Populus simonii × P. euphratica ‘Liaohu 1’. Scientia Silvae Sinicae 51 (7 ): 166 (in Chinese with English summary). Wang, S.D. and R.S. Peng (2015b) The fast-growing and salt-alkali tolerant poplar elite variety of Populus simonii × P. euphratica ‘Liaohu2’. Scientia Silvae Sinicae 51 (10 ): 156 (in Chinese with English summary). Wang, Y., L. Duan, M. Lu, Z. Li, M. Wang and Z. Zhai (2006a) Expression of NAC1 up-stream regulatory region and its relationship to the lateral root initiation induced by gibberellins and auxins. Sci China C Life Sci 49 : 429–435.17172049 Wang, Y.H., L.S. Duan, M.Z. Lu, Z.H. Li, M.J. Wang and Z.X. Zai (2006b) Expression characteristics of NAC1 upstream regulatory region and its relationship with lateral root hormone induction. Scientia Sinica Vitae 3 : 217–222. Xie, Q., G. Frugis, D. Colgan and N.-H. Chua (2000) Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Genes Dev 14 : 3024–3036.11114891 Yang, H., L. Fan, X. Yu, X. Zhang, P. Hao, D. Wei and G. Zhang (2022) Analysis of the NAC gene family in Salix and the identification of SpsNAC005 gene contributing to salt and drought tolerance. Forests 13 : 971. Yang, H.F., G.F. Bo, X.W. Yu, A.Y. Li, X. Zhang, P. Hao and L. Liu (2021) Cloning of SpsNAC042 and its expression analysis under stress in Salix psammophila. Journal of Northwest Forestry University 36 : 11–17 (in Chinese with English summary). Yin, J.D., H.L. Zhang, S.Y. Wang, Z.X. Sun, L.X. Wang and J.J. Yang (2006) Salt tolerance of saline-resistant transgenic Zhongtian poplar in cutting propagation. Chinese Journal of Ecology 25 : 125–128 (in Chinese with English summary). Yu, L., J. Nie, C. Cao, Y. Jin, M. Yan, F. Wang, J. Liu, Y. Xiao, Y. Liang and W. Zhang (2010) Phosphatidic acid mediates salt stress response by regulation of MPK6 in Arabidopsis thaliana. New Phytol 188 : 762–773.20796215 Yu, X.W. (2020) Cloning, bioinformatics analysis and expression of Salix NACs gene. Inner Mongolia Agricultural University 39–40 (in Chinese). Yue, L., Y. Zhuang, Y. Gu, H. Li, S. Tu, X. Yang and W. Huang (2021) Heterologous expression of solanum tuberosum NAC1 gene confers enhanced tolerance to salt stress in transgenic Nicotiana benthamiana. J Plant Biol 64 : 531–542. Yoshiba, Y., T. Kiyosue, T. Katagiri, H. Ueda, T. Mizoguchi, K. Yamaguchi-Shinozaki, K. Wada, Y. Harada and K. Shinozaki (1995) Correlation between the induction of a gene for Δ1-pyrroline-5-carboxylate synthetase and the accumulation of proline in Arabidopsis thaliana under osmotic stress. Plant J 7 : 751–760.7773306 Zhang, B. (2016) Growth changes and metabolism analysis of Tamarix hispida to salt stress. Northeast Forestry University 28–32 (in Chinese). Zhang, C.M., S.L. Shi, Z. Liu, F. Yang and Z. Zhang (2019) Effects of drought stress on the root morphology and anatomical structure of alfalfa (Medicago sativa) varieties with differing drought-tolerance. Acta Prataculturae Sinica 28 : 79–89 (in Chinese with English summary). Zhang, J. (2020) Effects of drought stress on root structure and physiology of two kinds of Potentilla. Northeast Forestry University 35–38 (in Chinese). Zhang, S. and Y.D. Liu (2001) Activation of salicylic acid–induced protein kinase, a mitogen-activated protein kinase, induces multiple defense responses in tobacco. Plant Cell 13 : 1877–1889.11487699 Zhang, W.X., B.Y. Liu, C.J. Ding, B.Y. Zhang, Q.J. Huang, Y.G. Chu and X.H. Su (2014) Transformation of zinc finger protein transcription factor gene (ZxZF) and preliminary evaluation of drought tolerance in Populus × euramericana. Scientia Silvae Sinicae 50 : 31–37 (in Chinese with English summary). Zhu, J.-K. (2000) Genetic analysis of plant salt tolerance using Arabidopsis. Plant Physiol 124 : 941–948.11080272