==== Front Cell Rep Med Cell Rep Med Cell Reports Medicine 2666-3791 Elsevier S2666-3791(23)00192-1 10.1016/j.xcrm.2023.101073 101073 Article Arginine depletion attenuates renal cystogenesis in tuberous sclerosis complex model Amleh Athar 12 Chen Hadass Pri 23 Watad Lana 12 Abramovich Ifat 4 Agranovich Bella 4 Gottlieb Eyal 4 Ben-Dov Iddo Z. 35 Nechama Morris mnehama@gmail.com 126∗ Volovelsky Oded odedvo@hadassah.org.il 1267∗∗ 1 Pediatric Nephrology Unit, Hadassah Medical Center and Faculty of Medicine, Hebrew University of Jerusalem, Jerusalem, Israel 2 Wohl Institute for Translational Medicine, Hadassah-Hebrew University Medical Center, Jerusalem, Israel 3 Department of Nephrology, Hadassah Medical Center and Faculty of Medicine, Hebrew University of Jerusalem, Jerusalem, Israel 4 The Ruth and Bruce Rappaport Faculty of Medicine, Technion – Israel Institute of Technology, Haifa, Israel 5 Laboratory of Medical Transcriptomics, Department of Nephrology and Hypertension and Internal Medicine B, Hadassah – Hebrew University Medical Center, Jerusalem, Israel ∗ Corresponding author mnehama@gmail.com ∗∗ Corresponding author odedvo@hadassah.org.il 6 These authors contributed equally 7 Lead contact 07 6 2023 20 6 2023 07 6 2023 4 6 10107313 7 2022 2 3 2023 15 5 2023 © 2023 The Author(s) 2023 https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). Summary Cystic kidney disease is a leading cause of morbidity in patients with tuberous sclerosis complex (TSC). We characterize the misregulated metabolic pathways using cell lines, a TSC mouse model, and human kidney sections. Our study reveals a substantial perturbation in the arginine biosynthesis pathway in TSC models with overexpression of argininosuccinate synthetase 1 (ASS1). The rise in ASS1 expression is dependent on the mechanistic target of rapamycin complex 1 (mTORC1) activity. Arginine depletion prevents mTORC1 hyperactivation and cell cycle progression and averts cystogenic signaling overexpression of c-Myc and P65. Accordingly, an arginine-depleted diet substantially reduces the TSC cystic load in mice, indicating the potential therapeutic effects of arginine deprivation for the treatment of TSC-associated kidney disease. Graphical abstract Highlights • Arginine metabolism is disrupted in TSC disease, leading to renal cystogenesis • TSC kidneys have high mTOR-dependent argininosuccinate synthetase 1 levels • Arginine depletion inhibits mTORC1 hyperactivation and cystogenic signaling • Arginine deprivation might have therapeutic potential for TSC cystic kidney disease Amleh et al. reveal that the high metabolic activity of arginine leads to cyst formation in kidney models of tuberous sclerosis complex disease. High mTORC1 activity and signaling pathways in renal cystogenesis can be halted by arginine deprivation in TSC1-deficient cells and mouse kidneys. Keywords tuberous sclerosis complex TSC mechanistic target of rapamycin complex 1 mTORC1 arginine metabolism argininosuccinate synthetase 1 ASS1 proximal tubule cells PTCs cystogenesis Published: June 7, 2023 ==== Body pmcIntroduction Tuberous sclerosis complex (TSC) is a genetic disorder affecting various organs, including the brain, kidney, skin, and heart, with an estimated prevalence of 1:6,000. The disease is caused by inactivating mutations in either the Tsc1 or Tsc2 gene, encoding for hamartin and tuberin, respectively.1,2,3 TSC1 and TSC2 form a stable complex and function as the GTPase activating factor of the small GTPase Rheb. Stimulation of Rheb-GTP hydrolysis by the TSC1-TSC2 complex inhibits the downstream mechanistic target of rapamycin complex 1 (mTORC1) activity and its targets, including p70 S6 kinase (S6K) and eukaryotic translation-initiation factor 4E-binding protein 1 (4E-BP1), necessary for cell growth, metabolism, and protein synthesis regulation.4,5 Mutations in Tsc1/2 genes impair the inhibitory function of the TSC1-TSC2 complex on mTORC1 activity resulting in cell cycle dysregulation and tumorigenesis. Kidney disease is the leading cause of mortality in adult TSC patients and manifests with angiomyolipoma (AML)6 and cystic kidney disease, identified in the majority of patients.7 Cystic kidney disease ranges in severity from a single renal cyst to a severe polycystic phenotype, leading to gradual loss of renal parenchyma.8 Kidney disease is aggravated by the decline in nephron number consequent to multiple surgical procedures for resections and ablations of renal AML of large dimensions.9 As a result, TSC patients are exposed to CKD complications earlier than the general population, with about 40% of TSC patients developing advanced CKD.10,11,12,13,14 Renal cystogenesis is attributed to abnormal growth and function of renal tubular cells, but the molecular and metabolic mechanisms underlying TSC-associated cystic kidney disease are not well characterized, and effective therapies are still obscure. mTORC1 and inflammation have a central role in the pathogenesis of TSC cystic kidney disease. Inactivating Tsc1 mutations in nephron progenitor cells (NPCs) in mice increased cell proliferation and resulted in severe damage to renal proximal tubule cells (PTCs), starting as early as embryonic day 15.5 (E15.5) with a lethal cystic phenotype at E17.5. Furthermore, this effect was linked to enhanced c-Myc expression and increased inflammation, mainly macrophage infiltration, contributing to cyst formation in TSC. Rapamycin or dexamethasone treatment during pregnancy alleviated cystic kidney disease by inhibiting the mTORC1 pathway and the inflammatory response.15 Other mechanisms associated with TSC cyst development were also proposed. Tsc2 deletion accelerated extracellular vesicle (EV) production in the damaged cells with a distinct protein reservoir involved in diverse biological processes such as cellular proliferation, stress response, and metabolic pathways. The EVs signal to recipient cells to maintain tissue repair and cellular proliferation, thus contributing to TSC-associated cystogenesis.9,16 The limited response of TSC cystic kidney disease to mTOR inhibitors raises the possibility of mTORC1-independent cellular effects through additional cellular pathways. Tsc1 acts with FNIP1/2 as a co-chaperone to regulate Hsp90 chaperone activity by decelerating its ATPase activity which is essential to Hsp90 function.17,18,19,20 Moreover, Tsc1 was shown to control tight junction formation to create and maintain the epithelial barrier by mTORC1-independent pathways.21 Tsc1 hemizygous deletion in NPCs had mTOR-independent effects on nephrogenesis.22 Tsc2 deletion affected prostaglandin production, NOTCH activity, and VEGF gene expression in a mTORC1-independent mechanism.23,24,25 Significant metabolic cellular changes have been identified in renal cystic kidney diseases such as autosomal-dominant polycystic kidney disease (ADPKD).26,27,28,29,30 The role of metabolic changes in TSC has not been extensively examined in TSC cystic kidney disease. However, it can be assumed that mTORC1 hyperactivation causes extensive metabolic reprogramming. mTORC1 is a major regulator of cell metabolism and is controlled by cell environment and nutrient availability. Cells with high mTORC1 activity have extensive metabolic rewiring, including a Warburg-like switch to aerobic glycolysis, enhanced glucose flux through the pentose phosphate pathway, and glutamine addiction.31 The perturbations in these metabolic pathways sustain the high energy and metabolite demand, thus supporting cellular proliferation and protein synthesis. Indeed, PTCs obtained from TSC mouse kidneys are characterized by significant perturbation in expressions of genes associated with major metabolic pathways such as glucose metabolism, oxidative phosphorylation, the tricarboxylic acid (TCA) cycle, and lipid metabolism.15 This study aims to identify the dysregulated metabolic pathways that drive the cystogenic process in a TSC kidney model. Moreover, we aimed to distinguish between the metabolic pathways governed by mTORC1 signaling and mTORC1-independent pathways. We identified perturbation in several key metabolic pathways using the metabolomic analysis of Tsc1 knockout (KO) mice whole kidneys, specifically in PTCs. Furthermore, we detected changes in arginine metabolism and showed they have a pivotal role in the pathogenesis of TSC kidney disease associated with overexpression of ASS1, a rate-limiting enzyme in the arginine biosynthetic pathway in a mouse model and human TSC kidneys. Accordingly, arginine depletion reduced cell proliferation, mTORC1 activity, and TSC-associated cell signaling, both in vitro and in vivo. In addition, arginine depletion substantially reduced the cystic load in the TSC mouse model. These results suggest that arginine metabolism plays a critical role in TSC-associated cystogenesis, indicating that targeting this pathway may hold promise as a potential therapeutic strategy for TSC disease. Results Rewiring of the metabolic activity in a TSC kidney model To assess perturbations in major metabolic pathways of Tsc1 KO kidneys, their association with the cystogenic process, and whether they are governed by mTORC1-dependent or mTORC1-independent pathways, we used transgenic mice with complete Tsc1 deletion in Six2+ NPCs differentiating into the majority of nephron components.32 We previously showed that these mice have a postnatal lethal phenotype with mTORC1 hyperactivation in PTCs throughout pregnancy and a cystic phenotype visible at E17.5.15 Tsc1fl/fl female mice were mated with Six2 Cretg/+ Tsc1fl/+ males to generate Six2 Cretg/+ Tsc1fl/fl pups with NPC-specific Tsc1 deletion (25% of offspring, herein Tsc1 KO). Pregnant Tsc1fl/fl females were injected with vehicle or rapamycin, a potent and specific inhibitor of mTORC1, at E12.5, E14.5, and E16.5, as before.15 At postnatal day 0 (P0), the kidneys of wild-type (WT) (Tsc1fl/fl) and Tsc1 KO mice treated with either rapamycin or vehicle were excised, and metabolites were extracted and analyzed by hybrid triple quadrupole mass spectrometry. Overall, 8 WT and 7 Tsc1 KO kidneys treated with vehicle and 6 WT and 5 Tsc1 KO kidneys treated with rapamycin were collected. A total of 298 metabolites were identified (Table S1). Principal-component analysis (PCA) distinguished among the 4 subgroups of kidneys, with the major difference noticed between Tsc1 KO and WT kidneys. Moreover, the PCA indicated that Tsc1 KO kidneys treated with rapamycin more closely resembled WT kidneys treated with vehicle (Figure S1A). To identify alterations in metabolite levels and the metabolic pathways presumably affected by Tsc1 deletion, we compared metabolite intensity between kidneys from WT and Tsc1 KO mice treated with vehicle. Overall, 100 metabolites were identified, showing significant differences between the two groups (Figure S1B; Table S2). Furthermore, pathway analysis indicated that the altered metabolites are the products of different metabolic pathways, including amino-sugar and nucleotide-sugar metabolism and amino acid metabolism, such as the metabolism of lysine, tyrosine, and arginine (Figure S1C). Rapamycin reverses the metabolic profiling in TSC kidney mouse model We have previously shown that mTORC1 inhibition during pregnancy alleviates cystic kidney disease in Tsc1 KO offspring by inhibiting the mTORC1 pathway and reducing the inflammatory response.15 Therefore, we examined the effect of mTORC1 inhibition during pregnancy on the TSC metabolic activity. To this end, we compared metabolite levels between kidneys obtained from Tsc1 KO pups with or without rapamycin treatment during pregnancy. Overall, 108 metabolites were identified, showing significant differences between the two groups (Figure S1D; Table S3). Pathway analysis indicated that the altered metabolites are associated with different metabolic pathways, including pyrimidine metabolism, amino-sugar, and nucleotide-sugar metabolism, and amino acid metabolism of arginine, glycine, serine, and threonine (Figure S1E). Next, we focused on identifying specific metabolites and metabolic pathways that were dysregulated in Tsc1 KO mice compared with WT mice and reversed to the WT kidney profile upon rapamycin treatment. As mentioned above, PCA indicated clear segregation of the sample groups. Strikingly, kidneys obtained from Tsc1 KO mice treated with rapamycin more closely resembled WT kidneys (Figure 1A). In addition, we noted a general inverse relationship between the Tsc1 KO effects on metabolite levels and the rapamycin effects on these metabolites in Tsc1 KO kidneys (Figure 1B). Overall, we identified 58 metabolites that were significantly cross-regulated (Table S4), 34 of which were upregulated in kidneys from Tsc1 KO mice compared with WT mice and conversely down-regulated upon rapamycin treatment of Tsc1 KO mice. An additional 24 metabolites showed significant downregulation in kidneys obtained from Tsc1 KO mice compared with WT mice but were upregulated upon rapamycin treatment of Tsc1 KO mice (Figures 1C and 1D).Figure 1 Rapamycin treatment reverses the metabolic profiling of Tsc1 KO kidneys (A) Principal-component analysis plot of WT mice and Tsc1 KO mice with or without rapamycin treatment during pregnancy. Each dot represents an independent biological sample. (B) Scatterplot (ggplot2) showing log2 fold changes between the change in metabolites levels in Tsc1 KO and WT (x axis) and with and without rapamycin in Tsc1 KO mice (y axis), implying a reversal of mutation effects by rapamycin. (C) Venn diagram (ggVennDiagram) showing the overlap in dysregulated (significantly upregulated or downregulated) metabolites across the two pairwise comparisons. (D) Heatmap and dendrogram generated via hierarchical clustering of samples and metabolites that were significantly altered in at least 1 of the comparisons depicted in (C). (E) Venn diagram showing the overlap of metabolic pathways enriched with significantly altered metabolites in either of the depicted comparisons (KO, Tsc1 KO; KO+r, Tsc1 KO treated by rapamycin). (F) Scatterplot showing a correlation of the negative log10 FDR (false detection rate) of pathways affected by the experimental interventions (as in E). (G) Representative pathways enriched with significantly altered metabolites. See also Figure S1. Pathway analysis on the basis of the metabolites showing a difference between kidneys from Tsc1 KO and WT mice indicated that these metabolites are involved in 27 different metabolic pathways. Twenty-nine different metabolic pathways were identified when metabolites showing differences between kidneys from Tsc1 KO with or without rapamycin were analyzed. The vast majority of these pathways, 20 metabolic pathways, were jointly enriched in the two comparisons (Figures 1E and 1F), indicating that most Tsc1 KO-affected pathways respond to rapamycin. Nucleotide-sugar metabolism, arginine and proline metabolism, and arginine biosynthesis pathways were the top enriched and shared by the two comparisons (Figures 1F and 1G). The metabolic shift in TSC proximal tubular cells The PTCs have high metabolic activity as most water, solutes, glucose, and amino acid reabsorption occur in this nephron segment. Thus, a shift in metabolic activity and nutrient availability may substantially affect the structure and function of the proximal tubules. Indeed, we have previously shown that Tsc1 deletion in NPCs leads to severe damage to PTCs manifested in swollen cellular appearance with an occluded tubular lumen and deranged mitochondrial structure.15,22 In addition, PTCs are the primary source of cells responsible for TSC renal cyst development in the Tsc1 KO mice.15,22 Therefore, we aimed to identify the specific metabolic shift in PTCs of Tsc1 KO mice and the effect of rapamycin in these cells. For that purpose, Tsc1fl/fl female mice were mated with Six2 Cretg/+ Tsc1fl/+ males and treated with either rapamycin or vehicle, as before.15 At P0, the kidneys were excised, and PTCs were fluorescence-activated cell sorting (FACS)-based sorted using prominin-1 antibody, a selective PTC marker.15 The metabolites were extracted and analyzed by hybrid triple quadrupole mass spectrometry as above. Overall, 57 metabolites were identified (Table S5), with 25 metabolites showing a pattern of dysregulation in PTCs obtained from Tsc1 KO mice and reversal toward the PTCs obtained from WT kidneys upon rapamycin treatment of Tsc1 KO mice (Table S6). These changes were associated with various metabolic pathways. The most substantial perturbations were identified in arginine and proline metabolism and arginine biosynthesis pathways (Figures 2A–2C).Figure 2 Rapamycin treatment reverses the metabolic profiling of Tsc1 KO PTCs through a direct effect on the arginine metabolism pathway (A) Principal-component analysis plot showing WT mice, Tsc1 KO mice, and Tsc1 KO mice treated with rapamycin. Each dot represents an independent biological samples. (B) Heatmap and dendrogram generated via hierarchical clustering of samples and all (58) detected metabolites. (C) Pathways enriched with significantly altered metabolites. The metabolite concentration tables of the selected groups were analyzed by using MetaboAnalyst 4.0 (https://www.metaboanalyst.ca), applying no filtering, quantile normalization, log transformation, and no scaling. See also Figure S2. To further investigate metabolic pathways altered in TSC, the previously identified differentially expressed genes15 and the set of significantly altered metabolites identified in this study (Figure S1) were subjected to Ingenuity Pathway Analysis (IPA; Qiagen) gene-metabolite expression analysis. This joint IPA revealed significant perturbations in several metabolic pathways such as the CLEAR signaling pathway, glutamyl cycle, citrulline metabolism, and amino acids such as proline, arginine, serine, and glycine biosynthesis pathways (Figures S2A and S2B). Furthermore, an additional gene-metabolite IPA expression analysis comparing PTC gene expression and metabolic profiling obtained from Tsc1 KO mice with and without rapamycin indicated a significant perturbation in metabolic pathways such as glycolysis, endothelial nitric oxide synthase (eNOS) signaling, urea cycle, and arginine biosynthesis pathway (Figures S2C and S2D). Of note, some of the metabolic pathways identified, such as citrulline metabolism and eNOS signaling, are linked with the arginine biosynthesis pathway and were predicted to be enriched in Tsc1 KO kidneys according to the integrated IPA. High ASS1 expression in the TSC mice model and human samples Our metabolomic assays presented above anticipated substantial changes in arginine metabolism in Tsc1 KO kidneys affected by rapamycin, and upregulation of Ass1 expression in PTCs obtained from Tsc1 KO mice compared with WT PTCs was depicted by our gene expression analysis (Figure S2). Arginine is a conditionally essential amino acid involved in diverse biological processes such as amino acid and NO production, host immune responses, and cell signaling.33,34,35,36,37,38,39,40 The de novo biosynthetic pathway of arginine involves the conversion of citrulline to arginine and is catalyzed by ASS1 and argininosuccinate lyase (ASL). Specifically, ASS1 catalyzes the condensation of citrulline and aspartate to form argininosuccinate, the immediate precursor of arginine synthesis. ASS1, a rate-limiting enzyme in urea synthesis, is now recognized as a ubiquitous enzyme in mammalian tissues with specific expression and localization in different tissues depending on the specific arginine needs of the tissue.40 Interestingly, ASS1 overexpression in TSC human organoids resembling AMLs was previously reported.41 The increase in ASS1 gene expression and protein levels was validated by qRT-PCR and western blotting (WB), showing an increase in ASS1 expression in Tsc1 KO kidneys (Figures 3A–3C). Moreover, ASS1 immunostaining of mouse kidney samples indicated high expression in Tsc1 KO kidneys, specifically in cyst-lining epithelial cells (Figure 3D). Immunostaining of ASS1 in embryonic kidney sections from human TSC sections also demonstrated high levels of ASS1 expression in TSC kidneys compared with matched control embryonic kidneys in early and late pregnancy (Figure 3E). The same human embryonic kidney sections showed no difference in immunostaining with other markers, such as lotus tetragonolobus lectin (LTL), a specific marker for PTCs (Figure S3A), indicating the specificity of ASS1 immunostaining.Figure 3 Tsc1 deletion induces ASS1 overexpression in mTOR-dependent pathway (A) RNA was extracted from WT, and Tsc1 KO kidneys at P0, and the relative ASS1 expression was quantified, indicating higher ASS1 expression in the kidneys of Tsc1 KO mice compared with WT kidneys, ∗p < 0.05 (n = 4 biological replicates). (B) Western blot for ASS1 and control GAPDH in control, and Tsc1 KO mice homogenized kidneys. (C) Quantification of the western blot as in (B). ∗p < 0.05 (n = 4 biological replicates). (D) Renal sections of WT and Tsc1 KO mice (P0) were stained with anti-ASS1. Scale bar: 50 μm. (n = 3 biological replicates). (E) Human renal sections of miscarriage fetuses at different embryonic stages due to TSC or non-related causes as indicated, stained with ASS1. (F) Western blot for TSC1, pS6 (a marker for mTORC1 activation), β-actin, and ASS1 in extracts obtained from control or Tsc1 KO HK2 cells (n = 3 biological replicates). (G) Relative ASS1 gene expression using RNA obtained from control and Tsc1 KO HK2 cells, ∗p < 0.05 (n = 3 biological replicates). (H) ASS1 immunostaining of control and Tsc1 KO HK2 cells (scale bar: 50 μm; n = 3 biological replicates). (I) Western blot analysis for ASS1, pS6, and β-actin protein expression in Tsc1 KO HK2 treated with either vehicle or 50 nM rapamycin for 24 h (n = 3 biological replicates). (J) Quantification for ASS1 relative protein expression as in (I), ∗p < 0.05 (n = 3 biological replicates). See also Figure S3. The rise in ASS1 levels in proximal tubular cells is mediated by mTORC1 activation We used a human proximal tubular cell line (HK2 cells) to study the interaction between mTORC1 and ASS1 expression. Tsc1 was knocked out in HK2 cells using CRISPR-Cas9 containing lentiviral particles. Indeed, Tsc1 KO increased mTORC1 activity as observed by high pS6 ribosomal protein levels. As observed in the mouse and human models, TSC1 KO was associated with high ASS1 levels, measured by qRT-PCR, WB, and immunostaining, with no effect on ASS1 cellular localization (Figures 3F–3H and S3B). These results were further reinforced in HEK293 cells, demonstrating that Tsc1 KO in these cells elevated ASS1 protein expression (Figure S4A). To examine whether ASS1 upregulation is secondary to mTORC1 hyperactivation, Tsc1 KO HK2 cells were incubated with rapamycin. Rapamycin significantly inhibited mTORC1 activation and ASS1 expression, indicating that ASS1 expression is regulated by the mTORC1 pathway (Figures 3I, 3J, and S3C). For further reinforcement, ASS1 expression was evaluated in kidney sections obtained from vehicle-treated WT and Tsc1 KO, as well as Tsc1 KO mice treated with rapamycin as before.15 pS6 and ASS1 immunostaining was enhanced in Tsc1 KO kidneys compared with WT kidneys and both pS6 and ASS1 immunostaining were diminished upon rapamycin treatment, pointing to mTORC1-dependent ASS1 regulation (Figures 4A–4D). Altogether, our results indicate major perturbations in the arginine biosynthesis pathway, together with mTORC1-dependent overexpression of the rate-limiting enzyme ASS1.Figure 4 Rapamycin treatment in vivo alleviates TSC-associated cyst development and inhibits ASS1 expression in a mTORC1-dependent manner (A and B) Kidney sections of WT and Tsc1 KO mice treated with either vehicle or rapamycin, as indicated, were H&E stained (A) or immunostained for ASS1 (B) or pS6 as a marker for mTORC1 activation (D). WT pups treated with vehicle (n = 3 biological replicates), Tsc1 KO pups treated with vehicle (n = 3 biological replicates), or rapamycin (n = 3 biological replicates). Scale bar = 500 μm. (C) Relative quantification of sum fluorescence intensity as in (B). ∗p < 0.05. Arginine deprivation impairs the proximal tubular cell cycle and TSC-associated protein expression in Tsc1 KO HK2 cells Next, we studied the effect of arginine depletion on Tsc1 KO HK2 cells. Tsc1 KO and control HK2 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with or without L-arginine. The cell cycle was monitored using propidium iodide staining and FACS analysis. Quantitative analysis revealed that arginine depletion significantly reduced the proportion of cells in the G2M phase while increasing the proportion of cells in the G0/G1 phase, indicating cell-cycle arrest (Figures 5A and 5B). Furthermore, the effect of arginine depletion on cell cycle and proliferation was reinforced in Tsc1 KO HEK293 cells, indicating that arginine depletion induces cell-cycle arrest and increases cell population at the G0/G1 phase (Figures S4B and S4C). We previously showed that Tsc1 KO PTCs exhibit hyperactivation of the mTORC1 pathway, together with elevated c-Myc and NF-κB P65 subunit protein levels.15 Conversely, arginine depletion in Tsc1 KO HK2 cells and Tsc1 KO HEK293 cells reduced mTORC1 activity, c-Myc, and NF-κB P65 subunit protein expression levels in TSC1 KO cell and to a lesser extent in control cells (Figures 5C and S5A–S5D). Taken together, these results indicate that the arginine biosynthesis pathway is a pivotal metabolic pathway essential for cell proliferation and TSC-associated cellular signaling.Figure 5 Arginine depletion in vitro induces cell-cycle arrest and attenuates TSC-associated signaling (A) Control and Tsc1 KO HK2 cells were incubated with either control or arginine-free medium for 10 days. Cells were harvested and fixed, and the cell cycle was monitored by propidium iodide flow cytometry-based analysis. (B) Quantification of data in A (n = 6 biological replicates), ∗p < 0.05. (C) Western blot analysis for ASS1, pS6, c-Myc, P65, and actin protein expression in control and Tsc1 KO HK2, representative of 2 independent experiments with similar results. See also Figures S4 and S5. Arginine deprivation ameliorates cyst formation in Tsc1 knockout mice To understand the effect of arginine depletion in vivo and its role in TSC-associated cyst development and growth, we mated Tsc1fl/fl female mice with Six2 Cretg/+ Tsc1fl/+ males, as described above. After conception, as identified by a vaginal plaque, the pregnant Tsc1fl/fl females were assigned to either arginine-deficient or control diet up to the delivery date (P0), when the kidneys were excised. The groups did not differ in litter size or kidney-to-body weight ratio (Figures S6A–S6C). Histopathology analysis indicated a significant reduction in cyst overload in kidneys obtained from Tsc1 KO mice fed an arginine-deficient diet (Figures 6A and 6B). Furthermore, the reduction in the cystic overload in Tsc1 KO mice fed an arginine-deficient diet was associated with reduced mTORC1 activity (Figures 6C, 6D, S7A, and S7B), cell proliferation (Figures 6E and 6F) and c-Myc protein expression (Figures 7A, 7B, and S7C), as measured by immunostaining and WB analysis of these kidneys.Figure 6 Arginine depletion ameliorates cyst development in Tsc1 KO mice (A) Representative H&E staining of kidney sections from WT (Tsc1fl/fl) and Tsc1 KO pups from Tsc1fl/fl mothers fed either control or arginine-deficient diets at P0, showing reduced cyst formation in kidneys of Tsc1 KO pups fed an arginine-deficient diet. Scale bar: 500 μm. (B–E) Quantification of the cyst area per section in the different groups as in (A). WT pups were fed a control diet (n = 5 biological replicates) and an arginine-deficient diet (n = 4 biological replicates). Tsc1 KO pups fed a control diet (n = 5 biological replicates) and arginine-deficient diet (n = 5 biological replicates), ∗p < 0.05. Kidney sections, as in (A), were immunostained for pS6 (C) and for the proliferation marker Ki67 (E). Scale bar: 50 μm. (D) Quantification of sum fluorescence intensity as in (C). ∗p < 0.05. (F) Quantification of Ki67-positive cells compared with total cells (DAPI positive cells) as in (E). ∗p < 0.05. See also Figures S6, S7, and S9. Figure 7 Arginine depletion attenuates cyst-associated c-Myc and P65 expression and reduces mononuclear cell infiltration in vivo in Tsc1 KO mice (A) Kidney sections from WT and Tsc1 KO P0 pups from Tsc1fl/fl mothers fed either control or arginine-deficient diets were immunostained for c-Myc. (B) Quantification of immunohistochemistry staining as in (A). ∗p < 0.05. (C) Sections, as in (A), were immunostained for P65, showing upregulation in P65 expression in Tsc1 KO kidneys and downregulation upon treatment with the arginine-deficient diet. (D) Quantification of sum fluorescence intensity as in (C). WT pups fed a control diet (n = 5 biological replicates) and arginine-deficient diet (n = 4 biological replicates). Tsc1 KO pups fed a control diet (n = 5 biological replicates) and arginine-deficient diet (n = 5 biological replicates), ∗p < 0.05. (E) As indicated, the kidney of WT and Tsc1 KO mice subjected to either control or arginine-depleted diet were dissociated and stained with APC-conjugated F4/80 and subjected to FACS analysis. Representative FACS analysis indicating the F4/80+ cells in each sample. (F) Quantification of the percentage of F4/80+ cells in each group as in (E). WT pups fed a control diet (n = 5 biological replicates), Tsc1 KO pups fed a control diet (n = 4 biological replicates), and Tsc1 KO pups treated with arginine-deficient diet (n = 3 biological replicates), ∗p < 0.05. See also Figures S7–S10. Moreover, the arginine-deficient diet prevented the increase in NF-κB P65 subunit protein expression in TSC cyst-lining cells (Figures 7C, 7D, and S7D), which was associated with a decline in kidney mononuclear infiltration of Tsc1 KO kidneys, upon arginine-deficient diet treatment as was demonstrated by FACS analysis of F4/80+ cells in dissociated kidneys (Figures 7E and 7F). The downregulation in protein expression of c-Myc and P65 was not observed in the corresponding mRNA levels, pointing to post-transcriptional regulation (Figure S8). Even though arginine depletion inhibited mTORC1 activation, it did not affect ASS1 expression (Figures S7D and S9). To better understand the role of ASS1 in TSC-associated cellular signaling and cell cycle, control and Tsc1 KO HK2 cells were infected with either control or ASS1 targeted short hairpin RNA (shRNA) containing lentivirus particles, and cultured with control high glucose DMEM media. ASS1 knockdown (KD) reduced mTORC1 activity, c-Myc, and NF-κB P65 subunit protein expression levels in control and Tsc1 KO cells, indicating that ASS1 expression is a pivotal directly contributing to TSC-associated cellular signaling (Figure S10A). However, under the same conditions, ASS1 KD had a minimal effect on cell proliferation on both control and Tsc1 KO HK2 cells, presumably because of the high levels of external arginine availability in the growth medium (Figures S10B and S10C). Altogether, these results indicate that the arginine biosynthesis pathway plays a crucial role in the process of TSC-associated cystogenesis and that arginine deprivation may alleviate cyst development directly by altering PTC cell signaling, inflammation, and cell cycle. Discussion Cystic kidney disease is a leading cause of CKD in patients with TSC disease. Here we studied the metabolic changes in TSC kidneys mouse model and especially in PTCs, and demonstrated that arginine availability has a role in the pathogenesis of TSC cystic kidney disease. We show that Tsc1 ablation in NPCs leads to dramatic changes in a substantial number of metabolites and to perturbations in significant metabolic pathways in Tsc1 KO kidneys. mTOR inhibition during pregnancy in Tsc1 KO mice reversed metabolic changes, secondary to mTORC1 hyperactivation. However, some metabolites remained unresponsive to mTORC1 inhibition, indicating that, in part, these metabolic changes are mTORC1 independent. The metabolic changes were observed in whole kidney extracts and more so in sorted PTCs. We previously showed that cysts arise from the PTCs population in the Tsc1 KO mouse model. Other studies have previously used targeted deletions in other nephron segments, such as intercalated cells, for studying kidney disease.9,42,43 On the basis of our metabolomic and bioinformatic analysis, we identified changes in arginine metabolism and overexpression of ASS1, a rate-limiting enzyme in the arginine biosynthetic pathway. These changes were observed in transcript and protein levels both in vitro in a human cell line of PTCs and in vivo in mouse and human TSC sections. The increase in ASS1 levels correlated with mTORC1 activity, as demonstrated by a decrease in ASS1 levels in a PTC cell line incubated with rapamycin. Arginine depletion in PTCs prevented the activation of signaling pathways previously shown to contribute to the cystogenic process, such as c-Myc and P65.15 Arginine depletion also prevented the increase in mTORC1 activity and pathogenic changes in the cell cycle. Interestingly, feeding pregnant mice carrying TSC embryos with an arginine-depleted diet substantially reduced the TSC cystic load, along with a decline in mTORC1 activity and cystogenic pathways. Arginine is a semi-essential amino acid because de novo arginine synthesis can be insufficient during stress, inflammation, and early embryonic development. In these cases, arginine availability depends on nutritional supply and protein degradation.44 The synthesis of arginine occurs mainly in the kidney using the intestinal-renal axis. Citrulline, produced primarily by the small intestine, is taken up by PTCs of the kidney and is efficiently converted to arginine by the sequential action of ASS1 and ASL to meet the needs for diverse cellular functions.45 Arginine is necessary for homeostasis as a precursor for protein synthesis, nitric oxide production, proline, creatine, agmatine, and polyamine synthesis.40,46 Arginine is also an immune modulator through its effects on T cell activation, promoting the generation of central memory-like T cells endowed with higher survival capacity and anti-tumor activity,38 and as an essential factor for maturation of the T cell receptor ζ-chain (TCRζ), necessary for T cells to interact with antigens.47 In macrophages, extracellular arginine is essential for NO production in response to different pro-inflammatory stimuli and is crucial for macrophage M1/M2 polarization.37,39 We previously showed that inflammatory reactions, mainly induced by macrophages, are involved in TSC cystogenesis.15 Indeed, arginine depletion, both in vitro and in vivo, reduced P65 expression and macrophage infiltration in Tsc1 KO kidneys, implying reduced inflammatory response. Of note, some impact of arginine deprivation is noticed on c-Myc and P65 in the control cells, implying an additional non-TSC-mediated effect of arginine depletion. An interaction between arginine metabolism and mTORC1 activity was previously suggested.46,48 Arginine may mediate its effects on mTOR activation by disrupting the interaction between TSC and mTORC1, activating Rag GTPase required for recruitment of mTORC1 complex to the lysosomal surface, and disrupting the CASTOR complex, regulating mTORC1 activation.48,49 In this regard, our results support this notion by indicating that arginine depletion in vivo and in vitro tampers with mTOR activation. Arginine also serves as a cell signaling modulator for the activation of MAPK as well as for the activation of the transmembrane G protein-coupled receptors (GPCRs), which are responsible for signal transduction into the intracellular space.37,39,50,51 Arginine was also implicated in activating different transcription factors by direct interaction and protein conformational change.38 Here we show that c-Myc and P65 expression are directly governed by arginine availability and ASS1 expression, which could result from direct interaction or altered PTC cell signaling inducing c-Myc and P65 upregulation. ASS1 expression is controlled by c-Myc and HIF-1α interacting with an E-box element located at the ASS1 gene promoter.52,53 Moreover, the ASS1 seems necessary for c-Myc expression, pointing to a direct cross-talk. Indeed, the kidneys of a TSC mouse model express high levels of ASS1 in correlation with elevated c-Myc expression. Nevertheless, in our system, arginine depletion and c-Myc down-regulation were unable to downregulate ASS1 expression, which may imply a post-transcriptional mechanism regulating ASS1 expression. Arginine is supplied in the human body mainly from the dietary resources and limited intrinsic recycling mediated by ASS1.26 ASS1 levels are increased in various tumor types and restricting arginine metabolism by the diet or arginine catabolizing agents can be effective.26,27,54,55 No adverse effects were reported in limiting arginine in the diet.56 In our study, arginine depletion in mice had no visible effect on mice litter size, offspring weight, or kidney-to-body weight ratio. However, other side effects of arginine depletion during pregnancy can be detected at later stages and need further investigation. Our findings indicate that arginine biosynthesis and metabolism pathways are crucial factors in mediating the TSC-associated cystogenic process. Our findings suggest that targeting arginine metabolism may alleviate TSC-associated cystogenesis by derangement of the TSC-associated cell signaling in PTCs via a reduction in mTORC1, c-Myc, and P65 signaling, lessening the inflammatory response and decreasing cystic cell proliferation. We suggest that arginine deprivation-based therapies could be relevant in treating TSC-associated kidney disease. Limitations of the study The mouse model used in this study is based on Tsc1 deletion in NPCs differentiating into the majority of the cell population in the nephron. However, the study’s findings cannot be extrapolated to TSC cystic kidney disease caused by Tsc2 deletion. The study does not use experimental models with deletions in different cell populations in the kidney. Furthermore, the mouse model used in this study has an early and aggressive presentation, which does not reflect the clinical presentation of heterozygous mutation of TSC genes that characterize the human disease. Therefore, other models should be used to further confirm the study’s findings. The interpretation of the findings from human samples in this study is limited because of the low availability of TSC kidney samples, and the study includes only human embryonic tissues. To increase the validity of these findings in human TSC patients, further studies are required, such as histopathologic studies of adult TSC kidneys and experiments examining the effect of low arginine or targeted interventions on arginine metabolism in TSC patients. These studies would provide more comprehensive insights into the disease’s pathophysiology and potential therapeutic interventions. STAR★Methods Key resources table REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-pS6 ribosomal protein Cell Signaling Cat# 2211; RRID: AB_331679 Mouse S6 Ribosomal Protein(54D2) antibody Cell Signaling Cat# 2317; RRID: AB_2238583 HRP-anti-beta-actin antibody Abcam Cat# ab20272; RRID: AB_445482 Rabbit anti-c-Myc Cell Signaling Cat# 5605; RRID: AB_1903938 Rabbit anti-P65 Cell Signaling Cat# 8242; RRID: AB_10859369 Rabbit anti-ASS1 Abcam Cat# ab191165 Rabbit anti-Tsc1 Abcam Cat# ab227594 Mouse anti-GAPDH EMD Millipore Cat# MAB374; RRID: AB_2107445 PE-conjugated anti-CD133/prominin-1 antibody Thermo Fisher Scientific Cat# 12-1331-82; RRID: AB_465849 Rabbit anti Phosphor- 4E-BP1 (Ser65) Antibody Cell Signaling Cat# 9451; RRID: AB_330947 Biotinylated Lotus Tetragonolobus Lectin (LTL) antibody Vector laboratories Cat# B-1325; RRID: AB_2336558 Alexa Flour 594-conjucated streptavidin Jackson ImmunoResearch Cat# 016-580-084; RRID:AB_2337250 APC-conjugated anti-F4/80 antibody Macs Miltenyi Biotec Cat# 130-116-525; RRID: AB_2733417 Cy3-conjugated goat anti-rabbit antibody Jackson ImmunoResearch Cat# 711-165-152; RRID: AB_2307443 Cy5-conjugated goat anti-mouse antibody Jackson ImmunoResearch Cat# A90-516C5; AB_10630988 Histofine Simple Stain MAX PO Anti-Mouse Anti-Rabbit Antibody N-Histofine Cat# 414152F Bacterial and virus strains CRISPR/Cas9 TSC1 gRNA Sigma Aldrich Clone# HSPD0000043237 pSpCas9(BB)-2A-Puro Gift from Prof. Iddo Ben Dov, Nephrology Department, Hadassah Medical Center, Jerusalem, Israel shRNA ASS1 Sigma Aldrich Clone # TRCN0000045554, TRCN0000440576 pLKO.1 neo Gift from Prof.Kun Ping Lu, Western University, London, Canada Biological samples Embryonic kidney sections from human TSC and non-TSC patients Histopathology core facility at Hadassah Medical Center, Jerusalem, Israel Chemicals, peptides, and recombinant proteins Trizol (TRI) reagent Bio-Lab Cat# 009010233100 HBSS Sigma-Aldrich Cat# H6648-500ML DMEM modified medium Biological Industries Cat# 01-050-1A Fetal bovine serum Sigma-Aldrich Cat# F7524-500ML DAB reagent Thermo-Scientific Cat# TA-125- QHDX Arginine-Free Modified DMEM medium Biological Industries Cat#06-1050-44-1-A Protease/phosphatase inhibitors MERCK Cat# 4906837001 Collagenase/Dispase Sigma Aldrich Cat# 10269638001 Puromycin Sigma Aldrich Cat# P7255 Neomycin Sulfate (10 mg/mL solution) Sigma Aldrich Cat# N1142 Penicillin-streptomycin Sigma Aldrich Cat# P4333-100ML Critical commercial assays High-capacity cDNA Reverse Transcription Kit containing RNase Inhibitor Applied Biosystems Cat# 4374966 Propidium Iodide Flow Cytometry Kit Abcam Cat# ab139418 Deposited data Raw and summary metabolomics data https://www.metabolomicsworkbench.org https://doi.org/10.21228/M8TD8H Experimental models: Cell lines Human: Proximal tubular epithelial cell line HK-2 Gift from Prof. Iddo Ben Dov, Nephrology Department, Hadassah Medical Center, Jerusalem, Israel Human: Embryonic kidney cell line HEK-293 Gift from Prof. Tally Naveh-Many Ph.D, Nephrology Department, Hadassah Medical Center, Jerusalem, Israel Experimental models: Organisms/strains Mouse: CD1 Tg(Six2-EGFP/cre)1Amc Gift from Raphael Kopan’s lab, Developmental biology department, Cincinnati Children’s Hospital Medical Center, Ohio, USA Mouse: CD1 Tsc1fl/fl Gift from Raphael Kopan’s lab, Developmental biology department, Cincinnati Children’s Hospital Medical Center, Ohio, USA Oligonucleotides Primers for Mouse ASS1 see Table 1 Sigma-Aldrich Cat# RE0057854-4/5 Primers for Human ASS1 see Table 1 Sigma-Aldrich Cat# RE00600-859/860 Primers for Mouse GAPDH see Table 1 Sigma-Aldrich Cat# RE006218-49/50 Primers for Human GAPDH see Table 1 Sigma-Aldrich Cat# RE0059942-4/5 Primers for Mouse Six2 Cre see Table 1 Sigma-Aldrich Cat#RE0037800-0/1 Primers for Mouse Tsc1 see Table 1 Sigma-Aldrich Cat# RE0037799-4/3 Primers for Mouse P65 see Table 1 Sigma-Aldrich Cat# RE0073272-8/9 Primers for Mouse c-Myc see Table 1 Sigma-Aldrich Cat# RE0073273-0/1 Software and algorithms LSRII flow cytometry and FlowJo software The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel https://crf.huji.ac.il/bd-lsr-ii Ingenuity Pathway Analysis (IPA®) QIAGEN Inc. https://digitalinsights.qiagen.com/products-overview/discovery-insights-portfolio/content-exploration-and-databases/qiagen-ipa/ MetaboAnalyst server, version 4.0 Chong, Wishart, and Xia60 https://www.metaboanalyst.ca GraphPad Prism version 8.3.0 Pediatric Nephrology Research lab, Hadassah Medical School, Jerusalem, Israel. https://www.graphpad.com/updates/prism-830-release-notes Thermo Xcalibur 4.4 Thermo TraceFinder™ 4.1 software Metabolite-Auto Plotter 2.3 Pietzke and Vazquez59 R project for statistical computing IMARIS 9.8.0 software The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel https://crf.huji.ac.il/nikon-confocal-a1r NIS-Elements AR analysis software The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel https://crf.huji.ac.il/nikon-confocal-a1r Other Amino Acid diet ENVIGO Cat# TD.01084 Arginine deficient diet ENVIGO Cat# TD.09152 Resource availability Lead contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Dr. Oded Volovelsky (odedvo@hadassah.org.il). Materials availability This study did not generate new unique reagents or code. Experimental model and subject details Human kidney section samples Embryonic kidney sections from human TSC and non-TSC patients were obtained from the histopathology core facility at Hadassah Medical Center as was approved by the Hebrew University IRB committee (HMO-0516-17). All samples were de-identified and numbered before immunostaining and analysis. Two non-TSC kidney sections were obtained: 1) Week 14 of gestation (Number 237). An induced termination for suspected Cytomegaloviral infection, without specific pathologic findings in the fetus or the placenta; and 2) Perinatal death at 29 weeks of gestation due to severe Pierre Robin sequence, but without visceral congenital anomalies (Number 201). In addition, two age-matched TSC kidney sections were obtained: 1) 12 weeks of gestation (Number 21533). An induced termination for TSC1 mutation was examined without specific pathologic findings in the material. 2) 41 weeks of gestation (Number 32). An induced termination for TSC phenotype includes multiple tubers, subependymal nodules in the brain, and multiple cardiac rhabdomyomas. The kidneys were not severely affected, with only occasional cortical cysts. Animals All mice were maintained in the Hebrew University Specific-Pathogen-Free (SPF) Animal Facility Unit. The following CD1 transgenic mice lines were used: Tg (Six2-EGFP/cre)1Amc (herein Six2 Cre tg/+) and Tsc1fl/fl.4 For deletion of Tsc1 in NPCs, 6- to 8-week-old Six2 Cretg/+ male mice were mated with 6- to 8-week-old Tsc1fl/fl females. 25% of the pups were expected to carry the homozygous Tsc1 deletion (Six2 Cretg/+ Tsc1fl/fl). The mice genotype was identified using the following primers— Six2 Cre forward: GCATTACCGGTCGATGCAACGAGTGATGAG; Six2 Cre reverse: GAGTGAACGAACCTGGTCGAAATCAGTGCG; Tsc1 forward: CAGCTCCGACCATGAAGTG; and Tsc1 Reverse: AGGAGGCCTCTTCTGCTAC. The pregnancy date was determined by vaginal plug expulsion. The morning of plug detection was designated as day 0.5 of pregnancy. In our experiments, 16 pregnant Tsc1fl/fl females were separated into individual cages. Pregnant females were randomly placed either on a control diet (here in the control diet, n = 8 females) (ENVIGO, Cat #TD.01084) or an arginine deficient diet (here in Arg (−) Diet, n = 8 females) (ENVIGO, Cat #TD.09152) up to delivery date. Upon delivery (P0), newborn pups were dissected, and kidneys were excised. Newborn pups' kidneys and body weights were recorded, one kidney was fixed in fresh 4% formaldehyde in PBS for histological sectioning, and the other kidney was used for protein and RNA extraction. Study approval The animal study was approved by the Hebrew University Authority For Biological and Biomedical Models (Authorization number: MD-22-16835-3). The Hebrew University IRB committee approved the usage of human kidney sections in this study (HMO-0516-17). Cell lines The human proximal tubular epithelial cell line HK-2 and human embryonic kidney cell line HEK-293 were cultured in DMEM-modified medium (Biological Industries, Cat #01-050-1A), supplemented with 10% fetal bovine serum (Sigma Aldrich, Cat #F7524-500ML), 100 U/mL penicillin, and 100 μg/mL streptomycin (Sigma Aldrich, Cat #P4333-100ML) at 37°C in a humid atmosphere with 5% CO2. For TSC1 deletion, each of HK-2 and HEK-293 cells were infected with CRISPR/Cas9 lentiviral transduction particles containing the guide sequence: TTCCACCTCCGACGAGAGT, specifically targeting the human TSC1 gene (Sigma Aldrich, Clone # HSPD000043237), or the control CRISPR/Cas9 lentiviral transduction particles. 48 h after infection, the cells were treated with 1ug/ml puromycin (Sigma Aldrich, Cat #P7255) for additional 7 days before GFP+ cells were isolated using the BD Aria III flow cytometry-based cell sorting (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/bd-aria-iii). Control and TSC1 knockout HK-2 and HEK-293 cells were then incubated for 10 days with either control Modified DMEM medium (Biological Industries, Cat #01-050-1A) or arginine-free Modified DMEM medium (Biological Industries Cat #06-1050-44-1-A). Both media were deprived of the following amino acids: alanine, asparagine, glutamic acid, glutamine, aspartic acid and proline. In some cases, as indicated, control and Tsc1 KO HK2 cells were infected with either control or ASS1 targeting shRNA-containing particles (Sigma Aldrich, Clone # TRCN0000045554, TRCN0000440576), and selected with Neomycin Sulfate (50 μg/ml) (Sigma Aldrich, Cat #N1142) for 10 days shRNA sequences are as fallow: Clone # TRCN0000045554: GCCTGAATTCTACAACCGGTT, Clone # TRCN0000440576: CCCAAGTACAGGCGCTAATTG. Method details Section preparation, immunostaining, and analysis Kidneys at P0 were fixed in fresh 4% formaldehyde in PBS. Kidneys were embedded in paraffin and sectioned. For general histology, tissue sections were stained with hematoxylin and eosin. Immunofluorescence/Immunohistochemistry staining was performed as previously described.15 Briefly, paraffin-embedded tissue sections (4–6 μm) were deparaffinized, hydrated, and incubated overnight at 4C with the following antibodies, according to the manufacturer’s instructions: rabbit anti-phospho S6 ribosomal protein (Cell Signaling, Cat #2211), mouse anti-Ki67 (Novus Bio, Cat #NBP2-22112), rabbit anti-c-Myc (cell signaling, Cat#5605), rabbit anti-P65 (cell signaling, Cat #8242) and rabbit anti-ASS1 (Abcam, Cat #ab191165). For IF staining, the sections were incubated with Cy3-conjugated goat anti-rabbit (Jackson ImmunoResearch, Cat #711-165-152) or Cy5-conjugated goat anti-mouse (Jackson ImmunoResearch, Cat #A90-516C5) antibody according to the manufacturer’s instructions. For IHC, DAB reagent (Thermo-Scientific, Cat # TA-125-QHDX) was applied after incubation with Histofine Simple Stain MAX PO Anti-Mouse Anti-Rabbit Antibody (N-Histofine, Cat #414152F). Human embryonic kidney sections were stained for rabbit anti-ASS1 (Abcam, Cat #ab191165) and Anti Biotinylated Lotus Tetragonolobus Lectin (LTL) antibody (Vector Laboratories, Cat #B- 1325). The sections were then incubated with either Cy3-conjugated goat anti-rabbit (Jackson ImmunoResearch, Cat #711-165-152) or Alexa Flour 594-conjugated streptavidin (Jackson ImmunoResearch, Cat #016-580-084) respectively. All sections and slides were visualized with a confocal A1R microscope and analyzed using IMARIS 9.8.0 software and NIS-Elements AR analysis software (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/nikon-confocal-a1r). Cystic index Hematoxylin-stained sections were visualized by a Nikon TL light microscope (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/nikon-fluorescent). The cyst number for a given section area and the cyst area ratio compared with the total kidney section area were evaluated using NIS-Elements AR analysis software (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/nikon-confocal-a1r). Western Blotting Whole kidneys or HK-2 and HEK-293 cells were homogenized in ice-cold RIPA buffer containing 150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, and 25 mM Tris (pH 7.4) supplemented with protease/phosphatase inhibitors (MERCK, Cat #4906837001). An equal amount of protein extract was analyzed by SDS-PAGE, as previously described15 using the following antibodies according to the manufacturer’s instructions: rabbit anti-pS6 ribosomal protein (Cell Signaling, Cat #2211), HRP-anti-beta actin antibody (Abcam, Cat #ab20272), rabbit anti-c-Myc, (cell signaling, Cat #5605), rabbit anti-P65 (cell signaling, Cat #8242), rabbit anti-ASS1 (Abcam, Cat #ab191165), rabbit anti-TSC1 (Abcam, Cat #ab227594), mouse anti-GAPDH (EMD Millipore, Cat #MAB374), mouse S6 Ribosomal Protein(54D2) antibody (Cell Signaling, Cat #2317) and Rabbit phosphor-4E-BP1 (Ser65) antibody (Cell Signaling, Cat #9451). RNA isolation and c-DNA preparation Total RNA was extracted from 50 to 100 mg of kidney samples or HK-2 cells using Trizol (TRI) reagent (Bio-Lab, Cat #009010233100) as was previously described.15 Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using a High-Capacity cDNA Reverse Transcription Kit containing RNase Inhibitor (Applied Biosystems, Cat #4374966) following the manufacturer’s instructions. All primers used for qRT-PCR are summarized in Table 1.Table 1 Oligonucleotide sequences, related to STAR Methods Oligo name Sequence (5′-3′) Batch no. Mouse ASS1 forward primer ATGACCAGGTCCGCTTTGAG RE00578544 Mouse ASS1 reverse primer GGGGATTCCGTGTTGCTTTG RE00578545 Human ASS1 forward primer GCTTATAACCTGGGATGGGCA RE00600859 Human ASS1 reverse primer TTGCTGGACATAGCGTCTGG RE00600860 Mouse GAPDH forward primer GGGTCCCAGCTTAGGTTCAT RE00621849 Mouse GAPDH reverse primer CCCAATACGGCCAAATCCGT RE00621850 Human GAPDH forward primer GAAAGCCTGCCGGTGACTAA RE00599424 Human GAPDH reverse primer GCCCAATACGACCAAATCAGAG RE00599424 Mouse Six2 Cre forward primer GCATTACCGGTCGATGCAACGAGTGATGAG RE00378000 Mouse Six2 Cre reverse primer GAGTGAACGAACCTGGTCGAAATCAGTGCG RE00378001 Mouse Tsc1 forward primer CAGCTCCGACCATGAAGTG RE00377994 Mouse Tsc1 reverse primer AGGAGGCCTCTTCTGCTACC RE00377993 Mouse P65 forward primer CCCTGACCATGGACGATCTG RE00732728 Mouse P65 reverse primer TGCTTCGGCTGTTCGATGAT RE00732729 Mouse cMyc forward primer GTTGGAAACCCCGCAGACAG RE00732730 Mouse cMyc reverse primer ATAGGGCTGTACGGAGTCGT RE00732731 FACS-based cell sorting for kidney proximal tubule cell (PTCs) isolation PTCs were isolated as previously described.15 Briefly, kidneys were excised in ice-cold HBSS buffer (Sigma-Aldrich, Cat #H6648-500ML). The kidneys were sliced and chopped into pieces (∼0.5–1 mm) on ice using a surgical scalpel. The chopped kidneys were transferred into an HBSS solution containing 1 μg/μL collagenase/dispase (Sigma Aldrich, Cat #10269638001) and incubated for 25 min at 37°C. The cells were filtered through a 40-μm nylon cell strainer (Corning, Cat #431750) and washed twice with cold HBSS. For PTC isolation, the cells were stained with PE-conjugated anti-CD133/prominin-1 antibody (Invitrogen, Cat #12-1331-82) according to the manufacturer’s instructions. PE + cells were isolated by BD Aria III flow cytometry-based cell sorting (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/bd-aria-iii). For FACS analysis of F4/80+ cells, kidneys were chopped as described above and stained with APC-conjugated anti-F4/80 antibody (Macs Miltenyi Biotec, Cat #130-116-525). The cells were washed twice with HBSS before analysis by LSRII flow cytometry (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/bd-lsr-ii). Cell cycle analysis Control, TSC1 KO HK-2, and HEK-293 cells were cultured using the previously mentioned medium as above. The cells were harvested, fixed, and stained with Propodeum iodide (Abcam, Cat #ab139418) according to manufacturer instructions. The cells were analyzed by LSRII flow cytometry and FlowJo software (The core research facility, The Hebrew University of Jerusalem, Jerusalem, Israel, https://crf.huji.ac.il/bd-lsr-ii). Metabolic analysis For Kidneys metabolomics profiling: snap-frozen kidneys were transferred into 0.5 mL homogenization tubes prefilled with 1.4mm ceramic beads (CK14, #P000933-LYSK0-A, Bertin corp) and cold (−20°C) metabolites extraction solvent (Methanol: acetonitrile: water at a ratio of 5:3:2 respectively). A mixture of six labeled internal standards was added to the extraction solution for quality control (13C6-Glucose, 13C5-Glutamine, 13C5-Glutamate, 13C1-Alanine, 13C3-Pyruvate, and 13C3-Lactate). The exact volume of each tube was adjusted according to tissue weight (average volume of 200 μL). The samples were homogenized using Precellys 24 tissue homogenizer (Bertin Technologies) precooled to 4°C (3 cycles × 30 s at 6000 rpm, with a 30 s gap between each cycle) later centrifuged at 18,000 g for 15 min at 4°C. The supernatants were transferred into HPLC glass vials and kept at −80°C before LC-MS analysis. For cellular metabolomics profiling: Approximately 500,000 isolated PTCs in each biological sample were extracted using 200 μL of the same metabolite extract solution described above. Samples were vortexed for 15 min and centrifuged at 20,000g for 20 min at 4°C. The supernatants were transferred into HPLC glass vials and kept at −80°C before LC-MS analysis. LC-MS metabolomics analysis LC-MS analysis was conducted as described.58 Briefly, Dionex Ultimate ultra-high-performance liquid chromatography (UPLC) system coupled to Orbitrap Q-Exactive mass spectrometer (Thermo Fisher Scientific) was used. The resolution was set to 35,000 at a 200 mass/charge ratio (m/z) with electrospray ionization and polarity switching mode to enable both positive and negative ions across a mass range of 67–1000 m/z. UPLC setup consisted of a ZIC-pHILIC column (SeQuant; 150 mm × 2.1 mm, 5 μm; Merck). 5 μL of cells or kidney extracts were injected using an autosampler. Compounds were separated using a 15-min gradient, starting at 20% aqueous (20 mM ammonium carbonate adjusted to pH 9.2 with 0.1% of 25% ammonium hydroxide) and 80% organic (acetonitrile), terminated with 20% acetonitrile. Flow rate and column temperature were kept at 0.2 mL/min and 45°C, respectively, for a total run time of 27 min. All metabolites were detected using mass accuracy below 5 ppm. Thermo Xcalibur 4.4 was used for data acquisition. The peak areas of different metabolites were determined using Thermo TraceFinder 4.1 software. Metabolites were identified using the exact mass of the singly charged ion and the retention time of a matching standard using an in-house library acquired by running commercial standards for all detected metabolites. The peak areas of each identified metabolite were normalized to mg tissue or cell number. Metabolite-Auto Plotter 2.359 was used for data visualization during data processing. Raw and summary metabolomics data from this study are available at the NIH Common Fund’s National Metabolomics Data Repository (NMDR) Website, the Metabolomics Workbench,57 https://www.metabolomicsworkbench.org where it has been assigned Study IDs ST002457 and ST002458. The data can be accessed directly via its Project https://doi.org/10.21228/M8TD8H. Metabolomic statistical analysis Metabolomic profiling results were further analyzed using the MetaboAnalyst web server version 4.060 (https://www.metaboanalyst.ca), and the respective R package (MetaboAnalystR: https://github.com/xia-lab/MetaboAnalystR), applying the following pre-analytical options: filtering – none, normalization – quantile, transformation – logarithmic, scaling – none. We used MetaboAnalyst’s intrinsic single factor and multivariate statistical analyses, including fold change, unpaired t-test (applying Benjamini-Hochberg correction for multiple testing), principal component analysis (PCA), clustering dendrogram and heatmap, and the pathway enrichment analysis module. An excerpt of the R code and a respective concentration file needed to run the code can be downloaded from https://t.ly/0dGs. Additional downstream computations were conducted on R and plotted using the ‘ggplot2’ (scatter correlation plots) and ‘ggVennDiagram’ (Venn diagrams) packages. Metabolite concentration tables and results of differential concentration (expression) analyses are provided as Table S1. Concentrations of detected metabolites in kidney samples, related to Figure 1, Table S2. Univariate analysis result for each metabolite; KO vs. WT, related to Figure 1, Table S3. Univariate analysis result for each metabolite; KO+r vs. KO, related to Figure 1, Table S4. Metabolites showing significant yet inverse regulation in KO vs. WT and KO+r vs. KO comparisons, related to Figure 1, Table S5. Concentrations of detected metabolites in PTC samples, related to Figure 2, Table S6. Metabolites showing reversal of dysregulation in PTCs, related to Figure 2. Canonical pathway enrichment analysis Canonical pathway enrichment analysis of the significantly differentially expressed genes and metabolites was carried out using the Ingenuity Pathway Analysis (IPA) (QIAGEN Inc., https://digitalinsights.qiagen.com/products-overview/discovery-insights-portfolio/content-exploration-and-databases/qiagen-ipa/). Quantification and statistical analysis The numbers of biological samples were determined based on effect size or sample variation. No statistical method was used to predetermine the sample size. No animals or samples were excluded from any analysis. Animals were randomly assigned to groups for in vivo studies; no formal randomization method was applied when assigning animals for treatment. Values are reported as means ± SEM unless otherwise stated. The data were analyzed by a student’s 2-tailed t-test. The significance was set at a p value of less than 0.05. The data are presented using the GraphPad Prism version 8.3.0 and the R project for statistical computing. Supplemental information Document S1. Figures S1–S10 Table S1. Concentrations of detected metabolites in kidney samples, related to Figure 1 Table S2. Univariate analysis result for each metabolite; KO vs. WT, related to Figure 1 Table S3. Univariate analysis result for each metabolite; KO+r vs. KO, related to Figure 1 Table S4. Metabolites showing significant yet inverse regulation in KO vs. WT and KO+r vs. KO comparisons, related to Figure 1 Table S5. Concentrations of detected metabolites in PTC samples, related to Figure 2 Table S6. Metabolites showing reversal of dysregulation in PTCs, related to Figure 2 Document S2. Article plus supplemental information Data and code availability • Raw and summary metabolomics data from this study is available at the NIH Common Fund’s National Metabolomics Data Repository (NMDR) Website, the Metabolomics Workbench,57 https://www.metabolomicsworkbench.org, where it has been assigned Study IDs ST002457 and ST002458. The data can be accessed directly via its Project https://doi.org/10.21228/M8TD8H. • This paper does not report an original code. However, an excerpt of the MetaboAnalyst R code and a respective concentration file needed to run the code can be downloaded from https://t.ly/0dGs. • Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request Acknowledgments This work was supported by grants from the 10.13039/501100003977 Israel Science Foundation, Israel (2030/21 to M.N. and 2358/18 to O.V.), the TSC Alliance Research grant, USA (O.V.), and the Research Authority of Hadassah Hebrew University Medical Center, Israel (O.V.). O.V. and M.N. are Wohl’s Translation Research Institute research associates at Hadassah-Hebrew University Medical Center. The graphical abstract was created using BioRender.com. In addition, we thank Prof. Sharona Elgavish and Dr. Hadar Benyamini at the Hebrew University bioinformatics core facility for conducting the bioinformatics analysis to interpret our data. Finally, we thank the reviewers for taking the time and effort to review the manuscript. We sincerely appreciate all your valuable comments and suggestions, which helped us improve the manuscript’s quality. Author contributions M.N. and O.V. conceived the study, designed the experiment, and wrote the manuscript. M.N., A.A., and L.W. designed and conducted most of the experiments and supervised the rest of the experiments. H.P.C. conducted the cellular infections. I.A. and B.A. conducted metabolomics analysis experiments. E.G. helped conceive the study and critically reviewed the manuscript. I.Z.B.-D. helped conceive the study, performed the bioinformatics and statistical analysis, and critically reviewed the manuscript. Declaration of interests The authors declare no competing interests. Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2023.101073. ==== Refs References 1 Henske E.P. Jóźwiak S. Kingswood J.C. Sampson J.R. Thiele E.A. Tuberous sclerosis complex Nat. Rev. Dis. Prim. 2 2016 16035 27226234 2 Salussolia C.L. Klonowska K. Kwiatkowski D.J. Sahin M. Genetic etiologies, diagnosis, and treatment of tuberous sclerosis complex Annu. Rev. Genom. Hum. Genet. 20 2019 217 240 3 Yang H. Yu Z. Chen X. Li J. Li N. Cheng J. Gao N. Yuan H.X. Ye D. Guan K.L. Xu Y. Structural insights into tsc complex assembly and gap activity on rheb Nat. Commun. 12 2021 339 33436626 4 Jozwiak J. Hamartin and tuberin: working together for tumour suppression Int. J. Cancer 118 2006 1 5 16206276 5 Benvenuto G. Li S. Brown S.J. Braverman R. Vass W.C. Cheadle J.P. Halley D.J. Sampson J.R. Wienecke R. DeClue J.E. The tuberous sclerosis-1 (tsc1) gene product hamartin suppresses cell growth and augments the expression of the tsc2 product tuberin by inhibiting its ubiquitination Oncogene 19 2000 6306 6316 11175345 6 Giannikou K. Malinowska I.A. Pugh T.J. Yan R. Tseng Y.Y. Oh C. Kim J. Tyburczy M.E. Chekaluk Y. Liu Y. Whole exome sequencing identifies tsc1/tsc2 biallelic loss as the primary and sufficient driver event for renal angiomyolipoma development PLoS Genet. 12 2016 e1006242 27494029 7 Amin S. Lux A. Calder N. Laugharne M. Osborne J. O'callaghan F. Causes of mortality in individuals with tuberous sclerosis complex Dev. Med. Child Neurol. 59 2017 612 617 27935023 8 Gallo-Bernal S. Kilcoyne A. Gee M.S. Paul E. Cystic kidney disease in tuberous sclerosis complex: current knowledge and unresolved questions Pediatr. Nephrol. 2022 10.1007/s00467-022-05820-x 9 Bissler J.J. Zadjali F. Bridges D. Astrinidis A. Barone S. Yao Y. Redd J.R. Siroky B.J. Wang Y. Finley J.T. Tuberous sclerosis complex exhibits a new renal cystogenic mechanism Phys. Rep. 7 2019 e13983 10 Vekeman F. Magestro M. Karner P. Duh M.S. Nichols T. van Waalwijk van Doorn-Khosrovani S.B. Zonnenberg B.A. Kidney involvement in tuberous sclerosis complex: the impact on healthcare resource use and costs J. Med. Econ. 18 2015 1060 1070 26201433 11 Kingswood C. Bolton P. Crawford P. Harland C. Johnson S.R. Sampson J.R. Shepherd C. Spink J. Demuth D. Lucchese L. The clinical profile of tuberous sclerosis complex (tsc) in the United Kingdom: a retrospective cohort study in the clinical practice research datalink (cprd) Eur. J. Paediatr. Neurol. 20 2016 296 308 26706603 12 Kingswood J.C. Nasuti P. Patel K. Myland M. Siva V. Gray E. The economic burden of tuberous sclerosis complex in UK patients with renal manifestations: a retrospective cohort study in the clinical practice research datalink (cprd) J. Med. Econ. 19 2016 1116 1126 27310569 13 Siroky B.J. Yin H. Bissler J.J. Clinical and molecular insights into tuberous sclerosis complex renal disease Pediatr. Nephrol. 26 2011 839 852 21152937 14 Dixon B.P. Hulbert J.C. Bissler J.J. Tuberous sclerosis complex renal disease Nephron Exp. Nephrol. 118 2011 e15 e20 21071977 15 Nechama M. Makayes Y. Resnick E. Meir K. Volovelsky O. Rapamycin and dexamethasone during pregnancy prevent tuberous sclerosis complex-associated cystic kidney disease JCI Insight 5 2020 e136857 32484794 16 Zadjali F. Kumar P. Yao Y. Johnson D. Astrinidis A. Vogel P. Gross K.W. Bissler J.J. Tuberous sclerosis complex axis controls renal extracellular vesicle production and protein content Int. J. Mol. Sci. 21 2020 1729 32138326 17 Sager R.A. Woodford M.R. Mollapour M. The mtor independent function of tsc1 and fnips Trends Biochem. Sci. 43 2018 935 937 30361061 18 Woodford M.R. Hughes M. Sager R.A. Backe S.J. Baker-Williams A.J. Bratslavsky M.S. Jacob J.M. Shapiro O. Wong M. Bratslavsky G. Mutation of the co-chaperone tsc1 in bladder cancer diminishes hsp90 acetylation and reduces drug sensitivity and selectivity Oncotarget 10 2019 5824 5834 31645902 19 Woodford M.R. Backe S.J. Sager R.A. Bourboulia D. Bratslavsky G. Mollapour M. The role of heat shock protein-90 in the pathogenesis of birt-hogg-dubé and tuberous sclerosis complex syndromes Urol. Oncol. 39 2021 322 326 32327294 20 Woodford M.R. Sager R.A. Marris E. Dunn D.M. Blanden A.R. Murphy R.L. Rensing N. Shapiro O. Panaretou B. Prodromou C. Tumor suppressor tsc1 is a new hsp90 co-chaperone that facilitates folding of kinase and non-kinase clients EMBO J. 36 2017 3650 3665 29127155 21 Lai M. Zou W. Han Z. Zhou L. Qiu Z. Chen J. Zhang S. Lai P. Li K. Zhang Y. Tsc1 regulates tight junction independent of mtorc1 Proc. Natl. Acad. Sci. USA 118 2021 e2020891118 22 Volovelsky O. Nguyen T. Jarmas A.E. Combes A.N. Wilson S.B. Little M.H. Witte D.P. Brunskill E.W. Kopan R. Hamartin regulates cessation of mouse nephrogenesis independently of mtor Proc. Natl. Acad. Sci. USA 115 2018 5998 6003 29784808 23 Karbowniczek M. Zitserman D. Khabibullin D. Hartman T. Yu J. Morrison T. Nicolas E. Squillace R. Roegiers F. Henske E.P. The evolutionarily conserved tsc/rheb pathway activates notch in tuberous sclerosis complex and drosophila external sensory organ development J. Clin. Invest. 120 2010 93 102 20038815 24 Li C. Liu X. Liu Y. Zhang E. Medepalli K. Masuda K. Li N. Wikenheiser-Brokamp K.A. Osterburg A. Borchers M.T. Tuberin regulates prostaglandin receptor-mediated viability, via rheb, in mtorc1-hyperactive cells Mol. Cancer Res. 15 2017 1318 1330 28710231 25 Hartman T.R. Liu D. Zilfou J.T. Robb V. Morrison T. Watnick T. Henske E.P. The tuberous sclerosis proteins regulate formation of the primary cilium via a rapamycin-insensitive and polycystin 1-independent pathway Hum. Mol. Genet. 18 2009 151 163 18845692 26 Trott J.F. Hwang V.J. Ishimaru T. Chmiel K.J. Zhou J.X. Shim K. Stewart B.J. Mahjoub M.R. Jen K.Y. Barupal D.K. Arginine reprogramming in adpkd results in arginine-dependent cystogenesis Am. J. Physiol. Ren. Physiol. 315 2018 F1855 F1868 27 Podrini C. Rowe I. Pagliarini R. Costa A.S.H. Chiaravalli M. Di Meo I. Kim H. Distefano G. Tiranti V. Qian F. Dissection of metabolic reprogramming in polycystic kidney disease reveals coordinated rewiring of bioenergetic pathways Commun. Biol. 1 2018 194 30480096 28 Menezes L.F. Germino G.G. The pathobiology of polycystic kidney disease from a metabolic viewpoint Nat. Rev. Nephrol. 15 2019 735 749 31488901 29 Li X. Polycystic Kidney Disease 2015 Codon Publications 10.15586/codon.pkd.2015 30 Flowers E.M. Sudderth J. Zacharias L. Mernaugh G. Zent R. DeBerardinis R.J. Carroll T.J. Lkb1 deficiency confers glutamine dependency in polycystic kidney disease Nat. Commun. 9 2018 814 29483507 31 Medvetz D. Priolo C. Henske E.P. Therapeutic targeting of cellular metabolism in cells with hyperactive mtorc1: a paradigm shift Mol. Cancer Res. 13 2015 3 8 25298408 32 Hilliard S. Tortelote G. Liu H. Chen C.H. El-Dahr S.S. Single-cell chromatin and gene-regulatory dynamics of mouse nephron progenitors J. Am. Soc. Nephrol. 33 2022 1308 1322 35383123 33 Morris C.R. Hamilton-Reeves J. Martindale R.G. Sarav M. Ochoa Gautier J.B. Acquired amino acid deficiencies: a focus on arginine and glutamine Nutr. Clin. Pract. 32 2017 30S 47S 28388380 34 Oh H.S. Oh S.K. Lee J.S. Wu C. Lee S.J. Effects of l-arginine on growth hormone and insulin-like growth factor 1 Food Sci. Biotechnol. 26 2017 1749 1754 30263714 35 Liang M. Wang Z. Li H. Liu B. Yang L. L-arginine prevents 4-hydroxy-2-nonenal accumulation and depresses inflammation via inhibiting nf-κb activation J. Biochem. Mol. Toxicol. 36 2022 e23087 35470495 36 Ge Y. Li F. He Y. Cao Y. Guo W. Hu G. Liu J. Fu S. L-arginine stimulates the proliferation of mouse mammary epithelial cells and the development of mammary gland in pubertal mice by activating the gprc6a/pi3k/akt/mtor signalling pathway J. Anim. Physiol. Anim. Nutr. 106 2022 1383 1395 37 Pekarova M. Lojek A. The crucial role of l-arginine in macrophage activation: what you need to know about it Life Sci. 137 2015 44 48 26188591 38 Geiger R. Rieckmann J.C. Wolf T. Basso C. Feng Y. Fuhrer T. Kogadeeva M. Picotti P. Meissner F. Mann M. L-arginine modulates t cell metabolism and enhances survival and anti-tumor activity Cell 167 2016 829 842.e13 27745970 39 Buchmüller-Rouiller Y. Corradin S.B. Mauël J. Macrophage activation for intracellular killing as induced by a ca2+ ionophore. Dependence on l-arginine-derived nitrogen oxidation products Biochem. J. 284 1992 387 392 1599422 40 Szefel J. Danielak A. Kruszewski W.J. Metabolic pathways of l-arginine and therapeutic consequences in tumors Adv. Med. Sci. 64 2019 104 110 30605863 41 Hernandez J.O.R. Wang X. Vazquez-Segoviano M. Lopez-Marfil M. Sobral-Reyes M.F. Moran-Horowich A. Sundberg M. Lopez-Cantu D.O. Probst C.K. Ruiz-Esparza G.U. A tissue-bioengineering strategy for modeling rare human kidney diseases in vivo Nat. Commun. 12 2021 6496 34764250 42 Iwata W. Unoki-Kubota H. Kato H. Shimizu A. Matsumoto M. Imasawa T. Igarashi A. Matsumoto K. Noda T. Terauchi Y. Podocyte-specific deletion of tubular sclerosis complex 2 promotes focal segmental glomerulosclerosis and progressive renal failure PLoS One 15 2020 e0229397 32191726 43 Ren S. Luo Y. Chen H. Warburton D. Lam H.C. Wang L.L. Chen P. Henske E.P. Shi W. Inactivation of tsc2 in mesoderm-derived cells causes polycystic kidney lesions and impairs lung alveolarization Am. J. Pathol. 186 2016 3261 3272 27768862 44 Luiking Y.C. Ten Have G.A.M. Wolfe R.R. Deutz N.E.P. Arginine de novo and nitric oxide production in disease states Am. J. Physiol. Endocrinol. Metab. 303 2012 E1177 E1189 23011059 45 Haines R.J. Pendleton L.C. Eichler D.C. Argininosuccinate synthase: at the center of arginine metabolism Int. J. Biochem. Mol. Biol. 2 2011 8 23 21494411 46 Morris S.M. Arginine metabolism revisited J. Nutr. 146 2016 2579S 2586S 27934648 47 Taheri F. Ochoa J.B. Faghiri Z. Culotta K. Park H.J. Lan M.S. Zea A.H. Ochoa A.C. L-arginine regulates the expression of the t-cell receptor zeta chain (cd3zeta) in jurkat cells Clin. Cancer Res. 7 2001 958s 965s 11300497 48 Shimobayashi M. Hall M.N. Multiple amino acid sensing inputs to mtorc1 Cell Res. 26 2016 7 20 26658722 49 Takahara T. Amemiya Y. Sugiyama R. Maki M. Shibata H. Amino acid-dependent control of mtorc1 signaling: a variety of regulatory modes J. Biomed. Sci. 27 2020 87 32799865 50 Morris S.M. Arginine: master and commander in innate immune responses Sci. Signal. 3 2010 pe27 20716762 51 Mieulet V. Yan L. Choisy C. Sully K. Procter J. Kouroumalis A. Krywawych S. Pende M. Ley S.C. Moinard C. Lamb R.F. Tpl-2-mediated activation of mapk downstream of tlr4 signaling is coupled to arginine availability Sci. Signal. 3 2010 ra61 20716763 52 Long Y. Tsai W.B. Chang J.T. Estecio M. Wangpaichitr M. Savaraj N. Feun L.G. Chen H.H.W. Kuo M.T. Cisplatin-induced synthetic lethality to arginine-starvation therapy by transcriptional suppression of ass1 is regulated by dec1, hif-1α, and c-myc transcription network and is independent of ass1 promoter dna methylation Oncotarget 7 2016 82658 82670 27765932 53 Brashears C.B. Barlin M. Ehrhardt W.R. Rathore R. Schultze M. Tzeng S.C. Van Tine B.A. Held J.M. Systems level profiling of arginine starvation reveals myc and erk adaptive metabolic reprogramming Cell Death Dis. 11 2020 662 32814773 54 Al-Koussa H. El Mais N. Maalouf H. Abi-Habib R. El-Sibai M. Arginine deprivation: a potential therapeutic for cancer cell metastasis? A review Cancer Cell Int. 20 2020 150 32390765 55 Zou S. Wang X. Liu P. Ke C. Xu S. Arginine metabolism and deprivation in cancer therapy Biomed. Pharmacother. 118 2019 109210 31330440 56 Kaiser-Kupfer M.I. Caruso R.C. Valle D. Reed G.F. Use of an arginine-restricted diet to slow progression of visual loss in patients with gyrate atrophy Arch. Ophthalmol. 122 2004 982 984 15249361 57 Sud M. Fahy E. Cotter D. Azam K. Vadivelu I. Burant C. Edison A. Fiehn O. Higashi R. Nair K.S. Metabolomics workbench: an international repository for metabolomics data and metadata, metabolite standards, protocols, tutorials and training, and analysis tools Nucleic Acids Res. 44 2016 D463 D470 26467476 58 Mackay G.M. Zheng L. van den Broek N.J.F. Gottlieb E. Analysis of cell metabolism using lc-ms and isotope tracers Methods Enzymol. 561 2015 171 196 26358905 59 Pietzke M. Vazquez A. Metabolite autoplotter - an application to process and visualise metabolite data in the web browser Cancer Metabol. 8 2020 15 60 Chong J. Wishart D.S. Xia J. Using metaboanalyst 4.0 for comprehensive and integrative metabolomics data analysis Curr. Protoc. Bioinformatics 68 2019 e86 31756036