==== Front Open Res Afr Open Res Afr Open Research Africa 2752-6925 F1000 Research Limited London, UK 37396343 10.12688/openresafrica.13404.1 Research Article Articles Molecular detection of novel Anaplasma sp . and zoonotic hemopathogens in livestock and their hematophagous biting keds (genus Hippobosca) from Laisamis, northern Kenya [version 1; peer review: 3 approved] Mwaki Daniel M. Conceptualization Formal Analysis Investigation Methodology Validation Visualization Writing – Original Draft Preparation https://orcid.org/0000-0003-3255-6145 a123 Kidambasi Kevin O. Conceptualization Formal Analysis Methodology Validation Visualization Writing – Review & Editing 1 Kinyua Johnson Conceptualization Methodology Supervision Validation Visualization Writing – Review & Editing 2 Ogila Kenneth Conceptualization Methodology Supervision Validation Visualization Writing – Review & Editing 3 Kigen Collins Conceptualization Formal Analysis Methodology Validation Visualization Writing – Review & Editing https://orcid.org/0000-0002-4893-1213 1 Getange Dennis Conceptualization Formal Analysis Methodology Validation Visualization Writing – Review & Editing https://orcid.org/0000-0002-2536-966X 12 Villinger Jandouwe Conceptualization Formal Analysis Methodology Validation Visualization Writing – Review & Editing https://orcid.org/0000-0002-5097-6605 1 Masiga Daniel K. Conceptualization Formal Analysis Methodology Validation Visualization Writing – Review & Editing https://orcid.org/0000-0001-7513-0887 1 Carrington Mark Conceptualization Formal Analysis Funding Acquisition Methodology Validation Visualization Writing – Review & Editing 4 Bargul Joel L. Conceptualization Formal Analysis Funding Acquisition Investigation Methodology Project Administration Resources Supervision Validation Visualization Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0001-8573-6807 b12 1 Animal Health Department/Molecular Biology and Bioinformatics Unit, International Centre of Insect Physiology and Ecology (icipe), Nairobi, P.O. BOX 30772-00100, Kenya 2 Department of Biochemistry, Jomo Kenyatta University of Agriculture and Technology (JKUAT), Nairobi, P.O. BOX 62000-00200, Kenya 3 Department of Zoology, Jomo Kenyatta University of Agriculture and Technology (JKUAT), Nairobi, P.O. Box 62000-00200, Kenya 4 Department of Biochemistry, University of Cambridge, Tennis Court Road, Cambridge, CB2 1QW, UK a daniel.mutwiri@jkuat.ac.ke b jbargul@jkuat.ac.ke No competing interests were disclosed. 6 6 2022 2022 5 2313 5 2022 Copyright: © 2022 Mwaki DM et al. 2022 https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Background: Livestock are key sources of livelihood among pastoral communities. Livestock productivity is chiefly constrained by pests and diseases. Due to inadequate disease surveillance in northern Kenya, little is known about pathogens circulating within livestock and the role of livestock-associated biting keds (genus Hippobosca) in disease transmission. We aimed to identify the prevalence of selected hemopathogens in livestock and their associated blood-feeding keds. Methods: We randomly collected 389 blood samples from goats (245), sheep (108), and donkeys (36), as well as 235 keds from both goats and sheep (116), donkeys (11), and dogs (108) in Laisamis, Marsabit County, northern Kenya. We screened all samples for selected hemopathogens by high-resolution melting (HRM) analysis and sequencing of PCR products amplified using primers specific to the genera: Anaplasma, Trypanosoma, Clostridium, Ehrlichia, Brucella, Theileria, and Babesia. Results: In goats, we detected Anaplasma ovis (84.5%), a novel Anaplasma sp. (11.8%), Trypanosoma vivax (7.3%), Ehrlichia canis (66.1%), and Theileria ovis (0.8%). We also detected A. ovis (93.5%), E. canis (22.2%), and T. ovis (38.9%) in sheep. In donkeys, we detected ‘ Candidatus Anaplasma camelii’ (11.1%), T. vivax (22.2%), E. canis (25%), and Theileria equi (13.9%). In addition, keds carried the following pathogens; goat/sheep keds - T. vivax (29.3%) , Trypanosoma evansi (0.86%), Trypanosoma godfreyi (0.86%), and E. canis (51.7%); donkey keds - T. vivax (18.2%) and E. canis (63.6%); and dog keds - T. vivax (15.7%), T. evansi (0.9%), Trypanosoma simiae (0.9%) , E. canis (76%), Clostridium perfringens (46.3%), Bartonella schoenbuchensis (76%), and Brucella abortus (5.6%). Conclusions: We found that livestock and their associated ectoparasitic biting keds carry a number of infectious hemopathogens, including the zoonotic B. abortus. Dog keds harbored the most pathogens, suggesting dogs, which closely interact with livestock and humans, as key reservoirs of diseases in Laisamis. These findings can guide policy makers in disease control. Vector-borne diseases Hippobosca high-resolution melting analysis hemopathogens keds New Partnership for Africa's Development107742 DELTAS AfricaDEL-15-011 Wellcome217138/Z/19/Z This research was supported by the African Academy of Sciences (AAS) through a DELTAS Africa Initiative grant [DEL-15-011] as part of the Training Health Researchers into Vocational Excellence (THRiVE-2). The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)AAS’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from Wellcome [107742] and the UK government. MC is a Wellcome Investigator (217138/Z/19/Z). Additional support was obtained from icipe institutional funding from the Swedish International Development Cooperation Agency (SIDA), the Swiss Agency for Development and Cooperation (SDC), the Federal Democratic Republic of Ethiopia, and the Government of the Republic of Kenya. The views expressed in this publication are those of the authors and not necessarily those of AAS, NEPAD Agency, Wellcome or the UK government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. ==== Body pmcIntroduction Livestock in Africa are considered as one of the most valuable agricultural assets for the rural and urban poor, and accounts for about 40% of the agricultural GDP ( Malabo Montpellier Panel, 2020). In 2018, Africa’s total livestock population was estimated at 2 billion poultry birds, 438 million goats, 384 million sheep, about 356 million cattle, 40.5 million pigs, almost 31 million camels, and 38 million equines (including 30 million donkeys, 6.5 million horses, and 885,000 mules) ( Malabo Montpellier Panel, 2020). This represents about one-third of the world’s livestock population ( Otte et al., 2019). Moreover, livestock production plays a key economic role to the livelihood of pastoralists living in the marginalized arid and semi-arid regions of northern Kenya ( Mburu et al., 2017). These pastoralists largely depend on livestock as a source of meat and milk, income from selling livestock, and donkeys and camels also serve as a mode of transport. Pastoralism supports about 20 million people, produces about 90% of the meat consumed in East Africa and contributes to about 13% of the GDP in Kenya ( Nyariki & Amwata, 2019). Unfortunately, livestock production is hindered by pests and diseases, which are endemic in northern Kenya ( Perry & Grace, 2009). Hemopathogens of livestock, particularly those of zoonotic importance, are responsible for some of the most serious emerging infectious diseases facing sub-Saharan Africa and the rest of the world ( Rosenberg et al., 2018). About 75% of newly emerging diseases currently affecting humans originated in animals ( Jones et al., 2008). In Kenya, hemoparasites that cause babesiosis, theileriosis, rickettsiosis, anaplasmosis, and ehrlichiosis are a major impediment to livestock productivity and public health ( Kiara et al., 2014). Bacterial diseases in livestock include bartonellosis caused by Bartonella spp. , which is mainly transmitted by biting arthropod vectors such as ticks and reported widely in both wild and domestic mammals such as dogs, cats, and cattle ( Ereqat et al., 2016). In addition, brucellosis, a zoonotic disease, has been reported worldwide and mainly causes infections to the genitals of animals, abortion, and fetal death ( Probert et al., 2004). Brucella species have been shown to be of high public health and socio-economic importance in northern Kenya ( Kairu-Wanyoike et al., 2019). Parasitic protozoal infections, for example African animal trypanosomiasis, cause debilitating diseases in livestock and serious economic losses in Africa ( Petersen et al., 2007). Etiological agents such as Clostridium perfringens cause enteric diseases such as enterotoxaemia in both humans and livestock, mostly goats and sheep ( Singh et al., 2018). Livestock act as reservoirs of infectious pathogens that can be transmitted by various vectors. Ticks and biting flies such as Stomoxys spp. and tabanids are vectors of infectious pathogens including bacteria, viruses ( e.g., Rift Valley fever viruses), rickettsiae ( Coxiella, Anaplasma), and protozoa ( T. evansi, T. vivax, T. simiae) ( Baldacchino et al., 2013; Narladkar, 2018). Hippoboscid flies, commonly known as keds and belonging to the family Hippoboscidae within the superfamily Hippoboscoidea, are obligate ectoparasites of vertebrates, both domestic and wild animals and birds ( Petersen et al., 2007; Rahola et al., 2011). Members of Hippoboscidae act as vectors of many infectious agents including bacteria, viruses, and protozoans ( Rahola et al., 2011). Keds cause economic losses in various ways, including annoyance and psychological disturbances produced during the act of biting and feeding, the diseases they transmit ( Bargul et al., 2021), and expenditure incurred by farmers in controlling them ( Narladkar, 2018). The painful bites inflicted on the bloodmeal host by keds result in skin lesions and by feeding on blood, they contribute to anaemia ( Oyieke & Reid, 2003). In northern Kenya, keds and ticks are common external pests of livestock, found on livestock all year round ( Bargul et al., 2021). Keds are known to infest and blood-feed on all livestock species, domestic and wild animals. In addition, keds also feed on humans and in the process, could transmit zoonotic pathogens ( Getahun et al., 2020). To date, little efforts have been put into surveillance of pathogens harbored by the livestock and the role of keds in spreading various diseases. This calls for an urgent need for research studies to catalogue livestock infectious and zoonotic pathogens circulating in livestock for a better understanding of disease prevalence, transmission routes, and for control. In this study, we screened for selected hemopathogens ( Anaplasma, Trypanosoma, Clostridium, Ehrlichia, Brucella, Theileria, and Babesia spp.) in goats, sheep, and donkeys, and in keds collected from goats, sheep, dogs, and donkeys. Methods Study site The study was conducted in Laisamis sub-County (1° 36' 0" N, 37° 48' 0" E) in Marsabit County, northern Kenya ( Figure 1). Marsabit County borders Ethiopia to the North, Turkana County to the West, Samburu and Isiolo Counties to the South, and Wajir County to the East. Laisamis sub-County occupies an area of 20,290 km 2 that comprises five County Assembly Wards, among which Laisamis Ward (3,885 km 2), the area of this study has arid and semi-arid climatic conditions ( Marsabit CIDP, 2018). The main economic activity in this region is livestock rearing with limited crop production. The main livestock species kept in Marsabit County include approximately 217,360 camels, 2,029,490 goats, 1,851,452 sheep, 420,000 cattle, 81,900 donkeys, and 45,860 poultry ( Marsabit CIDP, 2018). Figure 1. A map of Kenya showing the study sites in Laisamis, Marsabit County. The samples collected from each site are shown on the map key. Sample collection Samples were collected in two field-sampling trips and each sampling site was geo-referenced with a global positioning system (GPS). Goat and sheep blood, keds on goats, sheep, and dog keds were collected in July 2019 along the Laisamis River at Tula Orbora, which is one of the main livestock watering points (1° 35’ 16.4” N, 37° 48’ 22.5” E). Donkey blood and donkey keds were collected at Sere-e-Sipeni (1°33’14.9” N, 37°49’32.1” E) in February 2020. Ethical approval This study was conducted in strict adherence to the experimental guidelines and procedures approved by the International Centre of Insect Physiology and Ecology (icipe ) Institutional Animal Care and Use Committee (REF: IACUC/ICIPE/003/2018) and the Pwani University Ethics Review (approval number: ERC/EXT/002/2020). Goats, sheep, and donkeys were handled carefully to minimize pain and discomfort. Verbal consent was obtained from livestock owners prior to collection of samples. Written consent was not possible as the livestock keepers could neither read nor write. Blood collection About 5 mL of blood was obtained from the jugular vein of 245 goats (22 males and 223 females), 108 sheep (8 males and 100 females), and 36 donkeys (18 males and 18 females) of both sexes. Each sample was collected into 5 mL EDTA vacutainers (Plymouth PLG, UK), and kept under cold chain during the sampling exercise. Immediately after completion of the sampling process, all blood samples were preserved in liquid nitrogen for transportation to icipe, Nairobi, for molecular detection of pathogens. Collection and identification of livestock keds Keds that infested goats, sheep, donkeys, and dogs were collected from their hosts by handpicking at night as previously reported ( Kidambasi et al., 2020). Freshly collected keds were preserved in absolute ethanol ready for transportation to icipe for molecular screening of pathogens. Keds for use in molecular and morphological identification were sorted at icipe (Nairobi). Species identification based on morphology was done through comparison with known hippoboscid collections at icipe. DNA extraction Keds were surface-sterilized with 70% ethanol and left to air dry for 10 min on a paper towel in a clean hood. Each fly was then placed into a clean 1.5-mL Eppendorf tube containing 250 mg of sterile zirconia beads of 2-mm diameter (Stratech, UK). The flies were homogenized in liquid nitrogen using a Mini-Beadbeater-16 for 3 min (BioSpec, Bartlesville, OK, USA). Genomic DNA was extracted from individual flies and blood samples using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. PCR-HRM for pathogen detection Hemopathogens including Anaplasma, Ehrlichia, piroplasms ( Theileria and Babesia spp.), animal African trypanosomes, Clostridium perfringens and Brucella spp. were amplified using pathogen-specific PCRs ( Table 1) followed by DNA fragment analysis based on high-resolution melting (HRM) analysis. Rotor-Gene Q (Qiagen, Hannover, Germany), Quant Studio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and Mic qPCR (Bio Molecular Systems, Upper Coomera, Queensland, Australia) thermocyclers were used for PCR-HRM analysis for pathogen detection. Table 1. PCR primers for pathogen detection. Primer name 5’ to 3’ sequence Target organism Target gene Amplicon size (bp) Primer reference AnaplasmaJV_F AnaplasmaJV_R CGGTGGAGCATGTGGTTTAATTC CGRCGTTGCAACCTATTGTAGTC Anaplasma spp. Partial 16S rRNA 300 ( Mwamuye et al., 2017) EhrlichiaJV_F EhrlichiaJV_R GCAACCCTCATCCTTAGTTACCA TGTTACGACTTCACCCTAGTCAC Ehrlichia spp. 16S rRNA 300 ( Mwamuye et al., 2017) Ehrlichia 16S F Ehrlichia 16S R CGTAAAGGGCACGTAGGTGGACTA CACCTCAGTGTCAGTATCGAACCA Ehrlichia spp. 16S rRNA 200 ( Tokarz et al., 2009) EHR 16SD 1492R GGTACCYACAGAAGAAGTCC GGTTACCTTGTTACGACTT Ehrlichia and Anaplasma spp. Longer 16S rRNA 1000 ( Parola et al., 2000) ITS1_CF ITS1_BR CCGGAAGTTCACCGATATTG TTGCTGCGTTCTTCAAC- GAA Trypanosoma spp. ITS1 250–720 ( Njiru et al., 2005) RLB_F RLB_R GAGGTAGTGACAAGAAATAACAATA TCTTCGATCCCCTAACTTTC Theileria and Babesia spp. 18S rRNA 450 ( Gubbels et al., 1999) Br_F Br_R GCTCGGTTGCCAATATCAATGC GGGTAAAGCGTCGCCAGAAG Brucella spp. bcsp31 223 ( Probert et al., 2004) Cp_F Cp_R AAAGATGGCATCATCATTCAAC TACCGTCATTATCTTCCCCAAA Clostridium perfringens 16S rRNA 279 ( Wu et al., 2009) Genus-specific Anaplasmataceae primers were used for amplification of the 16S rRNA gene of Ehrlichia and Anaplasma spp. ( Mwamuye et al., 2017), while Theileria and Babesia spp. were screened simultaneously using primers that target the hypervariable V4 region of the 18S rRNA gene ( Gubbels et al., 1999). Clostridium perfringens was detected using specific primers targeting the 16S rRNA gene ( Wu et al., 2009). A set of genus-specific primers described by ( Probert et al., 2004) that targets the bcsp31 gene was used for identification of Brucella spp. A universal set of primer that targets the trypanosomal internal transcribed spacer I (ITS-I) region was used for detection of animal African trypanosomes ( Njiru et al., 2005). PCR-HRM assays were performed in runs of 10 μL reaction volumes, containing 6 μL nuclease-free water, 2 μL of 5×HOT FIREPol EvaGreen HRM mix (no ROX) (Solis BioDyne, Estonia), 0.5 μL of 10 pmol of each primer and 1 μL of template DNA. PCR conditions in the Rotor-Gene, Quant Studio and Mic qPCR for detection of Ehrlichia, Anaplasma and piroplasms ( Theileria and Babesia) were preceded by an initial enzyme activation step at 95°C for 15 min followed by 10 cycles of denaturation at 94°C for 20 sec, touch-down annealing from 64°C with a decrease of 1°C after each cycle for 25 sec, and primer extension step at 72°C for 30 sec. Then, another 30 cycles each of: denaturation at 94°C for 20 sec, touch-down annealing from 55°C with a decrease of 1°C after every 5 cycles for 50 sec, and extension at 72°C for 30 sec, with a final elongation at 72°C for 3 min. Specific annealing temperatures of 55°C, 53.9°C, and 63.2°C were used for detection of Trypanosome spp ., Clostridium perfringens, and Brucella spp ., respectively. The PCR conditions were initial enzyme activation at 95°C for 15 min, 40 cycles of: denaturation at 95°C for 30 sec, annealing for 30 sec, and extension at 72°C for 30 sec, with a final elongation at 72°C for 7 min. HRM analysis proceeded immediately after PCR with a gradual increase in temperature from 75°C to 95°C with 2 sec increase of 0.1°C between successive fluorescence acquisitions. The melting curves were visualized based on the fluorescence signals and the change in fluorescence with time (dF/dT) plotted against change in temperature (°C). Rotor-Gene Q Series Software 2.1.0 (Build 9), Quant Studio Design and Analysis Software version 1.5.1 ( Mwamuye et al., 2017), and micPCR Software v2.8.1 were used to assess melt profiles of the test samples in comparison with that of the known positive controls to confirm detection of pathogens. DNA sequencing of representative samples showing distinct melting curves proceeded to identify the pathogens. Purification of PCR amplicons and gene sequencing Representative samples with expected and distinct melting curves relative to the known positive controls were amplified in larger PCR reaction volumes of 15 μL. Five μL of the PCR amplicons were resolved through 2% ethidium bromide-stained agarose gel electrophoresis followed by visualization of the DNA under ultraviolet light using Kodak Gel Logic 200 Imaging System (SPW Industrial, Laguna Hills, CA, USA). About 10 μL of each sample with clear bands was purified using ExoSAP-IT PCR Product Cleanup kit (Affymetrix, Santa Clara, CA, USA) following the manufacturer’s protocol. Purified samples were then incubated at 37°C for 15 min and 85°C for 15 min in a Proflex thermocycler (Applied Biosystems) prior to Sanger sequencing by Macrogen, Inc. (Amsterdam, Netherlands). All sequences generated by this study were deposited in the GenBank (NCBI) database and assigned accession numbers. Data analysis The Rotor-Gene Q Series 2.1.0 (Build 9), Quant Studio Design and Analysis Software v1.5.1, and micPCR Software v2.8.1 were used for HRM analysis. Data on pathogens from blood and ked samples were recorded in a Microsoft Excel Spreadsheet Program version 18.2110.13110.0 (Microsoft Corp.). All nucleotide sequences were edited and aligned with closely related sequences from the NCBI GenBank nr database using the MAFFT plugin in Geneious Prime software version 2020.2.1 (created by Biomatters, Auckland, New Zealand; open source alternatives: UGENE, BioEdit) ( Kearse et al., 2012). The Basic Local Alignment Search Tool ( BLAST) was used to query related sequences available in the GenBank nr database. Maps showing the sampling sites were generated by feeding the coordinates of the sampling locations into a GIS software, QGIS v3.16. Phylogenetic analysis Maximum likelihood phylogenetic trees of the sequence alignments were constructed using PhyML v3.0 ( Guindon et al., 2010). Tree topologies were estimated using nearest neighbor interchange improvements over 1,000 bootstrap replicates and the Akaike information criterion for automatic model selection was employed in the phylogenies. FigTree v1.4.3 ( Rambaut, 2016) was used to visualize the phylogenetic trees. Results Detection of pathogens A total of 389 blood samples from goats (245), sheep (108) and donkeys (36), as well as 235 keds from goats and sheep (116), dogs (108) and donkeys (11) were randomly collected in Laisamis Sub-County, Marsabit County of northern Kenya. Out of the 389 blood samples screened, 87.7% (341/389) tested positive for Anaplasma spp., 50.1% (195/389) tested positive for Ehrlichia canis, 12.6% (49/389) tested positive for Theileria spp., and 6.7% (26/389) tested positive for Trypanosoma spp. Out of 235 ked samples screened, 63.4% (149/235) were positive for E. canis, 34.9% (82/235) were positive for Bartonella schoenbuchensis, 24.3% (57/235) were positive for Trypanosoma spp., 21.3% (50/235) were positive for Clostridium perfringens, and only 2.6% (6/235) were positive for B. abortus. All the pathogens detected in this study are listed in Table 2. Table 2. Summary of hemopathogens detected in livestock and their keds. Pathogens Prevalence of hemopathogens in blood and ked samples Goat blood (n=245) Sheep blood (n=108) Goat/sheep keds (n=116) Dog keds (n=108) Donkey blood (n=36) Donkey keds (n=11) Trypanosoma spp . Trypanosoma vivax = 18 (7.3%) __ Trypanosoma vivax = 34 (29.3%) Trypanosoma evansi = 1 (0.86%) Trypanosoma godfreyi = 1 (0.86%) Trypanosoma vivax = 17 (15.7%) Trypanosoma simiae = 1 (0.9%) Trypanosoma evansi = 1 (0.9%) Trypanosoma vivax = 8 (22.2%) Trypanosoma vivax = 2 (18.2%) Anaplasma spp. Anaplasma ovis = 207 (84.5%) Novel Anaplasma sp. = 29 (11.8%) Anaplasma ovis = 101 (93.5%) __ __ ‘ Candidatus Anaplasma camelii’ = 4 (11.1%) __ Ehrlichia canis 162 (66.1%) 24 (22.2%) 60 (51.7%) 82 (76%) 9 (25%) 7 (63.6%) Theileria/ Babesia spp. Theileria ovis = 2 (0.8%) Theileria ovis = 42 (38.9%) __ __ Theileria equi = 5 (13.9%) __ *Brucella abortus __ __ __ 6 (5.6%) __ __ *Clostridium perfringens __ __ __ 50 (46.3%) __ __ *Bartonella schoenbuchensis __ __ __ 82 (76%) __ __ *Zoonotic pathogens; dash ( __) means the pathogen was not detected. Pathogen detection in blood samples Goat and sheep blood samples. In goat blood (245), we detected Anaplasma ovis 84.5% (207), novel Anaplasma sp. 11.8% (29), E. canis 66.1% (162), Trypanosoma vivax 7.3% (18), and Theileria ovis 0.8% (2) by PCR-HRM ( Figure 2). Figure 2. Melt curves of amplification of 16S rRNA of Anaplasma spp. in goats. We also detected A. ovis 93.5% (101), E. canis 22.2% (24), and T. ovis 38.9% (42) in sheep blood (108). Alignment of the edited Anaplasma 16S rRNA sequences with closely related sequences queried on NCBI GenBank nr database, showed that most samples were 100% identical to A. ovis (GenBank accession MG869525). However, some sequences were distinctly different from the queried A. ovis among other sequences with an identity of 96.8% and below ( Figure 3). In addition, alignment of the edited Theileria 18S rRNA sequences with closely related sequences showed 100% similarity to T. ovis (GenBank accession MN712508). Figure 3. Multiple sequence alignment of 16S rRNA sequences of (i) novel Anaplasma sp. (from study sample An8) and (ii) A. ovis (An74) amplified from goat blood, and (iii) the GenBank-retrieved sequence of A. ovis, accession MG869525. Nucleotide changes were identified between MG869525 and An8 sequences. For instance, at position 25 and 26 in the above alignment, ‘AA’ in the GenBank sequence MG869525 is replaced by ‘GG’ in the query sequence An8 (study sample). In contrast, An74 sequence (from this study) was 100% identical to the A. ovis sequence MG869525 from GenBank. Donkey blood samples. In donkey blood samples (36), we detected E. canis 25% (9), ‘Candidatus Anaplasma camelii’ 11.1% (4), Trypanosoma vivax 22.2% (8) and Theileria equi 13.9% (5). Analysis of the 200-bp Ehrlichia 16S rRNA sequences showed 100% identity to E. canis sequenced from ticks and fleas collected from companion dogs and cats in East and Southeast Asia (GenBank accession MT499360). On the other hand, alignment of the edited Theileria 18S rRNA sequences with closely related sequences queried on NCBI GenBank nr database, showed 100% identity with Theileria equi (GenBank accession MK063829). Additionally, analysis of the Anaplasma 16S rRNA sequences showed 100% identity to ‘Candidatus Anaplasma camelii’ (GenBank accession MT510533). Brucella spp. and Clostridium perfringens were not detected in donkey and goat blood. Pathogen detection in keds Goat and sheep keds. The keds collected from co-herded goats and sheep were found to harbor E. canis 51.7% (60/116) and three trypanosome species, namely T. vivax 29.3% (34/116), Trypanosoma evansi 0.86% (1/116) and Trypanosoma godfreyi 0.86% (1/116). Donkey keds. The pathogens that were detected in keds collected from donkeys included; E. canis 63.6% (7/11) and T. vivax 18.2% (2/11). Dog keds. We detected E. canis 76% (82/108), T. vivax 15.7% (17/108), Trypanosoma simiae 0.9% (1/108), and T. evansi 0.9% (1/108) in dog keds. Also, the dog keds harbored Clostridium perfringens 46.3% (50/108), B. abortus 5.6% (6/108) and Bartonella schoenbuchensis 76% (82/108). Similarly, analysis of the 200-bp Ehrlichia 16S rRNA sequences showed 100% identity with E. canis sequenced from ticks and fleas collected from companion dogs and cats in East and Southeast Asia (GenBank accession MT499360). All the ked samples were negative for Anaplasma spp. and piroplasms ( Theileria and Babesia spp.). Moreover, only keds obtained from dogs were positive for B. abortus, C. perfringens and B. schoenbuchensis. The Brucella bcsp31 gene sequences showed a 98.68% identity with B. abortus sequenced from cattle milk DNA in India (GenBank accession MK881176). The morphological identification of the keds matched with the molecular identification of two ked species: Hippobosca variegata (GenBank accession MW128366) and Hippobosca longipennis (GenBank accession MW128365). Phylogenetic analysis of Anaplasma spp. 16S rRNA sequences The phylogenetic tree comparing sequences of 16S rRNA gene fragments of Anaplasma (900–1000 bp) from this study to other sequences of the same gene available in GenBank is presented in ( Figure 4). Phylogenetic relationships and molecular evolution were inferred using the maximum likelihood method. Tree Topologies were estimated using nearest neighbor interchange improvements over 1,000 bootstrap replicates. The tree was drawn to scale representing a 2% evolutionary change in nucleotides per site. Figure 4. Maximum likelihood phylogenetic tree of 16S rRNA gene of Anaplasma spp. The tree shows the close relation as well as genetic divergence of sequences from this study and that queried from GenBank. Bootstrap values at the major nodes are of percentage agreement among 1000 bootstrap replicates. GenBank accession numbers, species identification and country of origin are indicated for each sequence. Sequences from this study are indicated in bold, and the associated sample indicated at the end. Wolbachia endosymbiont (GenBank accession DQ115537) 16S rRNA was used as the outgroup. Discussion There is little information about infectious pathogens, particularly zoonotic, circulating in livestock of northern Kenya, due to lack of proper disease surveillance. In the area of study in Laisamis, northern Kenya, we aimed to determine the occurrence and prevalence of selected hemopathogens in livestock (goats, sheep and donkeys) and their predominant ectoparasitic keds (collected from goats, sheep, donkeys and dogs). Our findings revealed T. vivax as the predominant trypanosome species in livestock and keds, outside the tsetse belts, with an infection rate of 6.7% (26/389) and 22.6% (53/235), respectively. This agrees with a previous report that showed T. vivax as the major case of trypanosome infection outside tsetse-infested areas in western Kenya ( Thumbi et al., 2010). This species is known to be pathogenic to goats, sheep and equids ( Galiza et al., 2011). Similarly, T. vivax infection in camels and camel keds was previously reported from the same study area ( Kidambasi et al., 2020), suggesting T. vivax as the major cause of trypanosomiasis in Laisamis, northern Kenya. Trypanosomiasis disease caused by this pathogen is among the most important diseases limiting livestock productivity and agricultural development, for example in Ethiopia ( Bedada & Dagnachew, 2012). Donkeys harbored T. vivax, E. canis, ‘ Ca. Anaplasma camelii’, and T. equi, with E. canis being the most prevalent pathogen 25% (9/36). E. canis is receiving increasing attention due to its high morbidity and mortality in animals ( Bunroddith et al., 2018). Detection of the canine pathogen, E. canis, in donkeys is not surprising because the pastoralist farmers rear mixed livestock species together with other domestic animals including dogs; thus, the donkeys could have acquired this pathogen from infected dogs through insect or tick bites. Ehrlichiosis is an emerging disease of domestic animals mainly transmitted by ticks and has previously been reported to infect dogs, cattle, humans, and goats ( Zhang et al., 2017). Further, donkeys were found to be infected with the camel-associated bacteria, ‘ Ca. Anaplasma camelii’, previously reported in Kenyan camels ( Kidambasi et al., 2020). The presence of this camel pathogen in donkeys could be attributed to co-herding of donkeys with camels, and the donkeys could have acquired the pathogen from infected camels. Keds are common ectoparasites infesting livestock in the study area and have been reported as mechanical vectors of this bacterial pathogen ( Bargul et al., 2021). Further research is needed to determine the zoonotic potential as well as the pathogenic role of this pathogen in donkeys and other livestock species. T. equi (13.9%) was also detected in donkeys. Pathogens associated with this genus are among the causative agents of equine piroplasmosis and have previously been shown to infect donkeys in some parts of Kenya including Mwingi ( Oduori et al., 2015). Goats harbored T. vivax, E. canis, T. ovis, A. ovis and a novel Anaplasma species. Sheep were also found to harbor E. canis, T. ovis, and A. ovis. T. ovis was more prevalent in sheep (38.9%) than in goats (0.8%). This finding is consistent with a study done on livestock in Palestine ( Azmi et al., 2019). Ovine theileriosis caused by T. ovis is among the most important infectious diseases affecting small ruminants, leading to significant economic losses to farmers ( Al-Hosary et al., 2021). E. canis and T. vivax were detected in most of the samples analyzed, including keds, suggesting these two are the common pathogens circulating in livestock herds in the study area. Further research will be needed to understand the vectors of these pathogens and whether keds are competent vectors of the pathogens. Additionally, a high prevalence of A. ovis was detected in goats (84.5%) and sheep (93.5%), which is consistent with findings in a study done in Tunisia, North Africa, in goats and sheep by PCR ( Said et al., 2015). This high prevalence of A. ovis could also be attributed to ticks that were present in most of the domestic animals. A. ovis is distributed worldwide and considered a major cause of small ruminant anaplasmosis in tropical and subtropical regions of the world, with general clinical effects ranging from fever, fatigue, low milk production and abortion but with a low mortality rate ( Stuen & Longbottom, 2011). A previous study in Corsica, France, reported the presence of A. ovis in dairy goats after an extensive survey due to health and production problems encountered in the goat flocks ( Cabezas-Cruz et al., 2019b). We discovered an unidentified Anaplasma-like species in 11.8% (29/245) of goats analysed. The Anaplasma sp. shared 96.77% sequence identity with A. ovis sequenced from goat blood in China (GenBank accession MG869525). The GC content of this novel Anaplasma sp. was 52.9% with clear observation of differences in the bases with the queried Anaplasma spp. from NCBI GenBank nr database ( Figure 3). The pathogenic role of this Anaplasma-like species in goats is not understood. However, it is related to A. ovis, which is known to be pathogenic in sheep, goats, and some wild ruminants ( Said et al., 2015). More hemopathogens were detected in dog keds than in other keds, and they include T. vivax, T. evansi, T. simiae, E. canis, C. perfringens, B. schoenbuchensis, and B. abortus. Due to the fact that most dogs had a free-roaming lifestyle in the study region, it is possible that dogs were at a higher risk of being infected with a wide range of pathogens. Therefore, keds collected from dogs acquired these pathogens from infected dogs during their bloodmeal feeding. We were unable to collect blood from dogs during sampling because we lacked proper protective gear against dog bites, and the dogs were not vaccinated from rabies; thus, collecting blood from dogs was considered too high-risk. Among all the pathogens detected in keds obtained from dogs, E. canis (76%) and B. schoenbuchensis (76%) had the highest prevalence rates. The high prevalence rate of these pathogens could be attributed to the high competition of pathogens circulating in the same host population, considering the possible interactions between the pathogens and, host immune system, and host life cycle as well ( Poletto et al., 2015). In previous studies, B. schoenbuchensis was also detected in deer ked by PCR test with a prevalence rate of more than 60% ( Szewczyk et al., 2017). B. schoenbuchensis is one of the most important species that cause bartonellosis and has been reported to cause infections in humans, cattle and wild animals such as the cervids in Asia, North America and Europe ( Rolain et al., 2003; Vayssier-Taussat et al., 2016). Additionally, Bartonella infection often manifests as various cardiovascular, neurological and rheumatologic conditions, making it a public health concern since pastoralists, farmers and veterinarians who interact with domestic animals are at a high risk of infection ( Maggi et al., 2012). There is little information on the presence of E. canis in keds, but this pathogen has been detected in Rhipicephalus sanguineus (the brown dog tick), the biological vector of the pathogen ( Cabezas-Cruz et al., 2019a). This study also reports the first occurrence of C. perfringens in dog keds. This pathogen is an important cause of enteric diseases in humans and domestic animals and is responsible for several forms of enterotoxaemia, which differs in clinical manifestation and severity according to the toxigenic type involved and specific toxins produced ( Singh et al., 2018). It affects small ruminants worldwide, causing heavy mortality and significant economic impact ( Sumithra et al., 2013). In previous reports, this pathogen has been shown to cause death in dogs due to hemorrhagic gastroenteritis of the gastrointestinal tract; thus further research is needed to better understand the role of this bacterium in enteric diseases of dogs ( Schlegel et al., 2012). The Brucella sp. (5.6%) detected in dog keds was closely related to B. abortus sequenced from cattle milk in India, showing a sequence identity of 98.68% (GenBank accession MK881176). Brucellosis in dogs is mainly associated with B. canis and not B. abortus, which mainly occur in cattle. However, cross-species transmission of Brucella spp. is possible and this is consistent with a study done in Argentina that detected B. abortus in farm dogs ( Mortola et al., 2019). Additionally, B. abortus is a common source of human infection with a high zoonotic potential, and cause a disease called Bang’s disease in humans ( Kaden et al., 2018). Brucella species have been shown to be of high public health and socio-economic importance in northern Kenya, and mainly transmitted to humans through ingestion of unpasteurized dairy products or raw/undercooked animal products ( Kairu-Wanyoike et al., 2019). Among trypanosomes detected in keds obtained from dogs, T. vivax (15.7%) was more prevalent than T. evansi (0.9%) and T. simiae (0.9%), which had low prevalence rates. The presence of these trypanosome species in dog keds suggests that the keds were infected during their bloodmeal acquisition from dogs that were initially infected with trypanosomes from ticks and possibly from other biting flies like Stomoxys. Additionally, the dogs had a free-roaming lifestyle and thus, it is also possible that they were infected when moving into neighboring tsetse-infested regions. Similarly, T. vivax (29.3%) was also more prevalent than T. evansi (0.86%) and T. godfreyi (0.86%) in keds obtained from goats. This low infection rate could be attributed to disease stability in the area, change in climate and seasonal outbreaks ( Gutierrez et al., 2006). Both T. vivax and T. evansi have recently been detected in camel keds in northern Kenya ( Kidambasi et al., 2020). Further, previous studies have shown T. godfreyi and T. simiae to infect a wide range of domestic animals including pigs, cattle, camels, dogs and goats with T. simiae being highly pathogenic to domestic pigs ( Hamill et al., 2013; Simwango et al., 2017). T. simiae and T. godfreyi are among the Trypanosome spp. that cause African animal trypanosomiasis with tsetse flies being their main vector ( Isaac et al., 2016). This is the first report of occurrence of these two Trypanosome spp. in keds. The molecular data from keds collected from donkeys showed detection of T. vivax (18.2%) and E. canis (63.6%) as the common pathogens. Detection of these pathogens in donkeys and goats, as well as in their associated ectoparasitic keds, shows the xenodiagnostic potential of using keds to indirectly screen for pathogens occurring in their associated hosts. Similarly, a recent report demonstrated the occurrence in keds of pathogens that were similarly present in their camel host from which they were collected, and further proposed the potential use of keds in xenodiagnosis ( Kidambasi et al., 2020). However, detection of pathogens in keds does not incriminate them as vectors, but studies should be carried out to determine the vector competence of these keds. Keds are known to transmit mammalian trypanosomatidae of the genus Megatrypanum and are suspected to be vectors of T. avium and T. corvi in birds ( Svobodová et al., 2015). The impact of zoonotic pathogens is often underestimated due to limited surveillance and insufficient data of disease burden in most developing countries ( Munyua et al., 2016). This study reveals that the domesticated animals, as well as keds collected from them, carried infectious pathogens of veterinary and public health concern. Notably, we sequenced multiple hemopathogens in dog keds, including zoonotic ones ( B. abortus, B. schoenbuchensis, and C. perfringens). Close association of humans with domestic animals infested by keds and other disease vectors increases chances of pathogen transmission. It is therefore crucial to conduct further studies to map out circulating livestock diseases in northern Kenya and establish the role of keds in disease transmission. Conclusions We detected various selected infectious hemopathogens present in livestock and their associated ectoparasitic biting keds in northern Kenya, which calls for further surveillance studies to increase the understanding of the epidemiology of livestock diseases and the transmission of zoonotic ones by insect vectors such as keds that also occasionally feed on humans. This will guide the policy makers and livestock farmers in disease control. Data availability Underlying data NCBI GenBank: Uncultured Anaplasma sp. clone An74 16S ribosomal RNA gene, partial sequence (16S rRNA of Anaplasma ovis in goat), accession number MZ203400: https://identifiers.org/ncbiprotein:MZ203400 NCBI GenBank: Uncultured Anaplasma sp. clone An8 16S ribosomal RNA gene, partial sequence (16S rRNA of novel Anaplasma sp. in goat), accession number MZ203399: https://identifiers.org/ncbiprotein:MZ203399 NCBI GenBank: Anaplasma ovis isolate 92B 16S ribosomal RNA gene, partial sequence (16S rRNA of Anaplasma ovis in sheep), accession number OM282854: https://identifiers.org/ncbiprotein:OM282854 NCBI GenBank: Candidatus Anaplasma camelii clone An4B 16S ribosomal RNA gene, partial sequence (16S rRNA of Candidatus Anaplasma camelii in donkey), accession number MZ203398: https://identifiers.org/ncbiprotein:MZ203398 NCBI GenBank: Uncultured Bartonella sp. clone EJ72 16S ribosomal RNA gene, partial sequence (16S rRNA of Bartonella schoenbuchensis in dog keds), accession number MZ203403: https://identifiers.org/ncbiprotein:MZ203403 NCBI GenBank: Uncultured Clostridium sp. clone Dg48 16S ribosomal RNA gene, partial sequence (16S rRNA of Clostridium perfringens in dog keds), accession number MZ203401: https://identifiers.org/ncbiprotein:MZ203401 NCBI GenBank: Trypanosoma simiae voucher T52 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence ( T. simiae ITS1 in dog keds), accession number MZ221829: https://identifiers.org/ncbiprotein:MZ221829 NCBI GenBank: Trypanosoma evansi voucher T64 small subunit ribosomal RNA gene and internal transcribed spacer 1, partial sequence ( T. evansi ITS1 in dog keds), accession number MZ221830: https://identifiers.org/ncbiprotein:MZ221830 NCBI GenBank: Ehrlichia canis isolate ES72 16S ribosomal RNA gene, partial sequence (Short 16S rRNA of E. canis in dog keds), accession number OM282855: https://identifiers.org/ncbiprotein:OM282855 NCBI GenBank: Theileria ovis isolate 26A small subunit ribosomal RNA gene, partial sequence (18S rRNA of Theileria ovis in sheep), accession number OM282856: https://identifiers.org/ncbiprotein:OM282856 NCBI GenBank: Theileria equi isolate 15D small subunit ribosomal RNA gene, partial sequence (18S rRNA of Theileria equi in donkey), accession number OM282857: https://identifiers.org/ncbiprotein:OM282857 Figshare: Detection of hemopathogens in goat, sheep, donkey, and their associated hematophagous biting keds, and dog keds, https://doi.org/10.6084/m9.figshare.18586028.v1 ( Mwaki et al., 2022) This project contains the following underlying data: - Raw HRM Rotor Gene, Quant Studio and micPCR HRM data files for detection of pathogens in goats, sheep, donkeys and their associated biting keds, and dog keds. The HRM data files for Anaplasma spp. and Ehrlichia sp. can be accessed using Rotor Gene Q software, Quant Studio TM Design and Analysis software, and micPCR software, while data files for the other pathogens can be accessed using Quant Studio TM Design and Analysis software. Data are available under the terms of the Creative Commons Zero "No rights reserved" data waiver (CC0 1.0 Public domain dedication). Acknowledgements We are very grateful to all the livestock farmers for allowing us to collect samples from their animals. We also thank the field assistants who helped in restraining animals during sample collection. We thank Benard Malenge ( icipe) and Emily Kimathi ( icipe) for generating the map of the sampling sites. 10.21956/openresafrica.14552.r29852 Reviewer response for version 1 Kolo Agatha 1Referee https://orcid.org/0000-0003-0111-0554 1 Molecular Microbiology and Immunology, The University of Texas at San Antonio, San Antonio, Texas, USA 14 7 2023 Copyright: © 2023 Kolo A 2023 https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Version 1recommendationapprove This research paper was soundly written and provided information about the hemopathogens that were detected in sheep, goats, donkeys and their insect vectors and well as in keds collected from dogs using molecular tools in Northern Kenya. The study mostly cited the appropriate references, and I suggested a few that could be added to strengthen the points made in the discussion on the novel Anaplasma sp. detected in goats (please see the attached file linked here for additional comments). The only limitation I saw in the study was the fact that blood samples from dogs were not collected and screened in the study. Although the authors mentioned rabies risk as a factor that impeded sample collection from dogs, molecular screening on canine blood could have painted a clearer picture on the role of dogs as reservoirs of zoonotic pathogens and the public health risk posed to humans. Adequate planning with the use of dog catchers and appropriate PPE for sample collection should be put into consideration for future studies. In general, this research paper provided valuable information on the pathogens circulating in sheep, goats, donkeys and their keds and in dog keds in Laisamis, Northern Kenya. Is the work clearly and accurately presented and does it cite the current literature? Yes If applicable, is the statistical analysis and its interpretation appropriate? Not applicable Are all the source data underlying the results available to ensure full reproducibility? Yes Is the study design appropriate and is the work technically sound? Partly Are the conclusions drawn adequately supported by the results? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes Reviewer Expertise: Molecular parasitology, Genetic variation of zoonotic tick- borne diseases, Tick microbiome, Zoonotic vector-borne diseases, Phylogenetic analysis, Physiologic functions of tick bacterial endosymbionts and microbiome analysis. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. 10.21956/openresafrica.14552.r29871 Reviewer response for version 1 Elnaker Yasser F 1Referee 1 Faculty of Veterinary Medicine, New Valley University, Kharga, New Valley Governorate, Egypt 30 6 2023 Copyright: © 2023 Elnaker YF 2023 https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Version 1recommendationapprove In this article the authors noted that livestock and their associated ectoparasitic biting keds carry a number of infectious hemopathogens, including the zoonotic  B. abortus. Dog keds harbored the most pathogens, suggesting dogs, which closely interact with livestock and humans, as key reservoirs of diseases in Laisamis. These findings can guide policy makers in disease control. The article is well-designed and gives good results about hem-pathogen in different animal app., in Kenya which may need further studies about its incidence and risk factors associated with each pathogen. Molecular biology is used easily in diagnosis and classification of pathogen. So, the article is good. Is the work clearly and accurately presented and does it cite the current literature? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Is the study design appropriate and is the work technically sound? Yes Are the conclusions drawn adequately supported by the results? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes Reviewer Expertise: epidemiology & infectious diseases I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. 10.21956/openresafrica.14552.r29801 Reviewer response for version 1 Mazzotta Elisa 1Referee 1 Istituto Zooprofilattico Sperimentale delle Venezie (IZSVe), Legnaro, Italy 27 6 2023 Copyright: © 2023 Mazzotta E 2023 https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Version 1recommendationapprove Overall comments: The work is well structured and provides information on the serological and molecular prevalence of various infectious and zoonotic pathogens in livestock reared in Laisamis, northern Kenya. The problem is well contextualised through appropriate bibliographical references. A direct detection of the investigated pathogens was carried out both in livestock and insect vector. Methods are accurately described. The results highlight the need for action on diseases that involve transmission by animal vectors and that involve other domestic and wild animal species in their cycle. The discussion deals with the topics in a clear and concise manner, also reporting the limitations of the study (e.g. it was not possible to take blood samples from dogs for rabies risk), and the need to assess the competence of the vector in which the molecular tests found positive. Although the possibilities for intervention in such a particular environment are difficult, the work shows the need to implement surveillance to adequately guide the control of zoonotic diseases. I therefore believe that this article deserves to be indexed; I merely suggest completing the bibliography (see references). Is the work clearly and accurately presented and does it cite the current literature? Yes If applicable, is the statistical analysis and its interpretation appropriate? Not applicable Are all the source data underlying the results available to ensure full reproducibility? Yes Is the study design appropriate and is the work technically sound? Yes Are the conclusions drawn adequately supported by the results? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes Reviewer Expertise: Veterinary Science, Animal Health, Zoonosis I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Competing interests: No competing interests were disclosed. Competing interests: No competing interests were disclosed. Competing interests: No competing interests were disclosed. ==== Refs Al-Hosary AA ElSify A Salama AA : Phylogenetic study of Theileria ovis and Theileria lestoquardi in sheep from Egypt: Molecular evidence and genetic characterization. Vet World. 2021;14 (3 ):634–639. 10.14202/vetworld.2021.634-639 33935408 Azmi K Al-Jawabreh A Abdeen Z : Molecular Detection of Theileria ovis and Theleiria equi in Livestock from Palestine. Sci Rep. 2019;9 (1 ):11557. 10.1038/s41598-019-47965-0 31399617 Baldacchino F Muenworn V Desquesnes M : Transmission of pathogens by Stomoxys flies (Diptera, Muscidae): A review. Parasite. 2013;20 :26. 10.1051/parasite/2013026 23985165 Bargul JL Kidambasi KO Getahun MN : Transmission of ‘ Candidatus Anaplasma camelii’ to mice and rabbits by camel-specific keds, hippobosca camelina. PLoS Negl Trop Dis. 2021;15 (8 ):e0009671. 10.1371/journal.pntd.0009671 34398891 Bedada H Dagnachew S : Study on the prevalence of donkey trypanosomosis in Awi zone northwest Ethiopia. Ethiop Vet J. 2012;16 (2 ). 10.4314/evj.v16i2.6 Bunroddith K Viseshakul N Chansiri K : QCM-based rapid detection of PCR amplification products of Ehrlichia canis. Anal Chim Acta. 2018;1001 :106–111. 10.1016/j.aca.2017.10.037 29291792 Cabezas-Cruz A Allain E Ahmad AS : Low genetic diversity of Ehrlichia canis associated with high co-infection rates in Rhipicephalus sanguineus (s.l.). Parasit Vectors. 2019a;12 (1 ):12. 10.1186/s13071-018-3194-9 30616670 Cabezas-Cruz A Gallois M Fontugne M : Epidemiology and genetic diversity of Anaplasma ovis in goats in Corsica, France 06 Biological Sciences 0604 Genetics. Parasit Vectors. 2019b;12 (1 ). 10.1186/s13071-018-3269-7 Ereqat S Nasereddin A Vayssier-Taussat M : Molecular evidence of Bartonella species in ixodid ticks and domestic animals in palestine. Front Microbiol. 2016;7 :1217. 10.3389/fmicb.2016.01217 27540374 Galiza GJN Garcia HA Assis ACO : High mortality and lesions of the central nervous system in Trypanosomosis by Trypanosoma vivax in Brazilian hair sheep. Vet Parasitol. 2011;182 (2–4 ):359–63. 10.1016/j.vetpar.2011.05.016 21664764 Getahun MN Villinger J Bargul JL : Molecular characterization of pathogenic African trypanosomes in biting flies and camels in surra-endemic areas outside the tsetse fly belt in Kenya. bioRxiv. 2020. 10.1101/2020.06.18.156869 Gubbels JM De Vos AP Van Der Weide M : Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J Clin Microbiol. 1999;37 (6 ):1782–9. 10.1128/JCM.37.6.1782-1789.1999 10325324 Guindon S Dufayard JF Lefort V : New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst Biol. 2010;59 (3 ):307–21. 10.1093/sysbio/syq010 20525638 Gutierrez C Corbera JA Morales M : Trypanosomosis in goats: Current status. Ann N Y Acad Sci. 2006;1081 :300–10. 10.1196/annals.1373.040 17135529 Hamill LC Kaare MT Welburn SC : Domestic pigs as potential reservoirs of human and animal trypanosomiasis in Northern Tanzania. Parasit Vectors. 2013;6 (1 ):322. 10.1186/1756-3305-6-322 24499540 Isaac C Ciosi M Hamilton A : Molecular identification of different trypanosome species and subspecies in tsetse flies of northern Nigeria. Parasit Vectors. 2016;9 (1 ):301. 10.1186/s13071-016-1585-3 27216812 Jones KE Patel NG Levy MA : Global trends in emerging infectious diseases. Nature. 2008;451 (7181 ):990–3. 10.1038/nature06536 18288193 Kaden R Ferrari S Jinnerot T : Brucella abortus: Determination of survival times and evaluation of methods for detection in several matrices. BMC Infect Dis. 2018;18 (1 ):259. 10.1186/s12879-018-3134-5 29871600 Kairu-Wanyoike S Nyamwaya, D Wainaina M : Positive association between Brucella spp. Seroprevalences in livestock and humans from a cross-sectional study in Garissa and Tana River Counties, Kenya. PLoS Negl Trop Dis. 2019;13 (10 ):e0007506. 10.1371/journal.pntd.0007506 31622339 Kearse M Moir R Wilson A : Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28 (12 ):1647–9. 10.1093/bioinformatics/bts199 22543367 Kiara H Jennings A Bronsvoort BMDC : A longitudinal assessment of the serological response to Theileria parva and other tick-borne parasites from birth to one year in a cohort of indigenous calves in western Kenya. Parasitology. 2014;141 (10 ):1289–98. 10.1017/S003118201400050X 24838078 Kidambasi KO Masiga DK Villinger J : Detection of blood pathogens in camels and their associated ectoparasitic camel biting keds, Hippobosca camelina: the potential application of keds in xenodiagnosis of camel haemopathogens [version 2; peer review: 2 approved]. AAS Open Res. 2020;2 :164. 10.12688/aasopenres.13021.2 32510036 Maggi RG Mozayeni BR Pultorak EL : Bartonella spp. Bacteremia and rheumatic symptoms in patients from Lyme disease-endemic region. Emerg Infect Dis. 2012;18 (5 ):783–91. 10.3201/eid1805.111366 22516098 Malabo Montpellier Panel: Meat, Milk and More : Policy innovations to shepherd inclusive and sustainable livestock systems in Africa. Malabo Montepellier Panel.2020;94. Reference Source Marsabit CIDP: Marsabit County Integrated Development Plan 2018-2022. Second County Integrated Development Plan 2018-2022.2018. Reference Source Mburu S Otterbach S Sousa-Poza A : Income and Asset Poverty among Pastoralists in Northern Kenya. J Dev Stud. 2017;53 (6 ):971–986. 10.1080/00220388.2016.1219346 Mortola E Miceli GS Meyer LP : Brucella abortus in Dog Population: An Underestimated Zoonotic Disease. Biomed J Sci & Tech Res. 2019;15 (2 ). 10.26717/BJSTR.2019.15.002681 Munyua P Bitek A Osoro E : Prioritization of zoonotic diseases in Kenya, 2015. PLoS One. 2016;11 (8 ):e0161576. 10.1371/journal.pone.0161576 27557120 Mwaki D Kidambasi K Kinyua J : Detection of hemopathogens in goats, sheep, donkeys, and their associated hematophagous biting keds, and dog keds (genus Hippobosca). figshare. Dataset. 2022. 10.6084/m9.figshare.18586028.v1 Mwamuye MM Kariuki E Omondi D : Novel Rickettsia and emergent tick-borne pathogens: A molecular survey of ticks and tick-borne pathogens in Shimba Hills National Reserve, Kenya. Ticks Tick Borne Dis. 2017;8 (2 ):208–218. 10.1016/j.ttbdis.2016.09.002 28011185 Narladkar BW : Projected economic losses due to vector and vector-borne parasitic diseases in livestock of india and its significance in implementing the concept of integrated practices for vector management. Vet World. 2018;11 (2 ):151–160. 10.14202/vetworld.2018.151-160 29657396 Njiru ZK Constantine CC Guya S : The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes. Parasitol Res. 2005;95 (3 ):186–192. 10.1007/s00436-004-1267-5 15619129 Nyariki DM Amwata DA : The value of pastoralism in Kenya: Application of total economic value approach. Pastoralism. 2019;9 (1 ). 10.1186/s13570-019-0144-x Oduori DO Onyango SC Kimari JN : A field survey for the seroprevalence of Theileria equi and Babesia caballi in donkeys from Nuu Division, Kenya. Ticks Tick Borne Dis. 2015;6 (5 ):683–8. 10.1016/j.ttbdis.2015.05.015 26072000 Otte J Pica-Ciamarra U Morzaria S : A comparative overview of the livestock-environment interactions in Asia and Sub-Saharan Africa. Front Vet Sci. 2019;6 :37. 10.3389/fvets.2019.00037 30854375 Oyieke FA Reid G : The Mechanical transmission of Trypanosoma evansi by Haematobia minuta ( Diptera : Muscidae ) and the survival of Trypanosomes in fly mouthparts parts and gut (A Preliminary Record). Folia Veterinaria. 2003;47 (1 ). Parola P Roux V Camicas JL : Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans R Soc Trop Med Hyg. 2000;94 (6 ). 10.1016/s0035-9203(00)90243-8 11198664 Perry B Grace D : The impacts of livestock diseases and their control on growth and development processes that are pro-poor.In Philosophical Transactions of the Royal Society B: Biological Sciences. 2009;364 (1530 ). 10.1098/rstb.2009.0097 Petersen FT Meier R Kutty SN : The phylogeny and evolution of host choice in the Hippoboscoidea (Diptera) as reconstructed using four molecular markers. Mol Phylogenet Evol. 2007:45 (1 ):111–22. 10.1016/j.ympev.2007.04.023 17583536 Poletto C Meloni S Van Metre A : Characterising two-pathogen competition in spatially structured environments. Sci Rep. 2015;5 :7895. 10.1038/srep07895 25600088 Probert WS Schrader KN Khuong NY : Real-Time Multiplex PCR Assay for Detection of Brucella spp., B. abortus,. and B. melitensis. J Clin Microbiol. 2004;42 (3 ):1290–3. 10.1128/JCM.42.3.1290-1293.2004 15004098 Rahola N Goodman SM Robert V : The Hippoboscidae (insecta: Diptera) from Madagascar, with new records from the “parc National de Midongy Befotaka.” Parasite. 2011;18 (2 ):127–40. 10.1051/parasite/2011182127 21678788 Rambaut A : FigTree. version 1.4.3. Institute of Evolutionary Biology, University of Edinburgh.2016. Rolain JM Rousset E La Scola B : Bartonella schoenbuchensis isolated from the blood of a French cow. Ann N Y Acad Sci. 2003;990 :236–8. 10.1111/j.1749-6632.2003.tb07370.x 12860633 Rosenberg R Lindsey NP Fischer M : Vital Signs: Trends in Reported Vectorborne Disease Cases — United States and Territories, 2004-2016. MMWR Morb Mortal Wkly Rep. 2018;67 (17 ):496–501. 10.15585/mmwr.mm6717e1 29723166 Said MB Belkahia H Alberti A : Molecular survey of Anaplasma species in small ruminants reveals the presence of novel strains closely related to A. phagocytophilum in Tunisia.In Vector Borne Zoonotic Dis. 2015;15 (10 ):580–90. 10.1089/vbz.2015.1796 26394065 Schlegel BJ Van Dreumel T Slavić D : Clostridium perfringens type a fatal acute hemorrhagic gastroenteritis in a dog. Can Vet J. 2012;53 (5 ):555–7. 23115371 Simwango M Ngonyoka A Nnko HJ : Molecular prevalence of trypanosome infections in cattle and tsetse flies in the Maasai Steppe, northern Tanzania. Parasit Vectors. 2017;10 (1 ):507. 10.1186/s13071-017-2411-2 29061160 Singh DD Pawaiya RS Gururaj K : Molecular detection of Clostridium perfringens toxinotypes, enteropathogenic Escherichia coli, rotavirus and coronavirus in diarrheic fecal samples of neonatal goat kids. Veterinarski Arhiv. 2018;88 (1 ):1–20. 10.24099/VET.ARHIV.161027 Stuen S Longbottom D : Treatment and Control of Chlamydial and Rickettsial Infections in Sheep and Goats.In Vet Clin North Am Food Anim Pract. 2011;27 (1 ):213–233. 10.1016/j.cvfa.2010.10.017 21215905 Sumithra TG Chaturvedi VK Siju SJ : Enterotoxaemia in goats—A review of current knowledge.In Small Ruminant Research. 2013;114 (1 ):1–9. 10.1016/j.smallrumres.2013.05.013 Svobodová M Volf P Votýpka J : Trypanosomatids in ornithophilic bloodsucking Diptera. Med Vet Entomol. 2015;29 (4 ):444–7. 10.1111/mve.12130 26211924 Szewczyk T Werszko J Steiner-Bogdaszewska Z : Molecular detection of Bartonella spp. in deer ked ( Lipoptena cervi) in Poland. Parasit Vectors. 2017;10 (1 ):487. 10.1186/s13071-017-2413-0 29037227 Thumbi SM Jung’A JO Mosi RO : Spatial distribution of African animal trypanosomiasis in suba and teso districts in Western Kenya. BMC Res Notes. 2010;3 :6. 10.1186/1756-0500-3-6 20205857 Tokarz R Kapoor V Samuel JE : Detection of tick-borne pathogens by masstag polymerase chain reaction. Vector Borne Zoonotic Dis. 2009;9 (2 ):147–52. 10.1089/vbz.2008.0088 18800864 Vayssier-Taussat M Moutailler S Féménia F : Identification of novel zoonotic activity of Bartonella spp, France. Emerg Infect Dis. 2016;22 (3 ):457–62. 10.3201/eid2203.150269 26885624 Wu J Zhang W Xie B : Detection and toxin typing of Clostridium perfringens in formalin-fixed, paraffin-embedded tissue samples by PCR. J Clin Microbiol. 2009;47 (3 ):807–810. 10.1128/JCM.01324-08 19109478 Zhang H Chang Z Mehmood K : First report of Ehrlichia infection in goats, China. Microb Pathog. 2017;110 :275–278. 10.1016/j.micpath.2017.07.012 28705746