==== Front MicroPubl Biol MicroPubl Biol microPublication Biology 2578-9430 Caltech Library 10.17912/micropub.biology.000759 New Finding Negative Result Expression Data Zea Mays Characterization of mechanosensitive MSL gene family expression in Zea mays aerial and subterranean brace roots Hazelwood Olivia S Conceptualization Formal analysis Investigation Writing - original draft Writing - review & editing 1 Hostetler Ashley N Data curation Formal analysis Validation Visualization Writing - original draft Writing - review & editing 1 Ikiriko Irene I Writing - original draft Writing - review & editing 1 Sparks Erin E Conceptualization Formal analysis Investigation Methodology Project administration Writing - original draft Writing - review & editing 1§ 1 Department of Plant and Soil Sciences, University of Delaware, Newark, Delaware, United States § Correspondence to: Erin E Sparks ( esparks@udel.edu ) The authors declare that there are no conflicts of interest present. 16 6 2023 2023 2023 10.17912/micropub.biology.00075929 1 2023 1 1 1970 14 6 2023 Copyright: © 2023 by the authors 2023 https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Plants must be able to sense and respond to mechanical stresses encountered throughout their lifespan. The MscS-Like (MSL) family of mechanosensitive ion channels is one mechanism to perceive mechanical stresses. In maize, brace roots emerge from stem nodes above the soil and some remain aerial while some grow into the soil. We tested the hypothesis that MSL gene expression is higher in subterranean brace roots compared to those that remain aerial. However, there was no difference in MSL expression between the two environments. This work sets the foundation for a deeper understanding of MSL gene expression and function in maize. NSF CMMI Award #2040346 ==== Body pmc Figure 1. MSL gene expression in maize brace roots varies by plant, but not environment (aerial or subterranean) A) Maize brace roots are roots that develop from stem nodes above the soil. These roots may remain aerial (called aerial brace roots throughout) or enter the soil (called subterranean brace roots throughout). B) Analysis of quantitative Reverse Transcriptase (qRT-) PCR results shows that aerial and subterranean brace roots were not significantly different for MSL gene expression (p < 0.05). C) The log2 fold change expression of MSL genes between subterranean and aerial brace roots is shown for each plant. These log2 fold change values demonstrate the variation in expression differences between the two environments. D) Considering only expression values of log2 fold change > |1|, we see that the relative expression between root environments varies by plant. Description Plants must perceive and respond to mechanical stimuli in order to survive. Examples of mechanical stimuli include external forces such as gravity, wind, and touch, as well as internal forces from cell division, cell expansion, and cell differentiation. These forces can often signal threats or significant developmental events, and in order for plants to respond to these stimuli, they must have mechanisms to detect it (Toyota et al. 2018) . Plants contain a number of conserved mechanosensitive (MS) ion channels that sense mechanical stress and can generate ion signals that facilitate the plant’s response to these mechanical stimuli (Basu and Haswell 2017; Guichard et al. 2022) . There are five families of MS proteins that have been discovered in plants and include the Mechanosensitive channel of Small conductance-Like (MSL), Hyperosmolality-gated Calcium-permeable channels (OSCA), Mid1-Complementing Activity (MCA), Piezo, and Two-Pore K + channel (TPK) (Guichard et al. 2022) . So far, the best studied of these MS channels are the MSL in the model plant Arabidopsis thaliana . In Arabidopsis, six of the ten MSL (AtMSL) family proteins have been characterized. All of the characterized AtMSLs cluster in two distinct classes and act as osmotic safety valves, which function to relieve osmotic stress (Basu and Haswell 2017) . Class I proteins are organelle membrane localized and include the characterized AtMSL1-AtMSL3 proteins. AtMSL1 is important for modulating the bioenergetic function of the mitochondria (Lee et al. 2016) . AtMSL2 and AtMSL3 are localized to the plastid envelope and aid in maintaining plastid size and shape (Haswell and Meyerowitz 2006) . Class II proteins, which include AtMSL8-AtMSL10, are localized to the plasma membrane. AtMSL8 is expressed in the plasma membrane of pollen grains where it maintains cellular integrity required for pollen rehydration during fertilization (Hamilton et al. 2015) . Although a physiological role for AtMSL9 and AtMSL10 is yet to be identified, absence of stretch-gated activities in msl9-1;msl10-1 double mutants suggest that both proteins form a heteromeric complex in the plasma membrane of root cells during mechanosensing (Haswell et al. 2008; Peyronnet et al. 2008) . However, overexpression of AtMSL10 promotes cell death (Veley et al. 2014) and reduces susceptibility to Pseudomonas syringae (Basu et al. 2022) which suggests that these channels have, or may evolve to function in other roles. These foundational studies have provided groundwork for understanding the role of MSL proteins in sensing mechanical stimuli. In contrast to Arabidopsis, the MS channels in many important crops such as Zea mays (maize) have been poorly characterized. Maize is an important cereal crop that is used to feed the world’s population and livestock, and in some countries contributes over 20% of food calories (Shiferaw et al. 2011) . However, maize yields are impacted by environmental forces such as wind and gravity that uproot the plants. Maize brace roots are a set of roots that grow from stem nodes above the soil and contribute to the anchorage of the stalk (Reneau et al. 2020) . These brace roots may remain aerial or grow into the soil and become subterranean ( Figure 1A ). However, there is nothing known about the function or pattern of expression of MSL genes in maize (ZmMSL) brace roots. Generally, the expression of MS genes relative to their function is poorly defined. However, one study in Mimosa pudica showed that distal leaflet cells expressed lower density MS transcripts than proximal cells which are utilized in mechanotransduction, leading to folding of the leaflet (Tran et al. 2021) . Thus, suggesting that MS genes are expressed more highly in tissues that respond to mechanical stimuli. In this study, we hypothesized that ZmMSL gene expression would vary between aerial brace roots compared to subterranean brace roots. Specifically, we proposed that subterranean brace roots would experience greater mechanical stimuli and thus increase expression of the ZmMSL channels. Maize has eight putative MSL genes (Kaur et al. 2020) . Similar to Arabidopsis, these ZmMSL genes can be divided into two classes: Class I (ZmMSL1-ZmMSL2) and Class II (ZmMSL3-ZmMSL8) (Kaur et al. 2020) . We designed primers to quantify the mRNA expression of all eight putative ZmMSL genes and designed reliable primers for seven of these. Thus, we quantified the expression of ZmMSL1-ZmMSL7 in aerial and subterranean brace roots for B73 inbred lines. Surprisingly, our results did not support our hypothesis and demonstrate that ZmMSL gene expression does not differ for aerial and subterranean brace roots ( Figure 1B ). In fact, some plants had increased expression for a specific ZmMSLs while others had decreased expression for the same gene. However, there is a difference in the expression among the putative ZmMSL genes, with ZmMSL3 being expressed the highest among the seven tested ZmMSL genes. Using paired aerial and subterranean brace roots from each plant, we assessed the relative expression at the plant-level through log2 fold change analyses. We find that the differences in expression between aerial and subterranean brace roots is variable by plant ( Figure 1C -D ). This suggests that there may be a response of ZmMSL gene expression to external stimuli and environments, but these stimuli are occurring on the plant-level and remain to be fully elucidated. An alternative explanation is that the subterranean/aerial differences in ZmMSL expression at the plant-level may be due to differences in mechanical stresses that occurred during the sample collection (i.e. field excavation, washing, and root acquisition). However, this is unlikely given the short duration of sample collection (30 min). Further, we would have predicted that if differences in ZmMSL gene expression were due to sample preparation, then the subterranean roots would experience a greater mechanical stress given their contact with the soil and would in-turn have higher ZmMSL gene expression, but this was not the case. Future work repeating these experiments in a more controlled environment would help to resolve the potential impact of environment or sample collection. In addition, a detailed assessment of ZmMSL gene function is required to fully understand the role of these channels in maize growth, development, and environmental responsiveness. Methods Plant Material Maize seeds were planted in Newark, DE USA in the summer of 2019 as part of a larger field study. At 57 days after plant (approximately vegetative leaf 10 to 11 stage, V10-V11), six B73 plants were excavated from the field. A root ball of approximately 0.75 m in diameter was excavated with a shovel and placed in a 5-gallon bucket of water. Roots were washed with tap water to remove excess soil and one aerial and one subterranean brace root were collected from each plant, flash frozen in liquid nitrogen, and stored at -80℃ prior to analysis. Time between root ball excavation and brace root freezing was limited to 30 min or less to reduce the potential of inducing transcriptional responses. RNA Isolation and cDNA Synthesis Roots were ground with liquid nitrogen in a pre-cooled mortar and pestle. The Quick-RNA Plant Miniprep kit (Zymo Research) was used to extract RNA from ground root tissue. Approximately 50 mg of tissue was used in the protocol and samples were subjected to 4000 RPM for 2 min on the BeadBug homogenizer (Benchmark Scientific) prior to extraction. RNA concentration was assessed using a DS-11 FX Nano UV-Vis Spectrophotometer / Fluorometer (DeNovix). cDNA was synthesized from 1 ug of total RNA using the SuperScript VILO kit (ThermoFisher Scientific). Undiluted cDNA was used for qRT-PCR on a QuantStudio3 Real-Time PCR machine (ThermoFisher Scientific). Three technical replicates were run for each sample. Primer Design Primers targeting the eight ZmMSL genes were designed from the maize B73 reference genome v4. cDNA and genomic DNA sequences for ZmMSL1 through ZmMSL8 were retrieved from MaizeGDB (https://www.maizegdb.org/) (Woodhouse et al. 2020) . Splice junctions were manually annotated in ApE software. Primers were designed in Primer3Plus (Release 3.2.0; www.primer3plus.com) (Untergasser et al. 2020) to span splice junctions. Standard curves were run for each primer pair, and primers with an efficiency of 1.8 or greater were retained for analysis. We were unable to find reliable primers for ZmMSL8, thus only primers for ZmMSL1-ZmMSL7 were retained for analysis. qRT-PCR qRT-PCR was performed using SybrGreen chemistry with 20 uL reaction volumes (10 uL 2X Apex qPCR GREEN Master Mix; 8 uL water; 0.5 uL of 10 uM Forward; 0.5 uL of 10 uM Reverse; 1 uL cDNA) and three technical replicates. For standard curves, equal volumes of each cDNA sample were mixed to generate a 1X standard. This standard was then serially diluted with water to generate a 0.5X, 0.25X and 0.125X standard. Gene-specific reactions were run on the same plate as the housekeeping gene (ZmACT1). Reactions were run on a QuantStudio3 Real-Time PCR machine (ThermoFisher Scientific) with the following parameters: two holds of 50℃ for 20 min and 95℃ for 10 min, then 40 cycles of 95℃ for 15 sec and 60℃ for 1 min, followed by a melt-curve analysis. qRT-PCR Analyses Relative gene expression values for each of the seven ZmMSL genes (Table 1) were calculated via the 2 -ddCt method (Schmittgen and Livak 2008) . Threshold cycle (Ct) values were determined by the QuantStudio3 Real-Time PCR machine (ThermoFisher Scientific). Briefly, Ct values for technical replicates were averaged when the standard deviation was less than 0.50. The averaged Ct values of the technical replicates were then used to calculate the dCt value (dCt = Ct GOI - CT HK , where GOI is the gene of interest and HK is the housekeeping gene), where ZmACT1 was used as the housekeeping gene (Ding et al. 2020) and one of the seven ZmMSLs was used as the gene of interest. To calculate the ddCT value, aerial and subterranean root samples from the same plant (paired samples) were compared, and the dCt value for the aerial sample was subtracted from the dCt value for the subterranean sample (ddCt = dCt Subterranean - dCT Aerial ). Lastly, to calculate the fold change, 2 to the negative ddCt was calculated for each plant (Fold change = 2 -ddCt ). Fold change values were taken to log base 2 (Log2FC) for graphing. Statistical Analyses All statistical analysis and graphing were completed in R v.4.0.3 (R Core Team 2021) . Due to the nature of RT-qPCR data, a Kruskal-Wallis test (non-parametric equivalent to a one-way ANOVA) was used to determine if there was a significant difference between dCT values for aerial and subterranean brace roots. Individual Kruskal-Wallis tests were run for each of the seven ZmMSL genes. All figures were generated in R with the ggplot2 package ver. 3.3.3 (Wickham 2016) . Reagents Table 1. Gene ID and primer sequences. Gene Class Gene Model (v3; v4) Forward (5'-3') Reverse (5'-3') ZmMSL1 I GRMZM2G028914;Zm00001d029608 TAACTGCTGGAGGGTTTGGG TGCCAGAGACATCAACACCA ZmMSL2 I GRMZM2G125494; Zm00001d002580 GCTCTCTCTTTGGGCTACCG ACATGACCGACGCCAAATTG ZmMSL3 II GRMZM2G027891; Zm00001d002679 GATCTTCCAGAACGTCGCCA CCTCTTGCTGACCCTGTTGT ZmMSL4 II GRMZM2G303244; Zm00001d051415 TTCATGAGGCAGGAAGAGGC AGCCATCTGGTTCAGCTTGT ZmMSL5 II GRMZM2G005996; Zm00001d017539 GAGGGGGATGAATCAGCGAC GTGCTCCTGTGCTCCTTCAA ZmMSL6 II AY530952.1_FG001; Zm00001d037120 AGCAATCCGAAGCTCTAGGC TCAGCAGATCCACCTCCTCA ZmMSL7 II GRMZM2G005013; Zm00001d044976 AGAGGTGGATCTGCTGAGGT ACGAGGTTGTGAAGCTGCAT ZmMSL8 II GRMZM2G090627; Zm00001d026135 N/A N/A ZmACT1 HK GRMZM2G126010; Zm00001eb348450 GCCCTGCTGTATGAAATGGA AAAGGAACCAGCTAAAAGCAAAC Acknowledgments We gratefully acknowledge the assistance of Jon Reneau in preparation of fields and tissues for analysis. ==== Refs Basu Debarati Codjoe Jennette M. Veley Kira M. Haswell Elizabeth S. 2022 7 1 The Mechanosensitive Ion Channel MSL10 Modulates Susceptibility to Pseudomonas syringae in Arabidopsis thaliana Molecular Plant-Microbe Interactions® 35 7 0894-0282 567 582 10.1094/mpmi-08-21-0207-fi 34775835 Basu Debarati Haswell Elizabeth S 2017 12 1 Plant mechanosensitive ion channels: an ocean of possibilities Current Opinion in Plant Biology 40 1369-5266 43 48 10.1016/j.pbi.2017.07.002 28750206 Ding Lei Milhiet Thomas Couvreur Valentin Nelissen Hilde Meziane Adel Parent Boris Aesaert Stijn Van Lijsebettens Mieke Inzé Dirk Tardieu François Draye Xavier Chaumont François 2020 1 24 Modification of the Expression of the Aquaporin ZmPIP2;5 Affects Water Relations and Plant Growth Plant Physiology 182 4 0032-0889 2154 2165 10.1104/pp.19.01183 31980571 Guichard Marjorie Thomine Sébastien Frachisse Jean-Marie 2022 8 1 Mechanotransduction in the spotlight of mechano-sensitive channels Current Opinion in Plant Biology 68 1369-5266 102252 102252 10.1016/j.pbi.2022.102252 35772372 Hamilton Eric S. Jensen Gregory S. Maksaev Grigory Katims Andrew Sherp Ashley M. Haswell Elizabeth S. 2015 10 23 Mechanosensitive channel MSL8 regulates osmotic forces during pollen hydration and germination Science 350 6259 0036-8075 438 441 10.1126/science.aac6014 26494758 Haswell Elizabeth S. Meyerowitz Elliot M. 2006 1 1 MscS-like Proteins Control Plastid Size and Shape in Arabidopsis thaliana Current Biology 16 1 0960-9822 1 11 10.1016/j.cub.2005.11.044 16401419 Haswell Elizabeth S. Peyronnet Rémi Barbier-Brygoo Hélène Meyerowitz Elliot M. Frachisse Jean-Marie 2008 5 1 Two MscS Homologs Provide Mechanosensitive Channel Activities in the Arabidopsis Root Current Biology 18 10 0960-9822 730 734 10.1016/j.cub.2008.04.039 18485707 Kaur Amandeep Taneja Mehak Tyagi Shivi Sharma Alok Singh Kashmir Upadhyay Santosh Kumar 2020 10 6 Genome-wide characterization and expression analysis suggested diverse functions of the mechanosensitive channel of small conductance-like (MSL) genes in cereal crops Scientific Reports 10 1 2045-2322 10.1038/s41598-020-73627-7 Lee Chun Pong Maksaev Grigory Jensen Gregory S. Murcha Monika W. Wilson Margaret E. Fricker Mark Hell Ruediger Haswell Elizabeth S. Millar A. Harvey Sweetlove Lee J. 2016 11 3 MSL1 is a mechanosensitive ion channel that dissipates mitochondrial membrane potential and maintains redox homeostasis in mitochondria during abiotic stress The Plant Journal 88 5 0960-7412 809 825 10.1111/tpj.13301 27505616 Peyronnet Rémi Haswell Elizabeth S. Barbier-Brygoo Hélène Frachisse Jean-Marie 2008 9 1 AtMSL9 and AtMSL10: Sensors of plasma membrane tension in Arabidopsis roots Plant Signaling & Behavior 3 9 1559-2324 726 729 10.4161/psb.3.9.6487 19704841 R Core Team 2021. R: A Language and Environment for Statistical Computing. Reneau Jonathan W. Khangura Rajdeep S. Stager Adam Erndwein Lindsay Weldekidan Teclemariam Cook Douglas D. Dilkes Brian P. Sparks Erin E. 2020 11 1 Maize brace roots provide stalk anchorage Plant Direct 4 11 2475-4455 10.1002/pld3.284 Schmittgen Thomas D Livak Kenneth J 2008 6 1 Analyzing real-time PCR data by the comparative CT method Nature Protocols 3 6 1754-2189 1101 1108 10.1038/nprot.2008.73 18546601 Shiferaw Bekele Prasanna Boddupalli M. Hellin Jonathan Bänziger Marianne 2011 8 23 Crops that feed the world 6. Past successes and future challenges to the role played by maize in global food security Food Security 3 3 1876-4517 307 327 10.1007/s12571-011-0140-5 Toyota Masatsugu Furuichi Takuya Iida Hidetoshi 2018 Molecular Mechanisms of Mechanosensing and Mechanotransduction Plant Biomechanics 375 397 10.1007/978-3-319-79099-2_17 Tran Daniel Petitjean Hugues Chebli Youssef Geitmann Anja Sharif-Naeini Reza 2021 8 10 Mechanosensitive ion channels contribute to mechanically evoked rapid leaflet movement in Mimosa pudica Plant Physiology 187 3 0032-0889 1704 1712 10.1093/plphys/kiab333 34734277 Untergasser A Cutcutache I Koressaar T Ye J Faircloth BC Remm M Rozen SG 2012 6 22 Primer3--new capabilities and interfaces. Nucleic Acids Res 40 15 0305-1048 e115 e115 10.1093/nar/gks596 22730293 Veley Kira M. Maksaev Grigory Frick Elizabeth M. January Emma Kloepper Sarah C. Haswell Elizabeth S. 2014 7 1 Arabidopsis MSL10 Has a Regulated Cell Death Signaling Activity That Is Separable from Its Mechanosensitive Ion Channel Activity   The Plant Cell 26 7 1532-298X 3115 3131 10.1105/tpc.114.128082 25052715 Wickham Hadley 2016 Data Analysis Use R! 2197-5736 189 201 10.1007/978-3-319-24277-4_9 Woodhouse Margaret R. Cannon Ethalinda K. Portwood John L. Harper Lisa C. Gardiner Jack M. Schaeffer Mary L. Andorf Carson M. 2021 8 20 A pan-genomic approach to genome databases using maize as a model system BMC Plant Biology 21 1 1471-2229 10.1186/s12870-021-03173-5