==== Front Sci Rep Sci Rep Scientific Reports 2045-2322 Nature Publishing Group UK London 37393362 37845 10.1038/s41598-023-37845-z Article Prevalence and epidemiological investigation of mgrB-dependent colistin resistance in extensively drug resistant Klebsiella pneumoniae in Iran Zahedi Bialvaei Abed 1 Eslami Parisa 2 Ganji Leila 3 Dolatyar Dehkharghani Alireza 3 Asgari Farhad 3 Koupahi Hossein 4 Barzegarian Pashacolaei Hamid Reza 5 Rahbar Mohammad rahbar.reflab@gmail.com 3 1 grid.411746.1 0000 0004 4911 7066 Microbial Biotechnology Research Center, Iran University of Medical Sciences, Tehran, Iran 2 grid.415577.5 Department of Microbiology, Milad Hospital, Tehran, Iran 3 grid.415814.d 0000 0004 0612 272X Department of Microbiology, Ministry of Health & Medical Education, Iranian Reference Health Laboratories Research Center, Tehran, Iran 4 grid.472346.0 0000 0004 0494 3364 Department of Microbiology, Islamic Azad University, Varamin-Pishva Branch, Varamin, Iran 5 Department of Laboratory, Emam Hossein Hospital, Tehran, Iran 1 7 2023 1 7 2023 2023 13 1068017 12 2022 28 6 2023 © The Author(s) 2023 https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Carbapenemases-producing K. pneumoniae are challenging antimicrobial therapy of hospitalised patients, which is further complicated by colistin resistance. The aim of this study was to investigate the molecular epidemiological insights into carbapenemases-producing and colistin-resistant clinical K. pneumoniaeA total of 162 colistin resistant clinical strains of K. pneumoniae were collected during 2017–2019. Antimicrobial susceptibility and the colistin minimum inhibitory concentration were determined. Using PCR assay, the prevalence of resistance-associated genes including blaKPC, blaIMP, blaVIM, blaOXA-48, blaNDM-1 and mcr-1 to -9 was examined. Additionally, a PCR assay was used to examine the mgrB gene in colistin-resistant bacteria. 94.4% of the tested strains were resistant to imipenem and 96.3% were resistant to meropenem. Colistin resistance (MIC > 4 µg/L) was observed in 161 isolates (99.4%) by Colistin Broth Disk Elution method. The KPC enzyme was the most common carbapenemase and was identified in 95 strains (58.6%), followed by the IMP, VIM and OXA-48 detected in 47 (29%), 23 (14.2%) and 12 (7.4%) isolates, respectively. However, no NDM-1 gene was detected. Additionally, none of the studied isolates harbored mcr variants, while mgrB gene was observed in 152 (92.6%) isolates. Colistin resistance of K. pneumoniae isolates may be associated with mgrB gene mutation. To stop the spread of resistant K. pneumoniae, surveillance must be improved, infection prevention protocols must be followed, and antibiotic stewardship must be practised. Subject terms Antimicrobials Applied microbiology Microbial genetics issue-copyright-statement© Springer Nature Limited 2023 ==== Body pmcIntroduction Multidrug-resistant Gram-negative bacteria (MDR-GNB), such as Klebsiella pneumoniae, are a serious public health concern, particularly infections caused by strains that produce carbapenemase and are only susceptible to a limited number of antimicrobials1,2. Polymyxin antibiotics have historically been used as a last resort to treat infections brought on by Enterobacteriaceae that are resistant to the antibiotic carbapenem. Polymyxin antibiotics, including colistin (also known as polymyxin E) are cationic antimicrobial peptides that bind to the lipid A phosphate moiety of bacterial lipopolysaccharide (LPS), resulting in leakage of intracellular components from the cell membrane3. However, the emergence of colistin resistance in GNB has been reported in several countries, with resistance mediated via genetic variations represented by chromosomal mutations in genes involved in lipopolysaccharide synthesis, namely phoP/phoQ, pmrA/pmrB or crrA/crrB as well as on the mgrB regulatory gene4,5. K. pneumoniae's acquired colistin resistance has been linked to the inactivation of the mgrB gene, with several genetic events causing changes to these genes in both human and animal isolates6. These mutations lead to overexpression of the genes and an increased synthesis of phospho- ethanolamine (pEtN) and 4-amino-4-deoxy-l-arabinose (LAra4N)7. In 2016, Yi-Yun Liu et al. discovered a plasmid-mediated colistin resistance gene (mcr-1) encoding a lipid A phosphoethanolamine transferase that confers resistance to colistin by transferring pEtN to lipid A8. Colistin-resistant Enterobacteriaceae, particularly K. pneumoniae, that contain the mcr-1 gene have been reported from humans, animals used for food production, and the environment worldwide, raising the possibility of horizontal transmission of colistin resistance9. This has raised concerns about the potential emergence of pandrug resistance in Enterobacterales. As a result, it is important to continuously and precisely examine how the mcr genes emerged and propagated across bacteria. A systematic review and meta-analysis on the prevalence of colistin resistance of K. pneumoniae isolates in Iran revealed that the pooled prevalence of colistin resistance in clinical isolates was 6.9%10. However, the rate of K. pneumoniae carbapenem resistance was more than 73% in different studies11,12. The development of reliable techniques for the detection of polymyxin resistance, with low cost and feasibility are necessary. Simner and colleagues described the Colistin Broth Disk Elution (CBDE), which uses colistin disks as a source of these antibiotics13. This study’s objective was to examine the molecular mechanisms of colistin and carbapenem resistance among a collection of extensively drug resistant K. pneumoniae collected from clinical specimens in Tehran, Iran. Also, a comparison was made in susceptibility of K. pneumoniae isolates to colistin using Disk diffusion, Chrome Agar, E-test, and CBDE. Materials and methods Bacterial strains From June 2017 to March 2019, a total of 162 non-duplicate strains of K. pneumoniae were isolated from clinical samples of inpatients and outpatients at Milad Hospital in Tehran, and they were resistant to the colistin in the initial screening. The disc diffusion method and selective agar medium CHROMagar COL-APSE (Paris, France) were used to detect resistance to colistin and finally colistin resistant isolates that were confirmed by both methods were included in the study. Antimicrobial susceptibility testing Antimicrobial susceptibility testing was performed on Muller– Hinton agar plates using the standard disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI, 2022) guidelines14. A total of 10 antibiotics including cefotaxime (CTX: 30 μg), ceftazidime (CAZ: 30 μg), piperacillin/tazobactam (TZP: 100/10 μg), amikacin (AN: 30 μg), gentamicin (GM: 10 μg), fosfomycin (FOX: 200 μg), imipenem (IMP: 10 μg), meropenem (MERO: 10 μg), ciprofloxacin (CIP: 5 μg), and trimethoprim/sulfamethoxazole (SXT: 1.25/23.75 μg) were investigated. Escherichia coli ATCC 25,922 was used as a quality control strain. Minimum inhibitory concentrations (MICs) of colistin were determined using E-test strips (bioMérieux, Craponne, France) and CBDE13. Isolates with an MIC > 4 µg/L by CBDE were categorized as resistant. Molecular analysis of carbapenem and colistin resistance-associated genes DNA extraction was performed commercial High pure PCR template preparation kit (Roche Molecular Biochemicals, IN, USA) according to the manufacturer’s instructions. Carbapenemases-encoding genes such as (blaKPC, blaIMP, blaVIM, blaOXA-48 and blaNDM-1) were detected by singleplex PCR15–19. Singleplex PCRs were also used to test the colistin-resistant isolates for the presence of mcr-1–9 according to previous published papers20–24. In addition, using specific primers that targeted the mgrB coding sequence and several flanking areas, PCR analysis of mgrB was carried out25. The sequence of primers used in this study, which were selected based on common variants, is shown in Table 1. Positive strains for blaNDM, blaVIM, blaKPC and blaOXA-48 that confirmed by sequencing method were used as positive control and E. coli ATCC 25922 was utilized as negative control in the PCR assays.Table 1 Primers used in this study. Primers Sequences Size (bp) References KPC ATGTCACTGTATCGCCGTCT TTTTCAGAGCCTTACTGCCC 893 15 NDM-1 GGTTTGGCGATCTGGTTTTC CGGAATGGCTCATCACGATC 621 16 OXA-48 TTGGTGGCATCGATTATCGG GAGCACTTCTTTTGTGATGGC 743 17 IMP CCAAACYACTASGTTATC GAATAGRRTGGCTTAAYTCTC 188 18 VIM GTTTGGTCGCATATCGCAAC AATGCGCAGCACCAGGATAG 382 19 Mcr-1 AGTCCGTTTGTTCTTGTGGC AGATCCTTGGTCTCGGCTTG 320 20 Mcr-2 AGCCGAGTCTAAGGACTTGATGAATTTG GCGGTATCGACATCATAGTCATCTTG 576 21 Mcr-3 AAATAAAAATTGTTCCGCTTATG AATGGAGATCCCCGTTTTT 929 20 Mcr-4 AATTGTCGTGGGAAAAGCCGC CTGCTGACTGGGCTATTACCGTCAT 1062 22 Mcr-5 GTGAAACAGGTGATCGTGACTTACCG CGTGCTTTACACCGATCATGTGCT 271 23 Mcr-6 ACTGACCAAGCCGAGTCTAAG GCATCACGGGATTGACATAGC 259 24 Mcr-7 GCGACCTCCTACCTGAATG CCCTTTGGCGACGACTTTG 345 24 Mcr-8 TTGTCGTCGTGGGCGAAAC CTGTCGCAAGTTGGGCTAAAG 514 24 Mcr-9 CGGCGAACTACGCTTACAG CGCACAGTTTCGGGTTATCAC 465 24 mgrB AAGGCGTTCATTCTACCACC TTAAGAAGGCCGTGCTATCC 253 25 Genomic sequencing Draft genome sequences were created using genomic sequencing on an Oxford Nanopore GridION in National Reference Laboratory. Statistical analysis Data analysis was performed using IBM SPSS Statistics v.22.0 (IBM Corp., Armonk, NY). The frequency of isolates between groups was compared by χ2 test. A P-value of ≤ 0.05 was considered statistically significant. Results Epidemiology of colistin-resistant K. pneumoniae isolates During the study periods, 162 colistin resistant strains of K. pneumoniae belonging to 94 (58%) men and 68 (42%) women were studied. The average age of the patients was 67.25 ± 1.2 (between 19 and 98 years) and most of the studied patients 103 (63.6%) were older than 65 years. Out of 162 patients, 155 were inpatients and only 7 were outpatients. The largest number of studied samples included trachea (41, 25.3%), urine (37, 22.8%) and sputum (35, 21.6%) samples, more than half of which (95, 58.6%) were received from the intensive care unit (ICU). The demographic characteristics of patients, sample types and distribution of study isolates among the different hospital wards are shown in Table 2.Table 2 Sources of strains isolation. Characteristics N (%) Gender, N (%)  Male 94 (58)  Female 68 (42) Age, N (%)  19–24 1 (0.6)  25–34 5 (3.1)  35–44 9 (5.6)  45–54 14 (8.6)  55–64 30 (18.5)  65 +  103 (63.6) Specimen type (%)  Wound 17 (10.5)  Sputum 35 (21.6)  Urine 37 (22.8)  Trachea 41 (25.3)  Blood 16 (9.9)  BAL 1 (0.6)  Pleural 5 (3.1)  Ascitic fluid 3 (1.9)  Abscess 3 (1.9)  Urinary catheter 4 (2.4) Ward (%)  Internal 29 (17.9)  I.C.U 95 (58.6)  Kidney transplantation 6 (3.7)  Emergency 6 (3.7)  Lung 6 (3.7)  Surgery 9 (5.6)  C.C.U 3 (1.9)  Dialysis 1 (0.6)  Outpatients 7 (4.3) Total 162 (100) Antimicrobial susceptibility testing 79.6% of the tested strains were resistant to cotrimoxazole, and except for amikacin, resistance to other antibiotics was observed above 90% (Fig. 1). Out of 162 K. pneumoniae isolates, 161 (99.3%) were resistant to ciprofloxacin. The resistance rate of the third generation of cephalosporins including ceftriaxone and ceftazidime was 98.8%. Resistance to carbapenems, which are used as alternative antibiotics in the treatment of strains resistant to cephalosporins, was high, so that 94.4% of the tested strains were resistant to imipenem and 96.3% were resistant to meropenem. From aminoglycoside antibiotics, gentamycin and amikacin were tested, and the resistance to gentamycin was about 90%, while the resistance to amikacin was about 44%, and 12% of the strains had intermediate resistance to this antibiotic. Resistance of K. pneumoniae strains to tazobactam-piperacillin was 92%. Colistin resistance (MIC > 4 µg/L) was observed in 161 isolates (99.4%) by CBDE (Table 3). To compare the antimicrobial sensitivity test using chrome agar, E-test and CBDE methods in colistin resistant K. pneumoniae isolates, 95.6% of the methods used in this study overlapped to detect colistin sensitivity. Meanwhile, a big difference was observed with the disc diffusion method. 50 (30.8%) of the isolates that showed resistance to colistin by other studied methods, showed a sensitive phenotype by disc diffusion method.Figure 1 Results of Antimicrobial susceptibility testing for different antibiotics in colistin resistant K. pneumoniae isolates. SXT Trimethoprim/Sulfamethoxazole, FOX Fosfomycin, CTX cefotaxime, CAZ Ceftazidime, IMP Imipenem, GM Gentamicin, MERO Meropenem, CIP Ciprofloxacin, AN Amikacin, TZP Piperacillin-Tazobactam. Table 3 Comparison of colistin resistance results obtained with different methods in K. pneumoniae isolates. Test Resistance (%) Sensitive (%) CBDE 161 (99.4) 1 (0.6) Chrome Agar 154 (95.1) 8 (4.9) MIC (E-test) 160 (98.8) 2 (1.2) Disk diffusion 105 (64.8) 57 (35.2) Total 162 (100) Molecular analysis of carbapenem and colistin resistance-associated genes The gene encoding the KPC enzyme was the most common and was identified in 95 strains (58.6%), followed by IMP and VIM in 47 (29%) and 23 (14.2%) strains, respectively. The gene encoding the OXA-48 enzyme was found in 12 strains (7.4%), while the NDM-1 gene was not detected. PCR screening for plasmid-mediated colistin resistance genes (mcr-1 to mcr-9) were examined on tested strains. According to the findings, no positive mcr isolates were found. Therefore, all the strains were examined for the presence of the mgrB gene, and 152 (92.6%) strains harboured the gene. Genomic sequencing of strains harboured mgrB gene revealed that only the conversion of codon 39 from TCA to TGA was present in two isolates, since the TGA codon is a stop codon, which causes the termination of transcription and the loss of protein function (Accession number KF852760: m colistin-susceptible K. pneumoniae strain; coverage:53%). Discussion The global increase in multidrug-resistant K. pneumoniae strains has increased the use of colistin to treat these infections, resulting in the emergence of colistin resistance worldwide26,27. The important concern that must be considered in the management of nosocomial infections caused by K. pneumoniae are periodic surveillance to identify the resistant strains for optimizing available infection control policies and treatment options in different parts of the hospitals28. This study investigated the molecular mechanisms of colistin and carbapenem resistance among a collection of extensively drug resistant K. pneumoniae clinical isolates in Tehran, Iran. Also, different phenotypic methods including disc diffusion, E-test, chrome agar and CBDE were compared to determine the susceptibility of K. pneumoniae isolates to colistin. In the comparison between the phenotypic methods, the highest number of colistin-resistant strains was identified with the CBDE method. So that out of 162 tested strains, except for one strain, the other isolates were resistant to colistin by the CBDE method, then the E-test and chrome agar methods showed the highest resistance (95.6% overlap to detect colistin resistance), and finally, the disc diffusion method showed the lowest resistance. Some studies have compared agar dilution, E-test and disk diffusion methods to measure colistin resistance in Gram-negative bacilli29,30. According to CLSI and EUCAST guidelines, they confirmed that the use of diffusion-based methods for antimicrobial susceptibility testing against colistin was unreliable, which is due to the large size of the colistin, prevents its uniform diffusion in agar-containing media14. Despite this recommendation, the results of this study showed that the disk diffusion method performed with both types of commercial disks containing colistin was able to successfully differentiate resistant strains. According to this result, it seems that revisions should be made about the diagnostic value of the disc diffusion method to determine the susceptibility to colistin and this test should not be completely abandoned. Because disc diffusion method is able to identify at least strains with high level of resistance to colistin and can be an important tool in the direction of rapid screening of resistant strains with high resistance level. CBDE is a simple and low-cost phenotypic method to test antimicrobial sensitivity against colistin in Gram-negative bacilli, including Enterobacteriaceae, which has been approved by CLSI and EUCAST. Studies have shown that CBDE method was comparable with the broth microdilution method as a reference method with a 100% correlation13,31. The colistin-resistant rate in Iran were reported about 11.6%32. Nevertheless, data from reports of neighboring countries showed the resistance to colistin are ranging from 0 to 31.7%33. As expected for colistin-resistant isolates in our study, most were also resistant to other clinically useful antimicrobial agents. In the present study, 96% of isolates showed phenotypic resistance to meropenem and/or imipenem, which similar to many other studies, 95 of them harboured blaKPC gene34. We found that none of the colistin-resistant K. pneumoniae isolates had plasmid-encoded mcr-genes, suggesting that the resistance is mediated by chromosomally encoded mechanisms. MCR-1 is still extremely uncommon in clinical isolates worldwide35. In previous investigations, mcr-1 prevalence in Enterobacteriaceae was reported to range between 0.1 and 1%36,37. The literature shows the prevalence of the mcr-1 gene was lower in Enterobacteriaceae strains isolated from human sources than in strains isolated from animal and food samples38. This assumes that their reservoir is at least in animals and the environment, following the important use of colistin in animal production and in general agriculture. In Iran, the massive use of colistin in clinical practice following the spread of carbapenemase-producing Enterobacteriaceae has led to the selection of multidrug-resistant bacteria in hospital settings39. Interestingly, the results of the current study showed that mcr-1- negative K. pneumoniae isolates had high level of colistin resistance. Consistent with this findings, previous studies reported that K. pneumoniae with chromosomal mutations in mgrB exhibited a high level of colistin resistance40,41. The mechanisms of colistin resistance other than those attributed to the mcr-1 gene in the K. pneumoniae isolates in this study are being further studied to define the precise molecular mechanism of resistance. Of 162 colistin resistant K. pneumoniae isolates, 150 (92.6%) isolates had mgrB. Critical changes in mgrB, such as disruption of the promoter or coding sequence, are thought to cause the gene to be silenced or lead to the generation of shortened mgrB40. In reality, PhoP/PhoQ activation follows mgrB inactivation by any of these occurrences, which in turn activates the PmrA response regulator responsible for modification of the lipopolysaccharide polymyxin target25. So mentioned mutation in the present study may causes the termination of transcription and the loss of protein function. Avgoulea et al. reported that insertional inactivation of the mgrB gene conferred resistance to colistin in all isolates tested42. There were some limitations related to the present study. Firstly, it should be noted that this study was performed using extracted DNA samples from K. pneumoniae that were selected based on the results of initial screening for colistin resistance. The lack of strains carrying mcr genes except mcr-1 as a positive control is another limitation. From an epidemiological standpoint, the monocentric nature of the study is a significant limitation. Conclusion Our findings indicate that the colistin resistance of K. pneumoniae isolates may be associated with mgrB gene mutation. These data provide added insight into the mechanism of colistin. Colistin resistance developed with a number of new mutations among highly resistant populations, limiting the availability of further antimicrobial medicines and resulting in pandrug resistance. The prevalence of resistance to carbapenems and colistin in Iran should be surveyed and new therapeutic strategies including old drugs should be evaluated and used in Iran. Acknowledgements Research reported in this publication was supported by Elite Researcher Grant Committee under Award Number 963434 from the National Institute for Medical Research Development (NIMAD), Tehran, Iran. Author contributions M.R. participated in study supervision, design of the study, and critical revision of the manuscript for important intellectual content. A.Z.B. carried out the data collection and drafted the manuscript. PE participated in microbiologic methods. L.G., F.A. and H.K. participated in design of the study and critical revision of the manuscript for important intellectual content. A.D.D. and H.R.B.P. conducted the molecular methods. All authors read and approved the final manuscript. The participant has consented to the submission of this article to the journal. We confirm that the manuscript, or part of it, has neither been published nor is currently under consideration for publication. This work and the manuscript were approved by all coauthors. Data availability All data generated or analyzed during this study are included in this published article and Supplementary Information file [and its tables and figures]. Code availability The code is available from the corresponding author upon request. Competing interests The authors declare no competing interests. Publisher's note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. ==== Refs References 1. Jamali S Tavakoly T Mojtahedi A Shenagari M The phylogenetic relatedness of bla NDM-1 harboring extended-spectrum β-lactamase producing uropathogenic Escherichia coli and Klebsiella pneumoniae in the North of Iran Infect. Drug Resist. 2020 13 651 657 10.2147/IDR.S230335 32158241 2. Pirzaman AN Mojtahedi A Investigation of antibiotic resistance and the presence of integron genes among ESBL producing Klebsiella isolates Meta Gene 2019 19 37 41 10.1016/j.mgene.2018.10.008 3. Yap PS-X Cheng W-H Chang S-K Lim S-HE Lai K-S MgrB mutations and altered cell permeability in colistin resistance in Klebsiella pneumoniae Cells 2022 11 19 2995 10.3390/cells11192995 36230959 4. Poirel L Jayol A Bontron S Villegas M-V Ozdamar M Türkoglu S The mgrB gene as a key target for acquired resistance to colistin in Klebsiella pneumoniae J. Antimicrob. Chemother. 2015 70 1 75 80 10.1093/jac/dku323 25190723 5. Cheong HS Kim SY Wi YM Peck KR Ko KS Colistin heteroresistance in Klebsiella pneumoniae isolates and diverse mutations of PmrAB and PhoPQ in resistant subpopulations J. Clin. Med. 2019 8 9 1444 10.3390/jcm8091444 31514418 6. Yusof NY Norazzman NII Hakim SNWA Azlan MM Anthony AA Mustafa FH Prevalence of mutated colistin-resistant Klebsiella pneumoniae: A systematic review and meta-analysis Trop. Med. Infect. Dis. 2022 7 12 414 10.3390/tropicalmed7120414 36548669 7. Gerson S Betts JW Lucaßen K Nodari CS Wille J Josten M Investigation of novel pmrB and eptA mutations in isogenic Acinetobacter baumannii isolates associated with colistin resistance and increased virulence in vivo Antimicrob. Agents Chemother. 2019 63 3 e01586 e01618 10.1128/AAC.01586-18 30617096 8. Liu Y-Y Wang Y Walsh TR Yi L-X Zhang R Spencer J Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study Lancet. Infect. Dis. 2016 16 2 161 168 10.1016/S1473-3099(15)00424-7 26603172 9. Poirel L Jayol A Nordmann P Polymyxins: Antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes Clin. Microbiol. Rev. 2017 30 2 557 596 10.1128/CMR.00064-16 28275006 10. Narimisa N Goodarzi F Bavari S Prevalence of colistin resistance of Klebsiella pneumoniae isolates in Iran: A systematic review and meta-analysis Ann. Clin. Microbiol. Antimicrob. 2022 21 1 1 9 10.1186/s12941-022-00520-8 34996464 11. Sharahi JY Hashemi A Ardebili A Davoudabadi S Molecular characteristics of antibiotic-resistant Escherichia coli and Klebsiella pneumoniae strains isolated from hospitalized patients in Tehran, Iran Ann. Clin. Microbiol. Antimicrob. 2021 20 1 32 10.1186/s12941-021-00437-8 33906654 12. Mokhtari M Mojtahedi A Mahdieh N Jafari A Arya MJ High prevalence of blaOXA-48 and blaNDM-producing carbapenem-resistant Klebsiella pneumoniae isolated from clinical samples in Shahid Rajaei Hospital in Tehran, Iran Jundishapur J. Microbiol. 2022 15 10 10.5812/jjm-130804 13. Simner PJ Bergman Y Trejo M Roberts AA Marayan R Tekle T Two-site evaluation of the colistin broth disk elution test to determine colistin in vitro activity against Gram-negative bacilli J. Clin. Microbiol. 2019 57 2 e01163 e1218 10.1128/JCM.01163-18 30282791 14. Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing, M100 2022 32 Clinical and Laboratory Standards Institute 15. Handal R Qunibi L Sahouri I Juhari M Dawodi R Marzouqa H Characterization of carbapenem-resistant Acinetobacter baumannii strains isolated from hospitalized patients in Palestine Int. J. Microbiol. 2017 2017 1 7 10.1155/2017/8012104 16. Nordmann P Poirel L Carrër A Toleman MA Walsh TR How to detect NDM-1 producers J. Clin. Microbiol. 2011 49 2 718 721 10.1128/JCM.01773-10 21123531 17. Brink AJ Coetzee J Corcoran C Clay CG Hari-Makkan D Jacobson RK Emergence of OXA-48 and OXA-181 carbapenemases among Enterobacteriaceae in South Africa and evidence of in vivo selection of colistin resistance as a consequence of selective decontamination of the gastrointestinal tract J. Clin. Microbiol. 2013 51 1 369 372 10.1128/JCM.02234-12 23152549 18. Vasconcelos NG Queiroz JHFDS Silva KED Vasconcelos PCDP Croda J Simionatto S Synergistic effects of Cinnamomum cassia L. essential oil in combination with polymyxin B against carbapenemase-producing Klebsiella pneumoniae and Serratia marcescens PLoS ONE 2020 15 7 e0236505 10.1371/journal.pone.0236505 32701970 19. Fallah F Borhan RS Hashemi A Detection of bla (IMP) and bla (VIM) metallo-β-lactamases genes among Pseudomonas aeruginosa strains Int. J. Burns Trauma 2013 3 2 122 124 23638331 20. Rebelo AR Bortolaia V Kjeldgaard JS Pedersen SK Leekitcharoenphon P Hansen IM Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes Euro Surveill. 2018 23 6 672 10.2807/1560-7917.ES.2018.23.6.17-00672 21. Yassin AK Zhang J Wang J Chen L Kelly P Butaye P Identification and characterization of mcr mediated colistin resistance in extraintestinal Escherichia coli from poultry and livestock in China FEMS Microbiol. Lett. 2017 364 24 242 10.1093/femsle/fnx242 22. Chen L Zhang J Wang J Butaye P Kelly P Li M Newly identified colistin resistance genes, mcr-4 and mcr-5, from upper and lower alimentary tract of pigs and poultry in China PLoS ONE 2018 13 3 e0193957 10.1371/journal.pone.0193957 29538423 23. Zhang J Chen L Wang J Butaye P Huang K Qiu H Molecular detection of colistin resistance genes (mcr-1 to mcr-5) in human vaginal swabs BMC. Res. Notes 2018 11 1 143 10.1186/s13104-018-3255-3 29463301 24. Gorecki A Musialowski M Wolacewicz M Decewicz P Ferreira C Vejmelkova D Development and validation of novel PCR primers for identification of plasmid-mediated colistin resistance (mcr) genes in various environmental settings J. Hazard. Mater. 2022 425 127936 10.1016/j.jhazmat.2021.127936 34883371 25. Cannatelli A D'Andrea MM Giani T Di Pilato V Arena F Ambretti S In vivo emergence of colistin resistance in Klebsiella pneumoniae producing KPC-type carbapenemases mediated by insertional inactivation of the PhoQ/PhoP mgrB regulator Antimicrob. Agents Chemother. 2013 57 11 5521 5526 10.1128/AAC.01480-13 23979739 26. Wang Y Liu F Hu Y Zhang G Zhu B Gao GF Detection of mobile colistin resistance gene mcr-9 in carbapenem-resistant Klebsiella pneumoniae strains of human origin in Europe J. Infect. 2020 80 5 578 606 32112887 27. Zahedi Bialvaei A Dolatyar Dehkharghani A Asgari F Shamloo F Eslami P Rahbar M Modified CIM test as a useful tool to detect carbapenemase activity among extensively drug-resistant Klebsiella pneumoniae, Escherichia coli and Acinetobacter baumannii Ann. Microbiol. 2021 71 1 23 10.1186/s13213-021-01634-8 28. Ghaffarian F Hedayati M Ebrahim-Saraie HS Roushan ZA Mojtahedi A Molecular epidemiology of ESBL-producing Klebsiella pneumoniae isolates in intensive care units of a tertiary care hospital, North of Iran Cell Mol. Biol. (Noisy-le-grand) 2018 64 7 75 79 10.14715/cmb/2018.64.7.13 29974849 29. Galani I Kontopidou F Souli M Rekatsina P-D Koratzanis E Deliolanis J Colistin susceptibility testing by Etest and disk diffusion methods Int. J. Antimicrob. Agents 2008 31 5 434 439 10.1016/j.ijantimicag.2008.01.011 18328674 30. Haeili M Kafshdouz M Pishnian Z Feizabadi MM Martinez-Martinez L Comparison of susceptibility testing methods for determining the activity of colistin against Gram-negative bacilli of clinical origin J. Med. Microbiol. 2019 68 1 60 66 10.1099/jmm.0.000879 30422106 31. Humphries RM Green DA Schuetz AN Bergman Y Lewis S Yee R Multicenter evaluation of colistin broth disk elution and colistin agar test: A report from the Clinical and Laboratory Standards Institute J. Clin. Microbiol. 2019 57 11 e01269 e01319 10.1128/JCM.01269-19 31511331 32. Aghapour Z Hasani A Aghazadeh M Rezaee MA Ganbarov K Pourlak T Genes involved in colistin resistance of gram-negative isolates in the northwest of Iran Gene Rep. 2019 14 81 86 10.1016/j.genrep.2018.12.001 33. Bialvaei AZ Samadi KH Colistin, mechanisms and prevalence of resistance Curr. Med. Res. Opin. 2015 31 4 707 721 10.1185/03007995.2015.1018989 25697677 34. Hu Y Liu C Wang Q Zeng Y Sun Q Shu L Emergence and expansion of a carbapenem-resistant Pseudomonas aeruginosa clone are associated with plasmid-borne bla KPC-2 and virulence-related genes Msystems 2021 6 3 e00154 e221 10.1128/mSystems.00154-21 34006625 35. Aris P Robatjazi S Nikkhahi F Marashi SMA Molecular mechanisms and prevalence of colistin resistance of Klebsiella pneumoniae in the Middle East region: A review over the last 5 years J. Glob. Antimicrob. Res. 2020 22 625 630 10.1016/j.jgar.2020.06.009 36. Castanheira M Griffin MA Deshpande LM Mendes RE Jones RN Flamm RK Detection of mcr-1 among Escherichia coli clinical isolates collected worldwide as part of the SENTRY Antimicrobial Surveillance Program in 2014 and 2015 Antimicrob. Agents Chemother. 2016 60 9 5623 5624 10.1128/AAC.01267-16 27401568 37. Quan J Li X Chen Y Jiang Y Zhou Z Zhang H Prevalence of mcr-1 in Escherichia coli and Klebsiella pneumoniae recovered from bloodstream infections in China: A multicentre longitudinal study Lancet Infect. 2017 17 4 400 410 10.1016/S1473-3099(16)30528-X 38. Elbediwi M Li Y Paudyal N Pan H Li X Xie S Global burden of colistin-resistant bacteria: Mobilized colistin resistance genes study (1980–2018) Microorganisms 2019 7 10 461 10.3390/microorganisms7100461 31623244 39. Fayyaz M Zafar H Mirza IA Meral U Hussain A Khalil H In vitro susceptibility of colistin against multidrug resistant Klebsiella pneumoniae clinical isolates Pak. Armed Forces Med. J. 2022 72 S668 S672 10.51253/pafmj.v72iSUPPL-3.9580 40. Haeili M Javani A Moradi J Jafari Z Feizabadi MM Babaei E MgrB alterations mediate colistin resistance in Klebsiella pneumoniae isolates from Iran Front. Microbiol. 2017 8 2470 10.3389/fmicb.2017.02470 29326662 41. Jayol A Nordmann P Lehours P Poirel L Dubois V Comparison of methods for detection of plasmid-mediated and chromosomally encoded colistin resistance in Enterobacteriaceae Clin. Microbiol. Infect. 2018 24 2 175 179 10.1016/j.cmi.2017.06.002 28606644 42. Avgoulea K Di Pilato V Zarkotou O Sennati S Politi L Cannatelli A Characterization of extensively drug-resistant or pandrug-resistant sequence type 147 and 101 OXA-48-producing Klebsiella pneumoniae causing bloodstream infections in patients in an intensive care unit Antimicrob. Agents Chemother. 2018 62 7 e02457 e02517 10.1128/AAC.02457-17 29661874