==== Front Malar J Malar J Malaria Journal 1475-2875 BioMed Central London 4635 10.1186/s12936-023-04635-x Research Significant number of Plasmodium vivax mono-infections by PCR misidentified as mixed infections (P. vivax/P. falciparum) by microscopy and rapid diagnostic tests: malaria diagnostic challenges in Ethiopia Abebe Abnet abnetabas@gmail.com 12 Menard Didier 3 Dugassa Sisay 1 Assefa Ashenafi 24 Juliano Jonathan J. 4 Lo Eugenia 5 Golassa Lemu 1 1 grid.7123.7 0000 0001 1250 5688 Aklilu Lemma Institute of Pathobiology, Addis Ababa University, Addis Ababa, Ethiopia 2 grid.452387.f 0000 0001 0508 7211 Ethiopian Public Health Institute, Addis Ababa, Ethiopia 3 grid.11843.3f 0000 0001 2157 9291 Laboratory of Parasitology and Mycology, University of Strasbourg, Strasbourg, France 4 grid.10698.36 0000000122483208 Division of Infectious Disease, School of Medicine, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina USA 5 grid.266859.6 0000 0000 8598 2218 Department of Biological Sciences, Bioinformatics Research Center, University of North Carolina at Charlotte, Charlotte, North Carolina, USA 1 7 2023 1 7 2023 2023 22 2017 12 2022 24 6 2023 © The Author(s) 2023 https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Background Plasmodium vivax malaria is now recognized as a cause of severe morbidity and mortality, resulting in a substantial negative effect on health especially in endemic countries. Accurate and prompt diagnosis and treatment of P. vivax malaria is vital for the control and elimination of the disease. Methods A cross-sectional study was conducted from February 2021 to September 2022 at five malaria endemic sites in Ethiopia including Aribaminch, Shewarobit, Metehara, Gambella, and Dubti. A total of 365 samples that were diagnosed positive for P. vivax (mono and mixed infection) using RDT, site level microscopists and expert microscopists were selected for PCR. Statistical analyses were performed to calculate the proportions, agreement (k), frequencies, and ranges among different diagnostic methods. Fisher’s exact tests and correlation test were used to detect associations and relationship between different variables. Results Of the 365 samples, 324 (88.8%), 37(10.1%), 2 (0.5%), and 2 (0.5%) were P. vivax (mono), P. vivax/Plasmodium falciparum (mixed), P. falciparum (mono) and negative by PCR, respectively. The overall agreement of rapid diagnostic test (RDT), site level microscopy and expert microscopists result with PCR was 90.41% (k: 0.49), 90.96% (k: 0.53), and 80.27% (k: 0.24). The overall prevalence of sexual (gametocyte) stage P. vivax in the study population was 215/361 (59.6%). The majority of these 215 samples (180; 83.7%) had below 1000 parasites/µl, with only four samples (1.9%) had ≥ 5000 parasites/µl. The gametocyte density was found to be weakly positive but statically significant with asexual parasitaemia (r = 0.31; p < 0.001). Conclusion Both microscopy and RDT showed moderate agreement with PCR in the detection and identification of P. vivax (mono) and P. vivax/P. falciparum (mixed) infections. Therefore, to achieve malaria elimination goals, strengthening routine malaria diagnostic methods by implementing diagnostic tools with a good performance in detecting and accurately identifying malaria species in clinical settings is recommended. Keywords Malaria Plasmodium vivax P.vivax/P.falciparum (mixed) Diagnostic method Ethiopia issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2023 ==== Body pmcBackground Malaria is a life-threatening disease caused by parasites that are transmitted to humans through the bites of infected female Anopheles mosquitoes. According to World Health Organization (WHO) 2022 report, there were an estimated of 247 million cases and 619,000 deaths from malaria worldwide [1]. Plasmodium vivax is the most geographically widespread parasite and poses a serious threat to public health [2, 3]. In Ethiopia, about 75% of the land mass is malarious, putting around 60% of the population at risk [4]. The proportion of Plasmodium falciparum and P. vivax in Ethiopia was 62.8% and 37.2%, respectively [5]. In co-endemic areas, where intense malaria-control activities have reduced the burden of P. falciparum, there has been a rise in the proportion of malaria attributable to P. vivax [6]. Plasmodium vivax is a cause of malaria, associated with a significant public health burden [7, 8]. The dormant liver stages, that is, hypnozoites, may cause relapse infections over the course of weeks to years after clearance of the blood stage infection [9, 10]. The control and elimination of P. vivax is more challenging than that of P. falciparum, a reflection of key differences in parasite and vector biology [11]. Clear understanding of the distribution and clinical management of P. vivax is essential for informed decisions on appropriate control strategies to be designed and implemented against this neglected species. Accurate and prompt diagnosis of malaria cases is key to the control and elimination of malaria [12–14]. The diagnosis of malaria using rapid diagnostic test (RDT) and microscopy have the advantages of being cheap, but these methods lack sufficient sensitivity to detect infections with low parasite density [15, 16], and often fails to identify a substantial fraction of P. vivax infections in blood [11]. In recent years, molecular diagnosis has emerged as the most sensitive and specific method for malaria diagnosis [17, 18]. Compared to real-time PCR assays, RDTs and microscopy are less effective for detecting low parasitaemia often seen in vivax infections [19]. Apart from the shortcoming in diagnostics, an increasing altitudinal range of mosquito distribution associated with climate change and human land use implies the potential for increased malaria burden across broader landscape, especially for countries of East Africa and South America [20]. Ethiopia has planned to eliminate malaria from specific geographic areas by 2020 and from the whole country by 2030 [21–23]. Plasmodium vivax distribution has been expanding to the highland, causing occasional malaria epidemics, although the existing deployed interventions seem to have an impact on the prevalence of this parasite [24].To achieve the elimination goal, the country must properly and consistently implement policies and practices which are used for the intervention of this neglected species. Poor diagnostic performance, low parasite density, the presence of gametocytes especially in asymptomatic infections, and the coexistence of different malarial species in the country hinder the progress towards elimination. So to achieve the elimination, sensitive diagnostic tools with good performance in detecting low parasitaemia infections and accurately identifying malarial species are necessary. This study aims to evaluate the performance of routine laboratory diagnostic methods for the diagnosis of pure P. vivax infection and P. vivax/P. falciparum mixed infection (referred to as ‘mixed infection’ thereafter) in febrile samples collected from five malaria endemic sites in Ethiopia. These sites represent different transmission intensities and environmental characteristics such as altitude. Methods Study design and study participants A cross-sectional study was conducted from February 2021 to September 2022 at five malaria endemic sites in Ethiopia. The study sites were selected from malaria endemic areas based on their P. vivax prevalence in the region and from different malaria risk stratification areas. The study sites include Aribaminch, Shewarobit, Metehara, Gambella, and Dubti (Fig. 1). Arbaminch hospital is located in the Southern Nation and Nationalities People Regional State in the southern part of the country (altitude 1200 m); Dubti hospital is located in the Afar Regional State in the northern-east part of the country (altitude 379 m); Gambella hospital is located in Gambella Regional State in the western part of the country (altitude 447 m); Metehara hospital is located in Oromia Regional State in the eastern part of the country (altitude 959 m); and Shewarobit hospital is located in Amhara Regional State in the northern part of the country (altitude 1268 m). Sample size Sample size determination was calculated using proportion of P. vivax (37.2%) from a total positive cases reported in Ethiopia(5). The following formula was used to calculate sample size:n=zα/22×p(1-p)ε2 P: proportion of P. vivax, Z: z- value at 5% level of significance, ε: margin of error, n: number of minimum sample size. Given that: p = 37.2%, Z = 1.96, and ε = 0.05. So the sample size calculated (n) was 358 and the total sample size with 10% non-response rate (N) was 394 (this is the sample collected at site level). The final sample size after re-examination of blood film slides at the central level was 365. A total of 394 participants who were presented with malaria sign/symptom and diagnosed positive for pure P. vivax or mixed infection using both RDT (this method was used in the hospital only for this study) and microscopy were included in this study. Blood smears were re-examined blindly by expert microscopists at national level and samples which showed no P. vivax were excluded. A total of 365 samples that were diagnosed positive for P. vivax (mono or mixed infection) based on RDT, site level microscopists and expert microscopists were selected for PCR analysis. Study flow chart The flow chart of the study conducted from February 2021 to September 2022 at five malaria endemic sites in Ethiopia is indicated in Fig. 2. Laboratory diagnosis Sample collection Finger prick blood sample was collected from suspected malaria patients who were referred to the laboratory of study sites. A unique identifier was assigned for each study participant to trace them at any time. The sample collected from suspected malaria patients was used for RDT and blood smears preparation. Thick and thin blood smears were stained with 10% working Giemsa solution (pH 7.2) for 10 min. Blood film slides were examined with 100X objective using microscope. Malaria laboratory diagnosis was done using RDT and microscopy in parallel for each suspected malaria patients. Then those who were positive for pure P. vivax and mixed infection using both RDT and microscopy were enrolled in the study. Two millilitre (2 ml) of venous blood sample was collected from volunteer individuals based on the inclusion criteria. The collected sample was used for the preparation of thin and thick blood film (used by the facility for external quality assessment programme), and for the preparation of dried blood spots (DBS). The DBS samples were kept at − 20 °C till shipped to the University of Strasbourg, France, for molecular analysis. Rapid diagnostic test RDT kit currently implemented by the country is SD BIOLINE Malaria Ag Pf/Pv (05FK80). It is a rapid, qualitative test for the detection of HRP-II (Histidine-rich protein II) specific to P. falciparum and Plasmodium lactate dehydrogenase (pLDH) specific to Plasmodium vivax. Five microlitres (5 µl) of whole blood was used for the test and the result was interpreted at 15 min (up to 30 min). Microscopy Microscopic examination of Giemsa-stained thick and thin blood film was used for the detection, identification and quantification of malaria parasites. The first diagnosis using microscopy was done at study site by site level microscopists. Site level microscopists are microscopists who are providing routine laboratory diagnosis service at study site (employees of the study sites). Parasite counts was measured for both sexual and asexual stages on thick film and reported per 200 WBCs or parasite count per microlitre of blood, assuming a total white blood cell count of 8000/µl. The densities of asexual and gametocyte stages in peripheral blood were determined by WHO certified microscopists using microscopy at national level. The quantification of asexual stage parasite density was conducted for P. vivax on the blood film slides with pure P. vivax infection and the asexual stage of both species on the blood film slides with a mixed infection. Whereas the density of gametocyte was estimated only for the gametocyte of P. vivax on both blood film slides with pure P. vivax and mixed species. The parasite density of both the asexual and sexual stages were then classified as low (below 1000 parasites per microlitre of blood), intermediate (1000–4999 parasites per microlitre of blood) and high (≥ 5000 parasites per microlitre of blood) [25]. Blood film slides were declared no parasite seen after examination of at least 100 high-power microscope fields [26]. Blood film slides were rechecked and quantified by WHO-certified malaria microscopists (who are working as reference readers of blood film slides in the country). DNA extraction Genomic DNA was extracted from DBS collected from study participants using QIAamp DNA Extraction kit (Cat.No: 79,216, Lot: 172,018,338, Germany) based on manufacture instructions. Each genomic DNA was extracted from one punch (with a diameter of 6 mm) of DBS sample, and DNA was eluted using 100 µL of TE (Tris-EDTA) buffer, then the extracted DNA was kept at − 20 °C till PCR process. Molecular diagnosis Genomic DNA was extracted from DBS collected from study participants using QIAamp DNA Extraction kit (Cat.No: 79,216, Lot: 172,018,338, Germany) based on manufacture instructions. Each genomic DNA was extracted from one punch (with a diameter of 6 mm) of DBS sample, and DNA was eluted using 100 µL of TE (Tris-EDTA) buffer, then the extracted DNA was kept at − 20 °C till PCR process. Table 1 Species-specific primers used for the detection and species identification of P. vivax and P. falciparum Species Forward or reverse Primer P. vivax Forward 5′ —TGCTACAGGTGCATCTCTTGTATTC Reverse 5′ —ATTTGTCCCCAAGGTAAAACG P. falciparum Forward 5′ —ATGGATATCTGGATTGATTTTATTTATGA Reverse 5′—TCCTCCACATATCCAAATTACTGC The PCR amplifications using Bio-Rad CFX96 Real-Time PCR detection system were carried out following 10 µL of Advanced mix sybgreen (2x) (Catalog # 1,725,271, Bio-Rad laboratories Inc. United State), 4 µL of molecular water, 0.5 µL of each primer (Table 1), and 5 µL of DNA template with the final volume of 20 µL. Quality assurance Training has been given for data and sample collectors. The clarity and flow of each question and the time to fill out the questionnaire were assessed. The collected data was checked for completeness by the principal investigator. The quality of kits and/or reagents which were used for all diagnostic methods have been assured using different quality control methods specific to each reagent and kit. Statistical analysis All data were entered into Microsoft Office Excel and statistical analyses were performed with Statistical Package for Social Sciences (SPSS) version 25. Descriptive statistics were used to calculate proportions, agreement, frequencies, and ranges. Fisher’s exact tests and correlation test were used to detect associations and relationship between different variables, respectively. The strength of agreement between RDT, site microscopy, and expert microscopists with PCR were determined by Kappa (K) value. Kappa (K) value is classified as: 0.01–0.20 slight agreement, 0.21–0.40 fair agreement, 0.41–0.60 moderate agreement, 0.61–0.80 substantial agreement, and 0.81–1.00 almost perfect agreement [13, 29]. The strength of correlation was interpreted as; 0.00–0.10 Negligible correlation, 0.10–0.39 Weak correlation, 0.40–0.69 Moderate correlation, 0.70–0.89 Strong correlation, and 0.90–1.00 Very strong correlation [30]. The p-value < 0.05 was considered statically significant. Results Characteristics of the study participants Females accounted for 35.1% (128/365) of the study participants. The mean age of the participants was 24.8 (ranging from 1 to 80 years old) with 137 (37.5%) of the participants age from 15 to 24 years old. Among all participants, 75 (20.5%) were farmer and 212 (58.1%) live in an urban area (Table 2). Table 2 Socio demographic characteristics of study participants, Ethiopia (n = 365) Variables Category Number Percent % Sex Female 128 35.1 Male 237 64.9 Age < 5 15 4.1 5–14 26 7.1 15–24 137 37.5 25–34 123 33.7 ≥ 35 64 17.5 Residence Rural 153 41.9 Urban 212 58.1 Marital status Single 217 59.5 Married 145 39.7 Divorced 3 0.8 Study sites Aribaminch 75 20.5 Shewarobit 70 19.2 Metehara 75 20.5 Gambella 75 20.5 Dubti 70 19.2 Performance of diagnostic methods For the 329 samples that were diagnosed as pure P. vivax by RDT, 310 (94.2%) were pure P. vivax infection and 17 (5.2%) were mixed infection based on PCR; whereas for the 36 samples diagnosed as mixed infection by RDT, 14 (38.9%) were pure P. vivax infection and 20 (55.6%) were P. vivax/P. falciparum mixed infection based on PCR. For the 327 samples diagnosed as pure P. vivax infection by site level microscopists, 310 (94.8%) were pure P. vivax infection, 15 (4.6%) were mixed infection, 1 (0.3%) was pure P. falciparum, and 1 (0.3%) was negative using PCR. Among the 38 mixed infections diagnosed by site level microscopists, 14 (36.8%) were pure P. vivax infection, and 22 (57.9%) were mixed infection using PCR. Of the 68 samples diagnosed as mixed infections by expert microscopists, 49 (72%) were pure P. vivax infection, 18 (26.5%) were mixed infections and 1 (1.5%) was pure P. falciparum infection using PCR. PCR was considered as a reference method for the evaluation of each the diagnostic methods. Of the 365 samples; 324 (88.8%), 37(10.1%), 2 (0.5%) and 2 (0.5%) were P. vivax, P .vivax/P. falciparum, P. falciparum and negative, respectively using PCR. The overall agreement of RDT, site level microscopy and expert microscopists result was 90.41% (K: 0495), 90.96% (k: 0.534), and 80.27% (k: 0.238), respectively (Table 3). The overall agreement of RDT and site level microscopy with expert microscopists result was 81.37% (K: 0249), and 82.19% (k: 0.286), respectively. Table 3 Over all agreement of RDT and microscopy against real-time PCR as gold standard (n = 365) Results Reference Method (PCR) Agreement Kappa Kappa Interpretation/agreement Pv Pv/Pf Pf Negative Total RDT Pv 310 17 1 1 329 90.41% 0.495 Moderate Pv/Pf 14 20 1 1 36 Total 324 37 2 2 365 Site level Microscopists Pv 310 15 1 1 327 90.96% 0.534 Moderate Pv/Pf 14 22 1 1 38 Total 324 37 2 2 365 Expert Microscopists Pv 275 19 1 2 297 80.27% 0.238 Fair Pv/Pf 49 18 1 0 68 Total 324 37 2 2 365 Samples included in this study were those which were positive for P.vivax (Mono or mixed infection) using RDT and microscopy, so P.falciparum (mono) and negative results were not expected from RDT and Microscopy For the 297 samples diagnosed as pure P. vivax infection by expert microscopists, 279 (93.9%) were pure P. vivax infection and 18 (6.1%) were mixed infection by RDT and site level microscopists, whereas from 68 samples diagnosed as mixed infection by expert microscopists, 50 (73.5%) and 48 (70.6%) samples were diagnosed as pure P. vivax infection by RDT and site level microscopists, respectively (Table 4). Table 4 Over all agreement of RDT and site level microscopy against the result of Expert Microscopists (n = 365) Results Expert microscopists Agreement Kappa Kappa interpretation Pv Pv/Pf Total RDT Pv 279 50 329 81.37% 0.249 Fair Pv/Pf 18 18 36 Total 297 68 365 Site level microscopists Pv 279 48 327 82.19% 0.286 Fair Pv/Pf 18 20 38 Total 297 68 365 Among all the five sites, Dubti (Afar) health facility had the lowest agreement in diagnostic results between the site level microscopists and PCR (81.43%), whereas the agreement of Shewarobit and Gambella hospitals had the highest agreement of 94.29% and 98.67%, respectively. In Dubti, among the 63 samples diagnosed as pure P. vivax infection by site level microscopists, 52 (82.5%), 10 (15.9%) and 1 (1.6%) were pure P. vivax infection, P. vivax/P. falciparum mixed infection and P. falciparum infection, respectively, based on PCR (Table 5). In Shewarobit, all the samples diagnosed as mixed infection by site level microscopists were P. vivax (mono) infection based on PCR. Table 5 Agreement of site level microscopists result with reference method per study sites (n = 365) PCR Diagnosis and Identification Agreement Study site name Evaluated Results Pv Pv/Pf Pf Negative Total Site level Microscopists Result Aribaminch Pv 70 0 0 0 70 93.33% Pv/Pf 4 0 0 1 5 Total 74 0 0 1 75 Shewarobit Pv 66 0 0 0 66 94.29% Pv/Pf 4 0 0 0 4 Total 70 0 0 0 70 Metehara Pv 74 1 0 0 75 98.67% Pv/Pf 0 0 0 0 0 Total 74 1 0 0 75 Gambella Pv 48 4 0 1 53 86.67% Pv/Pf 5 17 0 0 22 Total 53 21 0 1 75 Dubti Pv 52 10 1 0 63 81.43% Pv/Pf 1 5 1 0 7 Total 53 15 2 0 70 Based on PCR, 324 of the samples were pure P. vivax infection and 37 were mixed infection. Of 324 pure P. vivax samples, 106 (32.7%) were reported from altitude below 500 m and 144 (44.4%) were from altitude of 1000–1500 m. For the 37 mixed infection samples, 36 (97.3%) were from altitude below 500 m and none were from altitude of 1000–1500 m. Pure P. vivax and mixed species identified using PCR were significantly associated with the altitude of study site (p < 0.001). Among the 37 mixed infection, 23 (62.2%) were from rural area, significantly higher than those 324 pure P. vivax, of which 129 (39.8%) were from rural area (p = 0.009; Table 6). Table 6 Association of pure P. vivax and P. vivax/P. falciparum mixed infection with different variables (n = 361) Variables Pure P. vivax and P. vivax/P. falciparum mixed infection identified using PCR P-Value Pv Pv/Pf Total Study site altitude < 500 m 106 (32.7%) 36 (97.3%) 142 < 0.001 500–1000 m 74 (22.8%) 1 (2.7%) 75 1000–1500 m 144 (44.4%) 0 (0%) 144 Total 324 37 361 Age group (in years) < 5 14 (4.3%) 1 (2.7%) 15 0.263 5–14 22 (6.8%) 3 (8.1%) 25 15–24 117 (36.1) 18 (48.6%) 135 25–34 109 (33.6%) 13 (35.1%) 122 ≥ 35 62 (19.1%) 2 (5.4%) 64 Total 324 37 361 Residence area Rural 129 (39.8%) 23 (62.2%) 152 0.009 Urban 195 (60.2%) 14 (37.8%) 209 Total 324 37 361 Sex Female 113 (34.9%) 13 (35.1%) 126 0.975 Male 211 (65.1%) 24 (64.9%) 235 Total 324 37 361 Asexual and sexual parasite density From a total of 365 samples identified as pure P. vivax and mixed infections by RDT, 329 were pure P. vivax and 36 were mixed infections. Of 329 pure P. vivax, the asexual parasite density of 53 (16.1%), 124 (37.7%), and 152 (46.2%) samples had the parasite density below 1000 parasites/µL, between 1000 and 4999 parasites/µL, and ≥ 5000 parasites/µL, respectively. Whereas from 36 samples with P. vivax/P. falciparum mixed infections, the asexual parasite density of 9 (25%), 8 (22.2%), and 19 (52.8%) samples had the parasite density below 1000 parasites/µL, between 1000 and 4999 parasites/µL, and ≥ 5000 parasites/µL, respectively. The asexual stage parasite density has no significant association with the RDT Result (p = 0.138). For the 361 samples identified as pure P. vivax and mixed infections by PCR, the mean asexual (the density of both species was quantified in a mixed infection) parasite density was 11,296 parasites/µL (ranging from 44 to 68,880 parasites/µL). The asexual parasite density of 60 (16.6%) samples were below 1000 parasites/µL, 131 (36.3%) were between 1000 and 4999 parasites/µL, and 170 (47.1%) were ≥ 5000 parasites/µL. For the 60 samples with an asexual stage parasite density below 1000 parasites/µL, 131 samples with an asexual stage parasite density between 1000 and 4999 parasites/µL, and 170 samples with an asexual stage parasite density ≥ 5000 parasites/µL, 4 (6.7%), 11 (8.4%) and 22 (12.9%) were mixed infection, respectively. The overall prevalence of sexual (gametocyte) stages of P. vivax was 215/361 (59.6%). Among these 215 samples with gametocyte, 180 (83.7%) were below 1000 parasites/µL, 31 (14.4%) were between 1000 and 4999 parasites/µL, and 4 (1.9%) were ≥ 5000 parasites/µL. For the 180 samples with a sexual stage parasite density below 1000 parasites/µL and from 31 samples with a sexual stage parasite density between 1000 and 4999 parasites/µL, 16 (8.9%) and 5 (16.1%) were mixed infection, respectively. For the 60 samples with an asexual stage parasite density below 1000 parasites/µL, 6 (10.0%) were from Aribaminch and 19 (31.7%) were from Gambella. For the 131 samples with an asexual stage parasite density between 1000 and 4999 parasites/µL, 36 (27.5%) were from Metehara, which was higher than Dubti 21 (16.0%). For the 180 samples with a sexual stage parasite density less than 1000 parasites/µL, 23.9% were from Shewarobit, which was higher than Gambella (19.4%) and Dubti (13.9%). Both an asexual and sexual stage parasite density were significantly associated with the study site (p < 0.001) (Fig. 3). To avoid any bias in parasite density due to mixed infection, only 324 samples that were diagnosed as pure P. vivax infection by PCR were used to test for the correlation between asexual and sexual stage densities. The mean density of asexual parasite was 10,496 parasites/µL (95% confidence interval: 9106−12,020 parasites/µL), and that of sexual (gametocyte) parasite was 337 parasites/µL (95% confidence interval: 266–417 parasites/µL). A weak correlation (r) was detected between asexual and gametocyte stages density among the samples (r = 0.314 with 95% confidence interval: 0.214–0.422, p< 0.001) (Fig. 4)   Discussion Accurate and prompt laboratory diagnosis of malaria cases caused by P. vivax and other Plasmodium species is key to the control and elimination of this disease [31]. Previous studies have demonstrated higher sensitivity and specificity of real time-PCR based techniques compared to microscopy and RDT for the diagnosis of malaria parasite [32]. In this study, the overall agreement of RDT with PCR was 90.41%, which was higher than a study conducted in eastern Sudan with the agreement 81.2%(33), and Zambia 84.6% [33], but lower than 96.67% reported in China-Myanmar [34] and 97.6% in United Republic of Tanzania [35]. The inter assay agreement determined by Cohen’s Kappa coefficient of RDT and PCR in this study was k = 0.495, denoting (moderate agreement.), this was a similar level of agreement strength with some studies including work in Ghana with k = 0.47(moderate agreement) [36], but much lower than other studies conducted in Iran (k = 0.695; substantial agreement) [37], Cameroon (k = 0.71; substantial agreement) [38], Iran (k = 0.79; substantial agreement) [39], and Bangladesh (k = 0.80; substantial agreement) [19]. These findings showed that the agreement between RDT and PCR was not perfect likely due to low sensitivity and specificity of RDTs in detection and identification of Plasmodium species, suboptimal storage condition that affects the diagnostic quality of the kits, and/or lack of competency by laboratory personnel in the result interpretation. Compared to the site level microscopists, the expert microscopists who were certified by WHO showed a lower agreement with PCR. The agreement of site level microscopy with PCR was 90.96%, which was relatively higher than a study conducted in Addis Ababa, Ethiopia with the percent agreement of 71.4% [40], Adama, Ethiopia 77.3% [32], but relatively lower than the study findings reported from; Hawassa Town, Southern Ethiopia 88% [41], rechecking laboratories in Ethiopia 96.8% [13], Zambia 91.3% [33], United Republic of Tanzania 93.5% [35], and eastern Sudan 96.1% [42]. The strength of agreement between these two diagnostic methods was moderate, slightly higher than that reported in Ghana (k = 0.40) [36] and almost similar with that in Cameroon (k = 0.54) [38], but relatively low compare to that in Iran (k = 0.714) [37, 39] and Bangladesh (k = 0.84) [19]. Even though microscopy is an easy, cheap, simple, and the gold standard method for malaria diagnosis [37], the agreement of this method with PCR was moderate. This may be due to low parasitaemia of samples, errors by microscopists, as well as poor quality of reagents and equipment. Although microscopy is the gold standard, missing mixed infections may lead to treatments that would fail to clear the presenting blood-stage infection [43]. Poor performance on detection and/or species identification, such as reporting P. vivax /P. falciparum mixed infection as a mono-infection can lead to inappropriate treatment. Our findings showed that P. vivax/P. falciparum mixed infection is higher at low altitude, and that most of the identified P. falciparum infected samples were from sites at low altitude, similar to a prior study conducted in Northeastern Tanzania confirming that P. falciparum prevalence had a negative relationship with altitude [44]. The increasing evidence on the transmission of P. vivax in the areas traditionally considered as malaria free is an indication of the expansion of malaria transmission in Ethiopia to higher altitude settings [24], this may be due to local environmental modifications or expansion of mosquito’s habitat to non-endemic regions; besides changing human settlement pattern. In this study, the correlation between asexual and gametocyte stage density was significant but weakly positive correlation, given that a previous study conducted in Brazil showed a moderate correlation across the range of parasite densities observed in P. vivax-infected blood donors [45], whereas the studies conducted in Thailand [46], Indonesia [47], and western Thailand and northern Peru [48] reported a significant and strong correlation between gametocyte density and asexual parasitemia. This difference may be explained by the competency of microscopists or the performance of the method used to properly differentiate and quantify different stages of the parasite. This study was largely limited by its study population. The study population were only malaria patients who were diagnosed with pure P. vivax and mixed infections. It lacks negative samples, which is important to evaluate diagnostic method performance on the identification of true negative. So this made us challenging to evaluate the performance of the methods using different parameters like sensitivity and specificity. The other limitation of this study was conducting parasite density estimation only by microscopists using microscope. It may be a challenge to getting the exact parasite density because of the competency of microscopists. Conclusion Both microscopy and RDT showed moderate agreement with PCR in the detection and identification of pure P. vivax and P. vivax/P. falciparum mixed infections. Even though microscopy and RDT are used routinely for malaria laboratory diagnosis in Ethiopia, a substantial number of P. vivax mono-infections are misidentified as mixed infections and such an outcome could affect the anti-malarial drug treatment regime. Therefore, to achieve malaria elimination goals, it is recommended to strengthen routine malaria laboratory diagnostic methods by implementing diagnostic tools with a good performance in detecting and accurately identifying malaria species in clinical settings, providing adequate in-service technical training and strengthening the external quality assessment programme. Fig. 1 A map showing study sites, Ethiopia.  Fig. 2 Flow chart of the study conducted from Feb. 2021 to Sep 2022 at five malaria endemic sites. *Patients with no P. vivax infection using Microscopy and RDT were excluded, because the aim was to assess the performance of methods on the diagnosis of pure P. vivax or P. vivax/P. falciparum (mixed) infection in Ethiopia Fig. 3 Asexual and gametocyte densities by study site. Fig. 4 Correlation between asexual parasitemia and gametocytemia in pure P. vivax infections Abbreviations ALIPB Aklilu lema Institute of pathobiology DBS Dried blood spots DNA Deoxyribonucleic acid EPHI Ethiopian Public Health Institute HRP Histidine-rich protein IRB Institutional review board MoE Ministry of education NSP 5National strategic plan pLDH Plasmodium lactate dehydrogenase Pv/Pf Plasmodium vivax and Plasmodium falciparum RDT Rapid diagnostic tests RT PCR Real time polymerase chain reaction SOP Standard operating procedures SPSS Statistical package for social sciences WBC White blood cells WHO World Health Organization Acknowledgements This work is partially supported by SIDA project fund, and Human, Heredity and Health in Africa (H3Africa) [H3A-18-002]. H3Africa is managed by Science for Africa Foundation (SFA Foundation) in partnership with Wellcome, NIH and AfSHG. JJJ was funded through the National Institutes of Health (K24AI134990), and EPHI. We would like to acknowledge all individual personnel who were technically contributed for this study; staffs of study site laboratory, staffs of ALIPB (parasitology department), staffs of Strasbourg University department of parasitology (Lydia and Cécile LANG), and statistician (Dereje Dilu, Abriham Keralem and Chalie Mulu). We need offer our sincere appreciation to all regional health bureaus, study sites, and EPHI for their support. Lastly but not least, our genuine gratitude goes to all study participants who were participated in this study. Author contributions Conceptualization and Design: AA, LG, Drafting Proposal: AA, Revision: AA, LG, DM, SD, AA2, JJ, EL, Data Collection: AA, LG, AA2, SD, Laboratory analysis: AA, DM, LG, Validation: AA, LG, DM, SD, AA2, JJ, EL, Writing manuscript—draft: AA, Writing manuscript—review and editing: AA, LG, DM, SD, AA2, JJ, EL. Funding Data collection was supported by Aklilu Lema Institute of Pathobiology, Addis Ababa University, and laboratory analysis was supported by University of Strasbourg, France. Availability of data and materials All relevant data are within the manuscript. The data that support the findings of this study are available from the corresponding author on reasonable request. Declarations Ethical approval and consent to participate was obtained from the ministry of education (MoE) via its national research ethical review committee (Ref No:7/2-514/m259/35), and Aklilu Lema Institute of Pathobiology Institutional Review Board (IRB)(Ref No: ALIPB IRB/34/2013/20), Addis Ababa University, Addis Ababa, Ethiopia. An official letter was written to study sites and the study was commenced after permission was obtained from respective health facilities. Written Informed consent and assent has been taken from all study participants using their local language of the region before collecting blood sample. Consent for publication All authors have read and agreed to publish this article. Competing interests The authors declare no competing interests. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. ==== Refs References 1. WHO World malaria report 2022 Geneva World Health Organization 2. Baird KJ Evidence and implications of mortality associated with acute plasmodium vivax malaria Clin Microbiol Rev 2013 26 36 57 10.1128/CMR.00074-12 23297258 3. Siqueira AM Lacerda MVG Magalhães BML Mourão MPG Melo GC Alexandre MAA Characterization of Plasmodium vivax-associated admissions to reference hospitals in Brazil and India BMC Med 2015 13 57 10.1186/s12916-015-0302-y 25889040 4. FMoH. National strategic plan for malaria prevention, control and elimination in Ethiopia 2011–2015. Addis Ababa, 2010.  https://extranet.who.int/countryplanningcycles/sites/default/files/country_docs/Ethiopia/ethiopia_malaria_national_strategic_plan_2011-2015_130810.pdf. 5. Deress T Girma M Plasmodium falciparum and Plasmodium vivax prevalence in Ethiopia: a systematic review and Meta-analysis Malar Res Treat. 2019 2–29 7065064 6. Price RN Commons RJ Battle KE Thriemer K Mendis K Plasmodium vivax in the era of the shrinking P. falciparum map Trends Parasitol 2020 36 6 560 70 10.1016/j.pt.2020.03.009 32407682 7. Douglas NM Lampah DA Kenangalem E Simpson JA Poespoprodjo JR Sugiarto P Major burden of severe anemia from non-falciparum malaria species in Southern Papua: a hospital-based surveillance study PLoS Med 2013 10 e1001575 10.1371/journal.pmed.1001575 24358031 8. WHO World malaria R 2021 Geneva WHO, Organization 9. Michon P Cole-tobian JL Dabod E Schoepflin S Igu J Susapu M The risk of malarial infections and disease in Papua New guinean children Am J Trop Med Hygiene. 2013 76 997 1008 10.4269/ajtmh.2007.76.997 10. Wångdahl A Sondén K Wyss K Stenström C Björklund D Zhang J Relapse of Plasmodium vivax and Plasmodium falciparum malaria with and without primaquine treatment in a nonendemic area Clin Infect Dis 2022 74 1199 207 10.1093/cid/ciab610 34216464 11. Ding XC Ade MP Baird JK Cheng Q Cunningham J Dhorda M Defining the next generation of Plasmodium vivax diagnostic tests for control and elimination: target product profiles PLoS Negl Trop Dis 2017 11 e0005516 10.1371/journal.pntd.0005516 28369085 12. Yin J Li M Yan H Zhou S Xia Z Laboratory diagnosis for malaria in the elimination phase in China: efforts and challenges Front Med 2022 16 10 6 10.1007/s11684-021-0889-7 35226298 13. Abnet A Meseret B Habtamu A Wondwossen K Andargachew G Adino D Performance evaluation of malaria microscopists working at rechecking laboratories in Ethiopia Malar World J 2017 8 6 14. Samane AK Nahid HZ Saaed S Khazan H Ali H Ahmad R Comparision of microscopy and RDTs techniques for laboratory detection of malaria Afr J Biotechnol 2010 9 1514 6 10.5897/AJB09.1155 15. Tedla M A focus on improving molecular diagnostic approaches to malaria control and elimination in low transmission settings: review Parasite Epidemiol Control 2019 6 e00107 10.1016/j.parepi.2019.e00107 31193331 16. Wangai LN Karau MG Njiruh PN Sabah O Kimani FT Magoma G Sensitivity of microscopy compared to molecular diagnosis of P. Falciparum: implications on malaria treatment in epidemic areas in Kenya Afr J Infect Dis 2011 5 1 6 10.4314/ajid.v5i1.66504 23878701 17. Siwal N Singh US Dash M Kar S Rani S Rawal C Malaria diagnosis by PCR revealed differential distribution of mono and mixed species infections by plasmodium falciparum and P. vivax in India PLoS ONE 2018 13 e0193046 10.1371/journal.pone.0193046 29565981 18. Bharti AR Patra KP Chuquiyauri R Kosek M Gilman RH Llanos-Cuentas A Short report: polymerase chain reaction detection of Plasmodium vivax and Plasmodium falciparum DNA from stored serum samples: implications for retrospective diagnosis of malaria Am J Trop Med Hyg 2007 77 444 6 10.4269/ajtmh.2007.77.444 17827357 19. Alam MS Mohon AN Mustafa S Khan WA Islam N Karim MJ Real-time PCR assay and rapid diagnostic tests for the diagnosis of clinically suspected malaria patients in Bangladesh Malar J 2011 10 175 10.1186/1475-2875-10-175 21703009 20. Siraj AS Santos-Vega M Bouma MJ Yadeta D Carrascal DR Pascual M Altitudinal changes in malaria incidence in highlands of Ethiopia and Colombia Science 2013 343 1154 8 10.1126/science.1244325 21. FMoH. National Malaria Strategic Plan: 2014–2020. Addis Ababa, Ethiopia. 2014. https://www.vivaxmalaria.org/sites/p-vivax/files/content/attachments/2019-06-04/National Malaria Program Monitoring and Evaluation Plan 2014–2020.pdf. 22. President’s Malaria Initiative, Operational Plan M, Addis Ababa E . 2019 . https://www.pmi.gov/docs/default-source/default-document-library/malaria-operational-plans/fy19/fy-2019-ethiopia-malaria-operational-plan.pdf?sfvrsn=3. 23. Nega D Abera A Gidey B Mekasha S Abebe A Dillu D Baseline malaria prevalence at the targeted pre-elimination districts in Ethiopia BMC Public Health 2021 21 1996 10.1186/s12889-021-12036-5 34732150 24. Ketema T Bacha K Getahun K Del Portillo HA Bassat Q Plasmodium vivax epidemiology in Ethiopia 2000–2020: a systematic review and meta-analysis PLoS Negl Trop Dis 2021 15 e0009781 10.1371/journal.pntd.0009781 34525091 25. Debash H Bisetegn H Ebrahim H Feleke DG Gedefie A Tilahun M Prevalence and associated risk factors of malaria among febrile under-five children visiting health facilities in Ziquala district, Northeast Ethiopia: a multicenter cross-sectional study PLoS ONE 2022 17 e0276899 10.1371/journal.pone.0276899 36301956 26. Nicholas D Julie S Aung P Hadjar S Armedy H Enny K Gametocyte Dynamics and the role of drugs in reducing the transmission potential of Plasmodium vivax J Infect Dis 2013 208 801 12 10.1093/infdis/jit261 23766527 27. Canier L Khim N Kim S Eam R Khean C Loch K Malaria PCR detection in cambodian low-transmission settings: dried blood spots versus venous blood samples Am J Trop Med Hyg 2015 92 573 7 10.4269/ajtmh.14-0614 25561570 28. Xu W Morris U Aydin-Schmidt B Msellem MI Shakely D Petzold M SYBR green real-time PCR-RFLP assay targeting the Plasmodium cytochrome B gene - a highly sensitive molecular tool for malaria parasite detection and species determination PLoS ONE 2015 10 e0120210 10.1371/journal.pone.0120210 25774805 29. Sim JWC The Kappa statistic in reliability studies: use, interpretation, and sample size requirements Phys Ther 2005 85 257 68 10.1093/ptj/85.3.257 15733050 30. Schober P Boer C Schwarte LA Correlation coefficients: appropriate use and interpretation Anesth Analg 2018 126 1763 8 10.1213/ANE.0000000000002864 29481436 31. Nega D Abebe A Abera A Gidey B Gtsadik A Tasew G Comprehensive competency assessment of malaria microscopists and laboratory diagnostic service capacity in districts stratified for malaria elimination in Ethiopia PLoS ONE 2020 15 e0235151 10.1371/journal.pone.0235151 32584866 32. Beyene MB Teshome S Yehenew A Terefework Z Stuitje AR Abebe T Assessing the diagnostic performance of a novel RT-PCR fluorescence method for the detection of human plasmodium species PLoS ONE. 2022 17 e0272094 10.1371/journal.pone.0272094 35925877 33. Mwenda MC Fola AA Ciubotariu II Mulube C Mambwe B Kasaro R Performance evaluation of RDT, light microscopy, and PET-PCR for detecting Plasmodium falciparum malaria infections in the 2018 Zambia National Malaria Indicator Survey Malar J 2021 20 386 10.1186/s12936-021-03917-6 34583692 34. Xiaodong S Tambo E Chun W Zhibin C Yan D Jian W Diagnostic performance of CareStart malaria HRP2/pLDH (Pf/pan) combo test versus standard microscopy on falciparum and vivax malaria between China-Myanmar endemic borders Malar J 2013 12 6 10.1186/1475-2875-12-6 23294729 35. Nicastri E Bevilacqua N Schepisi MS Paglia MG Meschi S Ame SM Accuracy of malaria diagnosis by microscopy, rapid diagnostic test, and PCR methods and evidence of antimalarial overprescription in non-severe febrile patients in two Tanzanian hospitals Am J Trop Med Hyg 2009 80 712 7 10.4269/ajtmh.2009.80.712 19407111 36. Agyapong FO Ansong D Owusu-Ofori A Martin-Peprah R Diagnostic performance of blood film microscopy and PfHRP2-based RDT in a routine clinical setting of a secondary health facility in Ghana J Adv Med Med Res 2019 31 1 9 10.9734/jammr/2019/v31i430294 37. Mirahmadi H Rahmati-Balaghaleh M Afzalaghaee M Zarean M Shamsian SA Mehravaran A Detection of malaria using blood smear by light microscopy, RDT and nested-PCR for suspected patients in south-eastern Iran Gene Rep 2021 25 101339 10.1016/j.genrep.2021.101339 38. Mfuh KO Achonduh-Atijegbe OA Bekindaka ON Esemu LF Mbakop CD Gandhi K A comparison of thick-film microscopy, rapid diagnostic test, and polymerase chain reaction for accurate diagnosis of Plasmodium falciparum malaria Malar J 2019 18 73 10.1186/s12936-019-2711-4 30866947 39. Ehtesham R Fazaeli A Raeisi A Keshavarz H Heidari A Detection of mixed-species infections of Plasmodium falciparum and Plasmodium vivax by nested PCR and rapid diagnostic tests in Southeastern Iran Am J Trop Med Hyg 2015 93 181 5 10.4269/ajtmh.14-0650 25962771 40. Yitbarek T Nega D Tasew G Taye B Desta K Performance evaluation of malaria microscopists at defense health facilities in Addis Ababa and its surrounding areas, Ethiopia PLoS ONE 2016 11 e0166170 10.1371/journal.pone.0166170 27893838 41. Ayalew F Tilahun B Taye B Performance evaluation of laboratory professionals on malaria microscopy in Hawassa Town, Southern Ethiopia BMC Res Notes 2014 7 839 10.1186/1756-0500-7-839 25422030 42. Osman MMM Nour BYM Sedig MF De Bes L Babikir AM Mohamedani AA Informed decision-making before changing to RDT: a comparison of microscopy, rapid diagnostic test and molecular techniques for the diagnosis and identification of malaria parasites in Kassala, eastern Sudan Trop Med Int Heal 2010 15 1442 8 10.1111/j.1365-3156.2010.02659.x 43. Leonard CM Mohammed H Tadesse M McCaffery JN Nace D Halsey ES Missed Plasmodium falciparum and Plasmodium vivax mixed infections in Ethiopia threaten malaria elimination Am J Trop Med Hyg 2022 106 667 70 10.4269/ajtmh.21-0796 44. Drakeley CJ Carneiro I Reyburn H Malima R Lusingu JPA Cox J Altitude-dependent and -independent variations in Plasmodium falciparum prevalence in northeastern Tanzania J Infect Dis 2005 191 1589 98 10.1086/429669 15838785 45. Ferreira MU Corder RM Johansen IC Kattenberg JH Moreno M Rosas-Aguirre A Relative contribution of low-density and asymptomatic infections to Plasmodium vivax transmission in the Amazon: pooled analysis of individual participant data from population-based cross-sectional surveys Lancet Reg Heal - Am 2022 9 100169 46. Bantuchai S Imad H Nguitragool W Plasmodium vivax gametocytes and transmission Parasitol Int 2022 87 102497 10.1016/j.parint.2021.102497 34748969 47. Kosasih A Koepfli C Dahlan MS Hawley WA Baird JK Mueller I Gametocyte carriage of Plasmodium falciparum (pfs25) and Plasmodium vivax (pvs25) during mass screening and treatment in West Timor, Indonesia: a longitudinal prospective study Malar J 2021 20 177 10.1186/s12936-021-03709-y 33836772 48. McKenzie FE Chansuda W Alan JM Rus JF Barnyen P Carmen L E   Gametocytemia in Plasmodium vivax and Plasmodium falciparum infections J Parasitol 2006 92 1281 5 10.1645/GE-911R.1 17304807