==== Front J Genet Eng Biotechnol J Genet Eng Biotechnol Journal of Genetic Engineering & Biotechnology 1687-157X 2090-5920 Springer Berlin Heidelberg Berlin/Heidelberg 37389653 528 10.1186/s43141-023-00528-3 Research In-silico mining and characterization of MYB family genes in wilt-resistant hybrid guava (Psidium guajava × Psidium molle) Ahmad Israr israr15ahmad@gmail.com http://orcid.org/0000-0002-6272-7251 Soni Sumit K. sumit.soni@icar.gov.in M. Muthukumar Pandey Devendra grid.505931.b 0000 0004 0636 1368 Division of Crop Improvement and Biotechnology, ICAR-Central Institute for Subtropical Horticulture, Rehmankhera, P.O. Kakori, Lucknow, Uttar Pradesh 226101 India 30 6 2023 30 6 2023 12 2023 21 7426 12 2022 20 6 2023 © The Author(s) 2023 https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Background The MYB family is one of the most significant groups of transcription factors in plants. However, several MYBs have been linked to secondary metabolism and are important for determining the color of fruit’s peel and pulp. Despite being a substantial fruit crop in tropical and subtropical areas of the world, wilt-resistant hybrid guava (Psidium guajava × Psidium molle; PGPM) has not yet been the subject of a thorough examination. This study’s goal was to assess the expression of MYB in guava fruit pulp, roots, and seeds to predict its function by in silico analysis of the guava root transcriptome data. Results In the current study, we have mined the MYBs family of MYB genes from the transcriptome of the PGPM guava root. We have mined 15 distinct MYB transcription factor genes/transcripts viz MYB3, MYB4, MYB23, MYB86, MYB90, MYB308, MYB5, MYB82, MYB114, MYB6, MYB305, MYB44, MYB51, MYB46, and MYB330. From the analyses, it was found that R2-MYB and R3-MYB domains are conserved in all known guava MYB proteins. The expression of six different MYB TFs was examined using semi-quantitative RT-PCR in “Shweta” pulp (white colour pulp), “Lalit” pulp (red color pulp), “Lalit” root, and “Lalit” seed. Conclusion There were 15 MYB family members observed in guava. They were unequally distributed across the chromosomes, most likely as a result of gene duplication. Additionally, the expression patterns of the particular MYBs showed that MYB may be involved in the control of wilt, fruit ripening, seed development, and root development. Our results allow for a more thorough functional characterization of the guava MYB family genes and open the door to additional research into one essential MYB transcription factor family of genes and its involvement in the growth and ripening of guava fruit. Supplementary Information The online version contains supplementary material available at 10.1186/s43141-023-00528-3. Keywords In silico mining MYB Psidium guajava RT-PCR ICAR, Indiaissue-copyright-statement© Academy of Scientific Research and Technology 2023 ==== Body pmcBackground Multigene families govern the growth and development of plants. A DNA-binding domain, a nuclear localization signal, a transcription activation domain, and an oligomerization site are the four primary domains that transcription factors typically contain and that play a significant role in the regulation of gene transcription [1]. Through the activation or suppression of the transcriptional process, these four domains cooperate to regulate a wide range of aspects of plant development and growth [2]. Analysis of each transcription factor’s distinct roles is complicated by the fact that multigene families frequently encode transcription factors [1]. The MYB transcription factors of higher plants are more widely distributed across the genome than those of fungi and mammals [3]. MYB transcription factors are made up of two unique regions: an N-terminal conserved MYB DNA binding domain and a C-terminal variable modulator region that regulates the activities of proteins. Plants have a high degree of conservation of the MYB domain, at N-terminus and proteins typically contain one to four repeats viz R1, R2, R3, and R4. Each repetition contains 50–53 amino acids that code for three α-helices, from which the second and third α-helices form the HTH (helix-turn-helix) structure [4]. The third α-helix interacts with the major groove of DNA and forms the transcription factor DNA recognition site [5]. A set of highly conserved tryptophan (W) residues found in the MYB domain is involved in sequence-specific DNA binding [6]. Contrarily, the C-terminal, promoter domain of various MYB proteins is extremely varied, contributing to the wide range of regulatory tasks played by the MYB gene family [7–9]. Higher plants often include R2R3-MYB domain proteins as their predominant form [10]. The regulation of primary and secondary metabolism, the management of the cell cycle, and the response to abiotic and biotic stressors are just a few of the phases of plant growth and development where the plant MYB transcription factors have been shown to play a role [11, 12]. The guava (Psidium guajava L.; PG) is a significant fruit crop in tropical and subtropical regions of the world. Guava has 2n = 22 chromosomes and a genomic size of over 450 MB. It belongs to the family Myrtaceae, which comprises about 150 species [13]. Guava is mostly produced in India, Mexico, Pakistan, Taiwan, Thailand, Colombia, and Indonesia, with small-scale plantations also operating in Malaysia, Australia, and South Africa [14]. There are approximately about 400 guava varieties produced all over the world, each with a unique fruit pulp and peel colour. When a fruit reaches maturity, the peel changes from green to yellow or red, and the fruit pulp can range from white to deep pink. This trait varies between cultivars and depends on the climate [15]. Consumers typically choose visually appealing colorful fruits because they have better nutritional characteristics and attractiveness. Genes involved in secondary metabolic pathways, particularly phenylalanine ammonia-lyase (PAL), anthocyanidin synthase (ANS), dihydro-flavonol 4-reductase (DFR), chalcone synthase (CHS), flavanol synthase/flavanone 3-hydroxylase (F3H), UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT), MYB transcription factors, basic helix-loop-helix (bHLH), tryptophan-aspartic acid repeat set c. regulate the color of fruits and vegetables [16–21]. Although Psidium guajava L (PG) is a lucrative economic crop it suffers huge losses due to wilt susceptibility. The specific etiology of wilt is unknown, but it has been linked to the pathogens Fusarium oxysporum, Fusarium solani, Rhizoctonia bataticola, Macrophomina phaeseoli, Gliocladium roseum, and Cephalosporium sp. etc. To combat wilt, the ICAR-Central Institute for Subtropical Horticulture in Lucknow has developed an interspecific hybrid rootstock of guava hybrid Psidium guajava × Psidium molle (PGPM). The rootstock has been demonstrated to be wilt-resistant and grafted successfully with commercial guava varieties [22, 23]. In light of the foregoing, it was hypothesized that the MYB also play a crucial role in determining the peel and pulp colour of guava fruit in PG as well as wilt resistance in PGPM. The first step for alteration via orderly breeding or genome editing is the identification of MYB candidate genes and the controlled pathways [24, 25]. The scarcity of genomic data for guava presents a significant challenge for genetic study. However, the development of genomic and transcriptomic analytical resources and tools is being aided by NGS techniques and bioinformatics pipelines. No attempt has been made to describe MYB genes implicated in guava development, even though physiological studies have been conducted. The objective of this study was to evaluate MYB expression in guava fruit pulp, root, and seed to determine its function by in silico analysis of the root transcriptome data of guava. Materials and method Transcriptome sequencing and in silico analysis On the Illumina platform, paired-end sequencing was used to analyze the transcriptome sequence of the PGPM. The libraries were created using the Illumina TruSeq Stranded Total RNA Library Preparation Kit following the manufacturer's instructions using input total RNA of less than 1 g. Using Trinity software at default settings, high-quality reads were achieved. Trinity software was used with the default parameters to produce high-quality reads. The CD-HIT software was used to further process the transcripts for the prediction of Unigenes. With the help of blast analysis, more than 35,000 CDS were located with precise gene annotations. Nucleotide sequences were analyzed using nucleotide BLAST against mango genome data in the National Center for Biotechnology Information to determine the chromosomal placement and location of MYB CDS (NCBI). Using the online sequence manipulation suite (https://www.bioinformatics.org/sms2/), the nucleotide CDS sequence was converted into amino acid sequences. The MOTIF Search tool (https://www.genome.jp/tools/motif/) was used to analyze the motif search results. Using the MUSCLE tool (https://www.ebi.ac.uk/Tools/msa/muscle/), multiple amino acid sequence alignments of MYB proteins were carried out using CDS of transcriptome data. Weblogo (https://weblogo.berkeley.edu) tool was used to prepare the logo sequences for the R2-R3-MYB domains of MYB proteins. The gene expression analysis of mine MYB family genes was carried out using commonly occurring CDS (based on common NR blast hit accession) taking as control with hybrid Psidium guajava × Psidium molle hybrid (wilt-resistant) as treated. The Gene Ontology (GO) and Subcellular localization analysis of the mine MYB family genes was performed using the online web-server BUSCA (Bologna Unified Subcellular Component Annotator) (https://busca.biocomp.unibo.it/). The phylogenetic position of mine MYB family genes with respect to the reference MYB gene of Arabidopsis thaliana (AAD46772) was performed using MEGA version 5.2 software. The protein sequence of mine MYB family genes was aligned through by inbuilt MUSCLES alignment tool of MEGA version 5.2 software. The evolutionary history was inferred by using the Maximum Likelihood method based on the Poisson correction model with bootstrap replications of 500. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using a JTT model, and then selecting the topology with superior log likelihood value [26]. Semi-quantitative RT-PCR analysis Lalit (pulp, seed, and root) and Shweta (pulp) samples of frozen guava were pulverized to a fine powder with liquid nitrogen using a mortar and pestle. Total RNA was isolated using the Spectrum TM plant total RNA kit (Sigma, USA) following the manufacturer's instructions. NanoDrop was used to monitor the purity and quantity of total RNA. The Maxima first strand cDNA synthesis kit for RT-qPCR (Genetix) was used to reverse transcribe 2 g of total RNA from each sample using OligodT and random primers under the manufacturer guidelines. A 1:5 dilution of the synthesized cDNA in nuclease-free water was performed before qRT-PCR analysis. The following parameters were employed to develop primer (Table 1) using IDT PrimerQuest software and the CDS acquired from fruit transcriptome data: OligoAnalyzer was used to check for the presence of stable hairpins and dimers. The ideal length was 25 base pairs, the GC content was 50–55%, the melting point was 57 °C, and the amplicon length range was 100–200 base pairs. For in silico confirmation of each gene’s specificity, the produced primer pair was then aligned to all guava CDS. One hundred nanograms of cDNA, 0.5 µm conc. of each primer, 2.5 mM dNTPs, and 1 unit of Taq DNA polymerase were mixed with 1 × PCR buffer to perform PCR amplification in a total volume of 10 µl. The reaction was run through 35 cycles in a Bio-Rad thermal cycler, starting with an initial denaturation at 94 ℃ for 30 s, followed by 57 °C for 30 s, 72 ℃ for 30 s, and a final extension at 72 °C for 5 min. PCR-amplified products were visualized via a trans-illuminator after being resolved on a 2.0% agarose gel made with 1 × TBE buffer and 0.5 µg of ethidium bromide.Table 1 Primers used in semi-quantitative RT-PCR analysis Gene Forward primer (5′-3′) Reverse primer (5′-3′) MYB3 GACCATCATTCAACTCCATA TCTTCCTGATGTGGGTGTTCC MYB4 CTTGTGGTCTCCAGAGGAAG CAGGCCTCAAGTAATTGATCCA MYB23 AACCAGACATCAAGAGAGGT GTGGTGTTCCAGTAGTTCTTGA MYB86 TTGAGGCCTGATTTGAAGAG AAGAGTTCCACAGATTCTTG MYB90 CAAGGGAGCATGGACGGCAG CGGAGATGTTCCCTCTCTTA MYB308 AACTCCGGACGAGGACGATC TGGGTGTTCCAGTAGTTCTTG Result and discussion In this study, 2.64 GB of data was generated from root transcriptome analysis of the PGPM. Trinity software was used to do a de novo assembly of high-quality reads, identifying 170,027 transcripts with a maximum length of 962 bp. The top-hit species distribution showed that the species Eucalyptus grandis received the bulk of hits. We have mined 15 different MYB transcription factors genes/transcripts (MYB3, MYB4, MYB5, MYB6, MYB23, MYB44, MYB46, MYB51, MYB86, MYB82, MYB90, MYB114, MYB305, MYB308, and MYB330) in the root transcriptome data of guava. Further, the phylogenetic position of mine MYB family genes with respect to the reference MYB gene of Arabidopsis thaliana (AAD46772) is depicted in Fig. 1. Phylogenetic analysis grouped the mine MYB family genes into four clusters.Fig. 1 Molecular phylogenetic analysis by maximum likelihood method. The tree with the highest log likelihood (-2952.9718) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 16 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 65 positions in the final dataset We used a bioinformatics technique to study domain analysis in coding sequences, which reveals that all mined MYB genes possess the conserved R2-MYB and R3-MYB domains and were found to be unevenly distributed throughout guava chromosomes (Fig. 2; Table 2). WebLogo was used to build sequence logos that could be used to show conservation at specific points. The conserved amino acids shared by MYB domains were strikingly similar, as seen in Figs. 3 and 4. According to these findings, the R2 and R3 repeats of the guava MYBs proteins contain a large number of conserved amino acids, including the distinctive Trp (W). The R2 repeat contains three conserved Trp (W) residues. The R3 repeat only conserved the second and third Trp (W), while the first Trp (W) was frequently replaced with phenylalanine (F) or isoleucine (I) (Figs. 3 and 4). It is possible that substitution at the first Trp (W) residue causes the recognition of new target genes and/or results in a reduction in the DNA-binding activity against target genes. The C-terminal domain is more mutable, whereas the N-terminal domain is more conserved [6, 27]. Gene Ontology (GO) and Subcellular localization analysis of the identified MYB family genes revealed that MYB5, MYB3, MYB1, MYB308, MYB51, MYB86, MYB4, MYB46, MYB23, MYB330, MYB114, MYB305, MYB44 were localized in the nucleus. Whereas the subcellular localization of MYB90 and MYB5 accounted for chloroplast and endomembrane systems respectively (Table 3 and supplementary data).Fig. 2 Distribution of MYB protein domains and motifs in different CDS of guava Table 2 Chromosomal location and nucleotide positioning of different CDS sequences having R2–R3 MYB domain CDS_MYB Chromosome (+/−) Chromosomal location CDS_187_MYB82 6 (+) 11203042 to 11203088 11203200 to 11203555 CDS_1047_MYB5 10 (+) 29397091 to 29397666 CDS_18029_MYB5 5 (+) 12762141 to 12762789 12763182 to 12763853 CDS_1048_MYB3 7(−) 30879921 to 30880054 30879617 to 30879750 30878781 to 30879528 CDS_1145_MYB1R1 5 (−) 42430294 to 42430731 CDS_1209_MYB308 9 (+) 1960510 to 1960643 1960848 to 1961612 CDS_1628_MYB114 6 (−) 5437874 to 5438160 5437180 to 5437492 CDS_1629_MYB6 1(+) 13565271 to 13565861 CDS_1632_MYB4 5 (+) 16370726 to 16370859 16370961 to 16371093 16371186 to 16372155 CDS_2416_MYB3R1 6 (+) 32952467 to 32954264 32954612 to 32954946 32955435 to 32955672 32952238 to 32952369 32956171 to 32956297 CDS_4475_MYB305 4 (−) 27474181 to 27474727 CDS_4529_MYB44 3 (+) 48186292 to 48186660 CDS_11028_MYB90 6 (+) 16927844 to 16928140 16929089 to 16929730 CDS_12868_MYB51 1 (+) 38436377 to 38437214 CDS_13761_MYB86 2 (+) 17474766 to 17475163 CDS_18309_MYB46 5 (+) 13524439 to 13524804 CDS_20213_MYB23 6 (−) 5306240 to 5306885 5307239 to 5307444 5306968 to 5307107 CDS_21499_MYB330 6 (−) 6631103 to 6631645 CDS_22252 _MYB330 3 (+) 45943958 to 45944765 CDS_35812 8 (+) 11169084 to 11169587 CDS_38352 5 (−) 6987291 to 6987668 CDS_32049_MYBAPL 3 (−) 23666873 to 23667736 Fig. 3 Multiple sequence alignments of MYB proteins. a R2MYB. b R3MYB of guava Fig. 4 Logo sequences for a R2MYB, b R3MYB domain of guava MYB proteins prepared from Weblogo Table 3 Gene ontology (GO) and Subcellular localization analysis of the identified MYB family genes S.N Accession GO ids GO terms Score Alternative localization 1 MYB5 GO:0005634 C: nucleus 1 2 MYB3 GO:0005634 C: nucleus 1 3 MYB90 GO:0009507 C: chloroplast 1 4 MYB1 GO:0005634 C: nucleus 1 5 MYB308 GO:0005634 C: nucleus 1 6 MYB51 GO:0005634 C: nucleus 1 7 MYB86 GO:0005634 C: nucleus 1 8 MYB4 GO:0005634 C: nucleus 1 9 MYB5 GO:0012505 C:endomembrane system 0.81 GO:0031090-C:organelle membrane (score = 0.71) 10 MYB46 GO:0005615 C:extracellular space 0.62 GO:0005634-C: nucleus (score = 0.38) 11 MYB23 GO:0005634 C: nucleus 1 12 MYB330 GO:0005634 C: nucleus 1 13 MYB114 GO:0005634 C: nucleus 1 14 MYB305 GO:0005634 C: nucleus 1 15 MYB44 GO:0005615 C: extracellular space 0.62 GO:0005634-C: nucleus (score = 0.38) The expression of MYB3, MYB4, MYB23, MYB86, MYB90, and MYB308 was also evaluated in the Lalit fruit pulp (red pulp), seed, root, and Shweta pulp (white pulp) (Fig. 5). MYB23 and MYB308 were only expressed in the root tissue, indicating that they play a crucial role in the development of roots. While pulp and root tissue showed MYB4 expression (Fig. 4). MYB86 and MYB90 expression was identified in all tissues, including the root, seed, and pulp, indicating that they play a significant role in the development of fruits and roots (Fig. 4). MYB3 was only expressed in the fruit pulp, highlighting its crucial function in fruit ripening (Fig. 4). The heatmap analysis also accounted the exclusive significant higher expression of MYB23 gene in wilt-resistant PGPM as compared with wilt susceptible Psidium guajava (Fig. 6). This result indicates that higher expression of MYB23 (only expressed in root) gene might play a crucial role to confer the wilt resistance in PGPM.Fig. 5 Semi-quantitative RT-PCR analysis of different MYB in root, pulp, and seed of guava Fig. 6 Heatmap of upregulated and downregulated 15 mine MYB gene. Scaling is the base mean value, i.e., dark red colour represents upregulated genes whereas green colour represents downregulated genes. MYB family genes of PG (Psidium guajava) taking as control while PGPM (hybrid Psidium guajava × Psidium molle) is treated Gene functions can be better understood by understanding the patterns of gene expression. Recent research has revealed that the pear’s skin, bud, and fruit express MYB genes [28, 29]. Through their conserved N-terminal domains and their C-terminal domains, which are particular to transcriptional activation or repression, conserved MYB TFs can take part in intricate physiological processes. For instance, MYB3, MYB86, and MYB90 were involved in fruit ripening and MYB4, MYB90, and MYB308 in root development (Fig. 4). Previous studies on apples, grapes, and strawberries by various researchers provided support for this finding [30–33]. They discovered that MYB-bHLH-WD40 complexes controlled the transcription of the genes responsible for producing structural anthocyanins. In a variety of plants, including Arabidopsis thaliana [6], Malus domestica [34], Solanum tuberosum [35], Solanum lycopersicum [36], Gossypium raimondii [37], etc., the roles of MYB proteins have been thoroughly studied. The MYB gene in Arabidopsis thaliana controls the production of flavonoids in most tissues [38]. This pathway appears to be extremely conserved because orthologs of the AtMYB in Beta vulgaris [39] and Medicago truncatula [40] also function as flavonol biosynthesis regulators. The expression of the MYB transcription factor (TF), glutathione S transferase (GST), 4-coumarate-CoA ligase (4CL), and WD repeat genes is higher in red-fleshed apples than in green apples, supporting the observation that the red-fleshed apples accumulate flavonoid and anthocyanin accumulation at comparatively higher levels than green apples [41]. A transcription factor like c-MYB that regulates the biosynthesis of anthocyanins is encoded by the C1 gene in maize, the first MYB gene discovered in a plant. The anthocyanins are essential to coloring flower petals and other plant structures, whereas proanthocyanidins are necessary for coloring seed coats [42, 43]. The MYB gene is responsible for controlling the synthesis of anthocyanins and proanthocyanidins, which affects plant structure and seed colour, respectively [44, 45]. Conclusion It has been established that members of the MYB gene family play many regulatory roles in controlling how plants respond to diverse biotic and abiotic stresses. Root transcriptome analysis of Psidium guajava × Psidium molle hybrid generated 2.64 GB data. In silico mining including motifs and expression of guava MYBs was carried out in the present study. A total of 15 MYB family members were identified. They were unevenly distributed among chromosomes in guava probably with the occurrence of gene duplication. The exclusive significant higher expression of the MYB23 gene (only expressed in root) in wilt-resistant PGPM indicates that it might play a crucial role to confer the wilt resistance in PGPM. Furthermore, the expression patterns of some MYB demonstrated that MYB might participate in the regulation of fruit ripening, seed and root development. Future guava fruit quality will be enhanced with the help of the identification and study of MYB genes. The insights from these findings may help with future functional studies of the MYB genes to clarify their biological functions in guava. Supplementary Information Additional file 1: Figure S1. Ancestor chart for GO: 0005634. GO: 0009507. A chlorophyll-containing plastid with thylakoids organized into grana and frets, or stroma thylakoids, and embedded in a stroma. Figure S2. Ancestor chart for GO: 0009507. GO: 0012505. A collection of membranous structures involved in transport within the cell. The main components of the endomembrane system are endoplasmic reticulum, Golgi bodies, vesicles, cell membrane and nuclear envelope. Members of the endomembrane system pass materials through each other or through the use of vesicles. Figure S3. Ancestor chart for GO: 001250. GO: 0005615.That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. Figure S4. Ancestor chart for GO: 0005615. Abbreviations PG Psidium guajava PGPM Hybrid (Psidium guajava × Psidium molle) MYB Myeloblastosis DNA Deoxyribonucleic acid CDS Coding sequence NCBI National Center for Biotechnology Information cDNA Complementary deoxyribonucleic acid RT-PCR Reverse transcription PCR Taq Thermus aquaticus TBE Tris-Borate-EDTA Trp Tryptophan WD Beta-transducin repeat Acknowledgements The author would also like to thank the Director of ICAR-CISH, Lucknow for providing the necessary facilities for the investigation. Research content The research content of manuscript is original and has not been published elsewhere. Authors’ contributions IA and SKS conceived the research, designed experiments. IA and SKS performed the experiments. IA, SKS and MM analyzed the data. IA, SKS, MM and DP prepared the draft. IA and SKS editing and prepared the final manuscript. Funding The research was funded by the Indian Council of Agricultural Research, New Delhi, India. Availability of data and materials The data generated during the process of this work are available upon request. Declarations Ethics approval and consent to participate Not applicable. Consent for publication All authors have seen the latest version of the manuscript and agree to its publication. Competing interests The authors declare that there is no conflict of interests or personal relationships that could have appeared to influence the work reported in this paper. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. ==== Refs References 1. Riechmann JL Heard J Martin G Reuber L Jiang C Keddie J Adam L Pineda O Ratcliffe OJ Samaha RR Creelman R Pilgrim M Broun P Zhang JZ Ghandehari D Sherman BK Yu G Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes Science 2000 290 5499 2105 2110 10.1126/science.290.5499.2105 11118137 2. Ptashne M How eukaryotic transcriptional activators work Nature 1988 335 683 689 10.1038/335683a0 3050531 3. Zimmermann IM Heim MA Weisshaar B Uhrig JF Comprehensive identification of Arabidopsis thaliana MYB transcription factors interacting with R/B-like BHLH proteins Plant J 2004 40 22 34 10.1111/j.1365-313X.2004.02183.x 15361138 4. Stracke R Werber M Weisshaar B The R2R3-MYB gene family in Arabidopsis thaliana CurrOpin Plant Biol 2001 4 447 456 10.1016/s1369-5266(00)00199-0 5. Kanei-Ishii C Sarai A Sawazaki T Nakagoshi H He DN Ogata K Nishimura Y Ishii S The tryptophan cluster: a hypothetical structure of the DNA-binding domain of the myb protooncogene product J Biol Chem 1990 265 32 19990 19995 10.1016/S0021-9258(17)45472-X 2246275 6. Dubos C Stracke R Grotewold E Weisshaar B Martin C Lepiniec L MYB transcription factors in Arabidopsis Trends Plant Sci 2010 15 10 573 581 10.1016/j.tplants.2010.06.005 20674465 7. Kranz HD Denekamp M Greco R Jin H Leyva A Meissner RC Petroni K Urzainqui A Bevan M Martin C Smeekens S Tonelli C Paz-Ares J Weisshaar B Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana Plant J 1998 16 2 263 276 10.1046/j.1365-313x.1998.00278.x 9839469 8. Jin H Martin C Multifunctionality and diversity within the plant MYB-gene family Plant Mol Biol 1999 41 577 585 10.1023/a:1006319732410 10645718 9. Kranz H Scholz K Weisshaar B c-MYB oncogene-like genes encoding three MYB repeats occur in all major plant lineages Plant J 2000 21 231 235 10.1046/j.1365-313x.2000.00666.x 10743663 10. Ogata K Kanei-Ishii C Sasaki M Hatanaka H Nagadoi A Enari M Nakamura H Nishimura Y Ishii S Sarai A The cavity in the hydrophobic core of Myb DNA-binding domain is reserved for DNA recognition and trans-activation Nat Struct Mol Biol 1996 3 178 87 10.1038/nsb0296-178 11. Zhu Y Dong C Zhu JK Hasegawa PM Bressan RA HOS10 encodes an R2R3-type MYB transcription factor essential for cold acclimation in plants Proc Natl Acad Sci USA 2005 12 9966 9971 10.1073/pnas.0503960102 12. Gao Z Liu C Zhang Y Li Y Yi K Zhao X Cui ML The promoter structure differentiation of a MYB transcription factor RLC1 causes red leaf coloration in empire red leaf cotton under light PLoS ONE 2013 8 10 1 12 10.1371/journal.pone.0077891 13. Nimisha S Kherwar D Ajay KM Singh B Usha K Molecular breeding to improve guava (Psidiumguajava L.): current status and future prospective Sci Horti 2013 164 578 588 10.1016/j.scienta.2013.10.017 14. Jain SM Priyadarshan PM Breeding plantation tree crops: Tropical species. In Annals of botany New York, USA: Springer 2009 104 vii xi 10.1093/aob/mcp206 15. Pommer CV Murakami KRN Jain SM Priyadarshan PM Breeding Guava (Psidium guajava L.) Breeding Plantation Tree Crops: Tropical Species 2009 New York Springer 16. Ban Y Honda C Hatsuyama Y Igarashi M Bessho H Moriguchi T Isolation and functional analysis of a MYB transcription factor gene that is a key regulator for the development of red coloration in apple skin Plant Cell Physiol 2007 48 958 970 10.1093/pcp/pcm066 17526919 17. Rock CD Trans-acting small interfering RNA4: key to nutraceutical synthesis in grape development? Trends Plant Sci 2013 18 601 610 10.1016/j.tplants.2013.07.006 23993483 18. Dhar MK Sharma R Koul A Kaul S Development of fruit color in Solanaceae: a story of two biosynthetic pathways Brief Funct Genomics 2015 14 199 212 10.1093/bfgp/elu018 24916164 19. LeRoy J, Huss B, Creach A, Hawkins S, Neutelings G (2016) Glycosylation is a major regulator of phenylpropanoid availability and biological activity in plants. Front Plant Sci. 7:10.3389/fpls.2016.00735. 20. Yao G Ming M Allan AC Gu C Li L Wu X Map-based cloning of the pear gene MYB114 identifies an interaction with other transcription factors to coordinately regulate fruit anthocyanin biosynthesis Plant J 2017 92 437 451 10.1111/tpj.13666 28845529 21. Wang N Xu H Jiang S Zhang Z Lu N Qiu H MYB12 and MYB22 play essential roles in proanthocyanidin and flavonol synthesis in red-fleshed apple (Malus sieversii f. niedzwetzkyana) Plant J 2017 90 276 292 10.1111/tpj.13487 28107780 22. Rajan S Kumar R Mishra AK Negi SS Hybrid Guava, Psidium molle × P guajava (INGR No. 04116; IC427822), with Resistance to Guava Wilt Ind J Plant Genet Resour 2005 18 3 301 23. Sharma MR Kumari S Mishra M Micropropagation of wilt resistant, inter-specific (Psidium molle × Psidium guajava) rootstock of Guava Plant Arch 2018 18 1 1170 1174 24. Mikhaylova EV, Shein MY, Artyukhin AY, Sukhareva AS, Panfilova MA, Kuluev BR (2020) Editing of the MYB genes in Brassica napus as a method to increase anthocyanin pigmentation and stress tolerance. E3S Web Conf 224: 04022.10.1051/e3sconf/202022404022. 25. Khusnutdinov E Sukhareva A Panfilova M Mikhaylova E Anthocyanin Biosynthesis Genes as Model Genes for Genome Editing in Plants Int J Mol Sci 2021 22 8752 10.3390/ijms22168752 34445458 26. Tamura K Peterson D Peterson N Stecher G Nei M Kumar S MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods Mol Biol Evol 2011 28 2731 2739 10.1093/molbev/msr121 21546353 27. Du H Yang SS Liang Z Feng BR Liu L Huang YB Genome-wide analysis of the MYB transcription factor superfamily in soybean BMC Plant Biol 2012 12 106 10.1186/1471-2229-12-106 22776508 28. Feng S Wang Y Yang S Xu Y Chen X Anthocyanin biosynthesis in pears is regulated by a R2R3-MYB transcription factor PyMYB10 Planta 2010 232 245 255 10.1007/s00425-010-1170-5 20422209 29. Xie M Huang Y Zhang Y Wang X Yang H Yu O Transcriptome profiling of fruit development and maturation in Chinese white pear (Pyrus bretschneideri Rehd) BMC Genomics 2013 14 823 831 10.1186/1471-2164-14-823 24267665 30. An JP An XH Yao JF Wang XN You CX Wang XF Hao YJ BTB protein MdBT2 inhibits anthocyanin and proanthocyanidin biosynthesis by triggering MdMYB9 degradation in apple Tree Physiol 2018 38 1578 1587 10.1093/treephys/tpy063 29897546 31. Schaart JG Dubos C Romero DLI Van Houwelingen AM Vos RC Jonker HH Xu W Routaboul JM Lepiniec L Bovy AG Identification and characterization of MYB-bHLH-WD40 regulatory complexes controlling proanthocyanidin biosynthesis in strawberry (Fragaria ananassa) fruits New Phytol 2013 197 454 467 10.1111/nph.12017 23157553 32. An XH Tian Y Chen KQ Wang XF Hao YJ The apple WD40 protein MdTTG1 interacts with bHLH but not MYB proteins to regulate anthocyanin accumulation J Plant Physiol 2012 169 710 717 10.1016/j.jplph.2012.01.015 22405592 33. Deluc L Barrieu F Marchive C Lauvergeat V Decendit A Richard T Carde JP Mérillon JM Hamdi S Characterization of a grapevine R2R3-MYB transcription factor that regulates the phenylpropanoid pathway Plant Physiol 2006 140 2 499 511 10.1104/pp.105.067231 16384897 34. Takos AM Jaffé FW Jacob SR Bogs J Robinson SP Walker AR Light induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples Plant Physiol 2006 142 3 1216 1232 10.1104/pp.106.088104 17012405 35. Li X Guo C Ahmad S Wang Q Yu J Liu C Guo Y Systematic analysis of myb family genes in potato and their multiple roles in development and stress responses Biomolecules 2019 9 8 317 10.3390/biom9080317 31366107 36. Li Z Peng R Tian Y Han H Xu J Yao Q Genome-wide identification and analysis of the MYB transcription factor superfamily in Solanum lycopersicum Plant Cell Physiol 2016 57 8 1657 1677 10.1093/pcp/pcw091 27279646 37. He Q Jones DC Li W Xie F Ma J Sun R Wang Q Zhu S Zhang B Genome-wide identification of R2R3-MYB genes and expression analyses during abiotic stress in Gossypium raimondii Sci Rep 2016 6 22980 10.1038/srep22980 27009386 38. Stracke R Ishihara H Huep G Barsch A Mehrtens F Niehaus K Weisshaar B Differential regulation of closely related R2R3-MYB transcription factors controls flavonol accumulation in different parts of the Arabidopsis thaliana seedling Plant J 2007 50 4 660 677 10.1111/j.1365-313X.2007.03078.x 17419845 39. Stracke R Holtgräwe D Schneider J Pucker B RosleffSörensen T Weisshaar B Genome-wide identification and characterisation of R2R3-MYB genes in sugar beet (Beta vulgaris) BMC Plant Biology 2014 14 249 10.1186/s12870-014-0249-8 25249410 40. Naik J Rajput R Pucker B Stracke R Pandey A The R2R3-MYB transcription factor MtMYB134 orchestrates flavonol biosynthesis in Medicago truncatula Plant Mol Biol 2021 106 157 172 10.1007/s11103-021-01135-x 33704646 41. Wang N Zheng Y Duan N Zhang Z Ji X Jiang S Comparative transcriptomes analysis of redand white-fleshed apples in an F1 population of Malus sieversii f. niedzwetzkyana crossed with M. domestica “Fuji” PLoS ONE 2015 10 1 20 10.1371/journal.pone.0133468 42. Jin W Wang H Li M Wang J Yang Y Zhang X Yan G Zhang H Liu J Zhang K The R2R3 MYB transcription factor PavMYB10.1 involves in anthocyanin biosynthesis and determines fruit skin colour in sweet cherry (Prunus avium L.) Plant Biotechnol J 2016 14 11 2120 2133 10.1111/pbi.12568 27107393 43. Nesi N Jond C Debeaujon I Caboche M Lepiniec L The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed Plant Cell 2001 13 2099 2114 10.1105/tpc.010098 11549766 44. Wang H Zhang H Yang Y Li M Zhang Y Liu J Dong J Li J Butelli E Xue Z Wang A Wang G Martin C Jin W The control of red colour by a family of MYB transcription factors in octoploid strawberry (Fragaria × ananassa) fruits Plant Biotechnol J 2020 18 5 1169 1184 10.1111/pbi.13282 31647169 45. Zheng X Om K Stanton KA Thomas D Cheng PA Eggert A Simmons E Yuan YW Conradi Smith GD Puzey JR Cooley AM The regulatory network for petal anthocyanin pigmentation is shaped by the MYB5a/NEGAN transcription factor in Mimulus Genetics 2021 217 2 36 10.1093/genetics/iyaa036