==== Front PeerJ PeerJ PeerJ PeerJ 2167-8359 PeerJ Inc. San Diego, USA 15525 10.7717/peerj.15525 Agricultural Science Microbiology Molecular Biology Plant Science Soil Science Disclosing the native blueberry rhizosphere community in Portugal—an integrated metagenomic and isolation approach Gomes Anicia 12 Narciso Rodrigo 12 http://orcid.org/0000-0002-6278-9727 Regalado Laura 12 http://orcid.org/0000-0002-5188-7874 Pinheiro Margarida Cardeano 12 Barros Filipa 12 Sario Sara 12 Santos Conceição 12 http://orcid.org/0000-0001-5212-6172 Mendes Rafael J. 12rafael.mendes@fc.up.pt 1 Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal 2 LAQV-REQUIMTE, Department of Biology, Faculty of Sciences, University of Porto, Porto, Portugal Wang Liang 27 6 2023 2023 11 e155253 3 2023 18 5 2023 © 2023 Gomes et al. 2023 Gomes et al. https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited. Backgorund The production of red fruits, such as blueberry, has been threatened by several stressors from severe periods of drought, nutrient scarcity, phytopathogens, and costs with fertilization programs with adverse consequences. Thus, there is an urgent need to increase this crop’s resilience whilst promoting sustainable agriculture. Plant growth-promoting microorganisms (PGPMs) constitute not only a solution to tackle water and nutrient deficits in soils, but also as a control against phytopathogens and as green compounds for agricultural practices. Methods In this study, a metagenomic approach of the local fungal and bacterial community of the rhizosphere of Vaccinium corymbosum plants was performed. At the same time, both epiphytic and endophytic microorganisms were isolated in order to disclose putative beneficial native organisms. Results Results showed a high relative abundance of Archaeorhizomyces and Serendipita genera in the ITS sequencing, and Bradyrhizobium genus in the 16S sequencing. Diversity analysis disclosed that the fungal community presented a higher inter-sample variability than the bacterial community, and beta-diversity analysis further corroborated this result. Trichoderma spp., Bacillus spp., and Mucor moelleri were isolated from the V. corymbosum plants. Discussion This work revealed a native microbial community capable of establishing mycorrhizal relationships, and with beneficial physiological traits for blueberry production. It was also possible to isolate several naturally-occurring microorganisms that are known to have plant growth-promoting activity and confer tolerance to hydric stress, a serious climate change threat. Future studies should be performed with these isolates to disclose their efficiency in conferring the needed resilience for this and several crops. Vaccinium corymbosum Climate change Alpha and beta diversity Plant growth promoting microorganisms Phytopathogens COMPETE 2020STOP.SUZUKIIPOCI-01-0247-FEDER-047034 Ministério da Ciência e Tecnologia—Fundacão para a Ciência e a TecnologiaUIDB/50006/2020|UIDP/50006/2020 This work was supported by COMPETE 2020, as part of the project STOP.SUZUKII (POCI-01-0247-FEDER-047034), and by Ministério da Ciência e Tecnologia—Fundacão para a Ciência e a Tecnologia through the project financed with reference UIDB/50006/2020|UIDP/50006/2020. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. ==== Body pmcIntroduction Blueberries (Vaccinium sp.) are one of the most important fruit crops in the world, due to their high levels of polyphenols, antioxidants, vitamins, minerals, and fibers (de Souza et al., 2014) that present numerous health benefits as anti-aging compounds, cancer prevention and of several degenerative diseases (de Macêdo et al., 2017; Becker et al., 2019). The high demand for healthier foods coupled with the increasing world population resulted in the expansion of the production of these fruits, with an average annual growth rate of 6.96% worldwide (FAOSTAT, 2023; Knoema, 2023). However, this crop is currently facing a number of challenges associated with climate change, as the global temperature is rising, contributing to longer and warmer summers, more and harsher heat waves, and a decline in rainfall levels, leading to severe drought periods and nutrient scarcity (Lobos & Hancock, 2015; Linares et al., 2020; Smrke et al., 2021). Besides climate issues, blueberry production finds several other obstacles, including high production costs associated with fertilization, weed management, and disease and pest control (Yu et al., 2020). To survive under diverse threatening conditions, plants take advantage of the collaboration with their epiphytic and endophytic microbial communities (Sarma et al., 2015). These multipurpose beneficial communities are generally referred to as plant growth-promoting microorganisms (PGPMs) and support plants in water use, nutrient uptakes such as phosphorus and nitrogen, and the breaking down of minerals and organic matter (Kumar, Patel & Meena, 2018). They also compete for nutrients and produce antibiotics and lytic enzymes to prevent the development of pathogens (Sattiraju et al., 2019). On the other hand, plants secrete up to 40% of their photosynthesis products into the soil, supplying carbon to the microbiome population in the rhizosphere (Berendsen, Pieterse & Bakker, 2012). A well-characterized group of PGPMs are fungi belonging to the Trichoderma genus. These microorganisms are a naturally occurring green strategy that plays a significant role in interacting with the plant’s root system to boost growth and nutritional quality while producing secondary metabolites that influence pathogenic defense either directly as antibiotics or indirectly by eliciting the plant defense mechanisms against different pathogens (Vinale & Sivasithamparam, 2020). For instance, the up-regulation of defense-related pathways increases the expression of volatile organic compounds (VOCs), namely jasmonic acid and ethylene, that trigger induced systemic resistance, or salicylic acid, driving wound repair and systemic acquired resistance (Ferreira & Musumeci, 2021). Currently, one of the most important challenges of environmental sustainability is to meet the needs of a rapidly growing human population; however, cultivable land is limited, so it is paramount to adopt appropriate agrobiotechnological measures to maximize food production while minimizing pollution and remediating contaminated soil (Abhilash et al., 2016). To this end, promoting native microorganisms’ growth is essential to strengthening the plants’ resilience to a multitude of abiotic and biotic challenges. Nowadays, profiling microbial samples from the soil is drastically facilitated by the development of novel metagenomic tools that surpass traditional approaches, avoiding the ineffective culturing step. In fact, the cultivation and isolation of microorganisms provide very limited results, as only around 1% of the soil microbiome is culturable, remaining the majority unexplored. Fortunately, metagenomics emerged as a driving force to survey the biodiversity of microbial communities (Daniel, 2005; Wolińska, 2019). In Portugal, blueberry production has increased considerably in the last years, placing the country in the top 10 of the world’s biggest producers, with an estimated annual growth of 31.27% (FAOSTAT, 2023; Knoema, 2023), significantly impacting Portuguese agriculture and economy (Hilário et al., 2020). However, to date, only a single study in Portugal has dwelled on the microbial communities associated with the rhizosphere of blueberry plants, being this study focused only on the bacterial community (Gonçalves et al., 2022). Despite the previous existence of studies that seek to know the community of microorganisms in blueberry plants, it is of great necessity to know both bacterial and fungi communities present in a native form. In this way, this knowledge will be meaningful to disclose more specific strategies to improve local blueberry production, taking the most out of the indigenous nature attributes, and avoiding the need for agrochemicals that degrade soil quality and the desired fruit. Therefore, and in the frame of the European Green Deal, with special emphasis on the Farm to Fork strategy, this work aimed to characterize the local rhizosphere-colonizing microbiome from blueberry plants in a biological orchard in the Douro region of Portugal. In order to achieve this, we resort to metagenomic sequencing of bacterial 16S and fungal ITS regions, and at the same time, isolation and identification, through molecular characterization, of the native mycorrhiza rhizobium. This allowed the establishment of a first report on the total profiling of the native community of blueberries’ rhizosphere in Portugal and the assessment of the putative presence of key native PGPMs. Materials and Methods Sample selection and collection For rhizosphere characterization, root, and soil samples from 6-year-old Blueberry plants, namely, Vaccinium corymbosum ‘Brigitta’ variety, grown under appropriate soil conditions, biological agricultural practices, and without the presence of other plant species, were collected in the Enxertada Indie Farmers production (Resende, 41°07′13.4″N 7°53′17.8″W) in October 2021. The ‘Brigitta’ variety was selected due to its high commercial value and belongs to the Northern highbush blueberry groups that are representative of the blueberry production in the north and center of Portugal, including in the sampling region. For root samples, roots with arbuscular morphology of V. corymbosum plants were selected; for soil samples, soil containing arbuscular roots with a depth of 5 cm was collected. A total of 10 V. corymbosum plants were randomly chosen and one soil sample per plant was collected (n = 10) (R1 to R10), to characterize the representative bacterial and fungal microorganisms’ populations at the site. The soil was placed in sterile bags and transported to the laboratory, and stored at −80 °C for further processing. For the root samples, another nine V. corymbosum plants were randomly chosen and the samples were collected in duplicate per plant (n = 9). The roots were also placed in sterile bags, and transported to the laboratory to be processed within 24 h of collection, for isolation of epiphytic and endophytic fungi and bacteria. Field sampling was approved by Enxertada Indie Farmers under the project STOP.SUZUKII. ITS and 16S amplicon metagenomic sequencing of V. corymbosum rhizosphere Genomic DNA from soil for metagenomic analysis was obtained. For the ten soil samples, the Soil DNA Purification Kit (EURx®, Gdansk, Poland) was used following the manufacturer’s instructions with a slight modification, namely, the Bead Tube containing 100 mg of sample was first snapfrozen in liquid nitrogen. DNA quality and quantity from every sample were carried out resorting to LVis Plate and the FLUOstar® Omega Multiplate reader (BMG, LABTECH, Ortenberg, Germany). To characterize the rhizobiome of the rhizosphere of V. corymbosum plants, amplicon metagenomic sequencing of the internal transcribed spacer (ITS) rRNA of the ITS1 region and 16S ribosomal RNA (rRNA) of the V3-V4 region was carried out on the DNA soil samples, at Novogene Europe (Novogene Co., Cambridge, UK). Briefly, after passing the quality control (QC), and amplification of the ITS and 16S regions, library construction was made with the amplicons (one library per sample). Sequencing by synthesis (SBS) technology was used resorting to the Illumina NovaSeq 6000 platform (Illumina®, San Diego, CA, USA) to generate 250 bp paired-end raw reads, and once sequencing was completed, QC and bioinformatics analysis were conducted. Metagenomic data analysis For the metagenomic ITS and 16S amplicon sequencing analysis, the pipeline outsourced by Novogene was followed. After assessing the sequencing coverage and quality, Qiime (V1.7.0) and Uparse software (Uparse v7.0.1090) were used to identify the total tags obtained and operational taxonomic units (OTUs). Then, the top 10 highest abundant fungal and bacterial genus of V. corymbosum rhizosphere were obtained (R1 to R10), alongside the phylum relative abundance, resorting to blastall (Version 2.2.25) and Unite (V8.2) database. An evolutionary tree of the top 100 genera, and a phylogenetic tree of the top 10 genera identified in every sample were created using MUSCLE (Version 3.8.31). Also, alpha-diversity analysis for each sample was performed through diversity indexes (Shannon and Simpson) and richness indexes (Chao1 and ACE), and Venn diagrams to disclose the core microbiota, whilst, for beta-diversity analysis between the samples, a non-metric multidimensional scaling (NMDS) was applied. QIIME (Version 1.7.0) was used for both alpha and beta diversity analysis, and results were displayed with R software (Version 2.15.3; R Core Team, 2013). Isolation of endophytic and epiphytic microorganisms To isolate epiphytic and endophytic fungi and bacteria, root samples were processed in two different ways. Healthy root segments were cut into various 3–5 cm segments. One segment was placed directly on potato dextrose agar (PDA) medium (27 g of potato dextrose broth; 1.5% Agar; distilled water up to 1 L) supplemented with 50 mM kanamycin, to isolate epiphytic fungi, whilst for epiphytic bacteria, two different segments were placed directly on Luria Bertani (LB) medium (37 g of LB broth; 1.5% Agar; distilled water up to 1 L) and brain heart infusion (BHI) medium (20 g of BHI broth; 1.5% Agar; distilled water up to 1 L). For endophytic microorganisms, the segments were washed in sterile dH2O and then went through a disinfection process consisting of 1-min washes each in 10% bleach, followed by 70% ethanol (EtOH) and 5 consecutive washes with sterile dH2O. After drying, the root samples were also placed on PDA supplemented with 50 mM kanamycin, to isolate fungi, and for bacteria, two segments were placed on LB and BHI mediums, (one segment each). Plates were then incubated at 25 °C for 5–7 days and at room temperature for 2–3 days, for fungal and bacterial growth respectively. PDA medium was supplemented with an antibiotic to prevent the growth of bacteria during fungi isolation (Vohník, 2020). Morphologically different fungal and bacterial colonies were purified on new plates containing PDA medium and LB or BHI medium respectively, followed by incubation at 25 °C for 7 days and at room temperature for 2 days, respectively. In the end, a visual assessment was conducted to determine the morphological characteristics of the isolated fungi and bacteria. A photographic record was also performed. Fungal and bacterial isolates were stored in potato dextrose broth (PDB) and LB at −80 °C in 60% and 30% glycerol, respectively. Fungal and bacterial DNA extraction, amplification and sequencing For genomic DNA extraction, the Plant & Fungi DNA Purification Kit (EURx®, Gdansk, Poland) was used for the 63 fungal isolates following the manufacturer’s instruction, with 100 mg of fresh fungal tissue. For the 59 bacterial isolates, the Bacterial & Yeast Genomic DNA Purification Kit (EURx®, Gdansk, Poland) was used following the manufacturer’s instructions. DNA quality and quantity from every bacterial and fungal sample were carried out resorting to LVis Plate and the FLUOstar® Omega Multiplate reader (BMG, LABTECH, Ortenberg, Germany). Endophytic and epiphytic fungal and bacterial isolates were identified by Sanger sequencing of the ITS and 16S partial region, respectively. To achieve that, a polymerase chain reaction (PCR) was carried out using a reaction mixture containing 1x Taq Master Mix (Bioron, Römerberg Germany), 1 μM of primers (listed in Table 1), and 1 ng of DNA template. The PCR cycle parameters were 2–5 min at 94 °C, followed by 25 cycles of 94 °C for 25 s, 49 °C or 55 °C (ITS, and 16S respectively) for 30 s, 72 °C for 50 s, and a final extension at 72 °C for 3 min. PCR amplicons were assessed by electrophoresis in a 1% agarose gel stained with GreenSafe Premium (NZYTech©, Lisboa, Portugal), at a constant voltage (120V) in 1x TBE buffer, and purified using the NZYGelpure Kit (NZYTech©, Lisboa, Portugal) following the manufacturer’s instructions. Sequencing was outsourced to STAB Vida (Lisbon, Portugal). 10.7717/peerj.15525/table-1 Table 1 Primers used for ITS and 16S rRNA Sanger sequencing. Primer 5′ -> 3′ sequence Reference ITS ITS1 TCCGTAGGTGAACCTGCGG White et al. (1990) ITS4 TCCTCCGCTTATTGATATGC White et al. (1990) 16S rRNA 27F AGAGTTTGATCCTGGCTCAG Lane (1991) 1492R GGTTACCTTGTTACGACTT Lane (1991) Culturable fungal and bacterial identification To confirm the identity of the fungal and bacterial isolates, raw sequences of the Sanger sequencing of the ITS and 16S regions were assembled with Geneious Prime 2022.1 (Biomatters, Auckland, New Zealand), and then assessed by BLASTn for existing homology in the GenBank database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Isolates’ identity was determined after assessing the query cover, E-value, and percentage of identity obtained. Results Metagenomic data analysis Illumina-sequencing of ITS amplicons produced 1,787,299 raw reads, that after qualification and removal of chimeras produced 1,293,940 effective tags, from which 556 OTUs were identified with an average length of 265 nt, and 97.98% Q20 score. Sequencing of 16S amplicons produced 1,800,579 raw reads, that after qualification and removal of chimeras produced 907 824 effective tags, from which 3,625 OTUs were identified with an average length of 413 nt and 98.24% Q20 score (Table 2). The fungal and bacterial communities associated with the rhizosphere of V. corymbosum from Enxertada Indie Farmers production are depicted in Figs. 1 and 2 (fungi), and Figs. 3 and 4 (bacteria) by an evolutionary tree of the 100 most abundant genera and top 10 most abundant genera in each sample. Among the fungal community, the Ascomycota (75.47%) and Basidiomycota (24.53%) were the most prevalently identified phyla (Fig. S1), while the bacterial community was dominated by Acidobacteriota (41.88%), Proteobacteria (29.48%) and Actinobacteria (15.06%) phyla (Fig. S2). 10.7717/peerj.15525/table-2 Table 2 Sequencing data and quality of ITS and 16S rRNA sequencing. Single, total and mean number of raw paired-end reads (raw reads), tags merged from reads (raw tags), cleaned and filtered tags (clean tags and effective tags) and operational taxonomic units (OTUs). Percentage of yielded effective tags in relation to produced raw reads. Single and mean number of sequenced effective tags nucleotides (base) and their average length. Single and mean percentage of Q20 and Q30 scores and GC content of effective tags. Soil sample Raw reads Raw tags Clean tags Effective tags Effective tags (%) OTUs Base (nt) Average length (nt) Q20 (%) Q30 (%) GC content (%) ITS R1 155,590 134,367 121,460 120,129 77.21% 425 32,349,810 269 98.6 96.56 55.01 R2 184,863 162,014 122,527 121,987 65.99% 282 36,837,738 302 96.97 92.77 54.85 R3 171,154 155,678 131,205 130,046 75.98% 215 39,584,999 304 96.62 92.04 54.51 R4 182,557 157,156 109,792 109,178 59.80% 417 32,475,292 297 97.52 93.89 51.19 R5 170,089 161,707 149,993 149,260 87.75% 330 42,733,120 286 99.15 97.32 54.99 R6 146,530 110,773 92,765 90,347 61.66% 598 23,273,395 258 98.22 96.05 50.33 R7 194,018 134,255 121,547 115,467 59.51% 1,217 29,139,615 252 99.07 97.49 53.93 R8 185,367 142,641 142,450 140,579 75.84% 979 32,195,048 229 97.54 95.85 50.62 R9 197,154 157,997 157,911 157,324 79.80% 435 35,314,304 224 97.82 95.21 51.12 R10 199,977 164,373 160,783 159,623 79.82% 657 37,195,561 233 98.29 96.42 52.92 Mean 178,730 148,096 131,043 129,394 72.34% 556 34,109,888 265 97.98 95.36 52.95 Total 1,787,299 1,480,961 1,310,433 1,293,940 5,555 16S rRNA R1 170,688 159,243 156,519 86,747 50.82% 2,929 35,846,478 413 98.36 94.59 56.60 R2 183,187 168,332 165,057 93,749 51.18% 3,681 38,746,901 413 98.27 94.43 56.91 R3 188,628 172,749 169,282 99,543 52.77% 3,523 41,086,071 413 98.24 94.43 57.29 R4 181,437 167,544 164,431 90,597 49.93% 3,830 37,408,294 413 98.25 94.43 57.00 R5 172,924 160,906 158,029 84,100 48.63% 3,202 34,730,044 413 98.28 94.44 56.28 R6 187,731 173,025 169,585 96,238 51.26% 3,687 39,763,304 413 98.22 94.32 57.08 R7 174,883 160,798 157,893 83,548 47.77% 3,814 34,532,604 413 98.23 94.24 57.05 R8 178,887 164,797 161,674 90,725 50.72% 3,864 37,459,285 413 98.22 94.29 57.10 R9 173,178 157,647 154,428 89,798 51.85% 4,024 37,162,831 414 98.11 93.99 57.08 R10 189,036 173,832 170,324 92,779 49.08% 3,699 38,309,489 413 98.17 94.17 57.12 Mean 180,058 165,887 162,722 90,782 50.40% 3,625 34,378,830 413 98.24 94.33 56.95 Total 1,800,579 1,658,873 1,627,222 907,824 36,253 10.7717/peerj.15525/fig-1 Figure 1 Evolutionary tree of the 100 most abundant genera of fungi across the different samples. Each bar represents the relative abundance of the genus in each sample. Each color of the branches corresponds to one phylum. 10.7717/peerj.15525/fig-2 Figure 2 Relative abundance of the top 10 most abundant genera identified by ITS sequencing in each sample. 10.7717/peerj.15525/fig-3 Figure 3 Relative abundance of the top 10 most abundant genera identified by 16S sequencing in each sample. 10.7717/peerj.15525/fig-4 Figure 4 Evolutionary tree of the 100 most abundant genera of fungi across the different samples. Each bar represents the relative abundance of the genus in each sample. Each color of the branches corresponds to one phylum. Among the top 100 most abundant genera of fungi in the analyzed samples, Archaeorhizomyces (31.49%), Serendipita (16.52%), Atractospora (15.26%), and Penicillium (7.57%) genera stood out as the most abundant genera among the total generated OTUs (Fig. 1). However, it is noticeable that Serendipita and Penicillium abundance was more homogenous across samples (Figs. 1 and 2). Despite less predominance among the whole fungal community, some particular genera dominated singular samples: Galerina (21.02% in R4) and Pezoloma (20.22% in R6) (Fig. 2). The bacterial community composition of the collected samples disclosed more homogenous results as the 10 most abundant genera of bacteria represented only between 20.75% and 30.66% of the sample community (Fig. 3). Several genera were predominant across all samples, such as Subgroup_2 (7.58%), Bradyrhizobium (7.32%), Acidothermus (6.29%), Candidatus Solibacter (5.11%), Bryobacter (4.72%) and Acidibacter (3.61%) (Fig. 4). Alpha-diversity and beta-diversity of microbial communities The richness (Chao1 and ACE indices) and diversity (Shannon and Simpson indices) of the communities were evaluated. As disclosed by the relative abundances of genera, analyzed samples showed a heterogenous diversity and richness of the fungal community, with Shannon and Simpson indices revealing a 30.19% and 23.81% coefficient of variation, while Chao1 and ACE indices displayed a 58.67% and 57.35% coefficient of variation (Table 3). Meanwhile, the bacterial communities disclosed very little variation of diversity and richness between samples, with the Shannon and Simpson indices presenting a 3.02% and 0.16% coefficient of variation whereas Chao1 and ACE indices presented a 9.65% and 9.40% coefficient of variation (Table 3). 10.7717/peerj.15525/table-3 Table 3 Alpha diversity indexes of the fungal and bacterial communities of each sample. Diversity indexes (Shannon and Simpson) and richness indexes (Chao1 and ACE) with respective mean, standard deviation (Stand. Dev.) and coefficient of variation (Coeff. Variation). Soil sample Observed species Shannon Simpson Chao1 ACE ITS R1 371 3.28 0.73 438.65 461.98 R2 265 3.20 0.76 282.22 282.48 R3 180 2.82 0.69 206.86 225.23 R4 362 3.38 0.82 403.89 405.32 R5 279 1.32 0.28 337.16 349.08 R6 598 4.06 0.87 832.18 737.55 R7 1,161 5.32 0.88 1,247.03 1,274.72 R8 910 4.49 0.78 1,167.67 1,138.07 R9 374 3.38 0.84 473.32 494.28 R10 579 4.07 0.85 713.27 757.82 Mean 3.55 0.74 625.44 625.80 Stand. Dev. 1.07 0.18 366.93 358.91 Coeff. Variation 30.19% 23.81% 58.67% 57.35% 16S R1 2,698 9.07 0.99 2,878.98 2,917.65 R2 3,365 9.29 0.99 3,723.17 3,746.40 R3 3,168 9.19 0.99 3,516.07 3,573.15 R4 3,534 9.64 1.00 3,861.02 3,910.73 R5 2,913 9.08 0.99 3,169.96 3,215.31 R6 3,342 9.48 1.00 3,606.90 3,685.56 R7 3,489 9.74 1.00 3,865.35 3,793.94 R8 3,549 9.65 1.00 3,818.78 3,902.55 R9 3,698 9.79 1.00 3,987.78 4,017.09 R10 3,397 9.75 1.00 3,664.03 3,726.39 Mean 9.43 0.99 3,567.14 3,607.96 Stand. Dev. 0.28 0 344.34 339.09 Coeff. Variation 3.02% 0.16% 9.65% 9.40% To further complement the analysis of inter-sample diversity, a multivariate analysis by non-linear multidimensional scaling (NMDS) was performed. The results showed a general dissimilarity between all fungal communities (Fig. 5), disclosing no correlation between any sample. On the other hand, the bacterial communities associated were shown to be generally more closely related to each other, especially R6, R7, R8, R9, and R10 samples, which grouped in the upper-right quadrant (Fig. 6). 10.7717/peerj.15525/fig-5 Figure 5 Multivariate analysis of the fungal communities of each soil sample by non-linear multidimensional scaling (NMDS) to evaluate the dissimilarity between each associated community. 10.7717/peerj.15525/fig-6 Figure 6 Multivariate analysis of the bacterial communities of each soil sample by non-linear multidimensional scaling (NMDS) to evaluate the dissimilarity between each associated community. Core microbiota of rhizosphere samples The alpha diversity of the fungal and bacterial communities was also analyzed regarding the common OTUs between samples. Although unique OTUs were found in every sample, there were 20 common OTUs on fungi identification (Fig. 7A). Trichoderma and Serendipita genera were the most abundant genera among the core fungi with three OTUs each (Table S1). Moreover, the bacterial community revealed a set of 1,152 common OTUs (Fig. 7B). The genera Bryobacter (27 OTUs), Subgroup_2 (26 OTUs), IMCC26256 (23 OTUs), Candidatus_Solibacter (21 OTUs), MB-A2-108 (21 OTUs), Haliangium (19 OTUs), 67-14 (17 OTUs) and Acidothermus (17 OTUs), were frequently encountered among this set (Table S2). 10.7717/peerj.15525/fig-7 Figure 7 Venn diagram of the common operational taxonomic units (OTUs) of the ITS (A) and 16S (B) metabarcoding. Each petal in the flower diagram represents for a sample or group, with different colors for different samples. The core number in the center is for the number of OTUs present in all samples, while number in the petals for the unique OTUs only showing in each sample. Identification of isolated fungal and bacterial communities from the rhizosphere The isolation of endophytic and epiphytic microorganisms yielded a total of 167 fungal and 288 bacterial isolates from the nine root samples collected. Of this total, after assessing each one for different morphological characteristics, isolates were grouped together resulting in 63 fungi and 59 bacteria isolates (Tables S3 and S4). From these, 20 endophytic and 18 epiphytic unique fungi and nine endophytic and 18 epiphytic unique bacteria were identified by BLASTn (Table 4). A list of identification results of endophytic and epiphytic fungi and bacteria isolates with their E-value, query cover, and identity were summarized in Tables S1 and S2. 10.7717/peerj.15525/table-4 Table 4 List of isolated endophytic and epiphytic fungi and bacteria. Code Type Species Code Type Species ITS F1 Endophytic Diaporthe columnaris 16S rRNA B1 Endophytic Bacillus sp. F2 Diaporthe sp. B2 Enterobacter sp. F3 Fusarium diaminii B3 Erwinia billingiae F4 Fusarium oxysporum B4 Lysinibacillus sp. F5 Fusarium sp. B5 Micrococcus sp. F6 Mucor moelleri B6 Paenibacillus sp. F7 Penicillium adametzii B7 Pantoea sp. F8 Phomopsis sp. B8 Priestia sp. F9 Rosellinia necatrix B9 Pseudomonas sp. F10 Sclerotium glucanicum B10 Epiphytic Acinetobacter sp. F11 Setophoma terrestris B11 Bacillus thurigiensis F12 Trametes villosa B12 Bacillus sp. F13 Trichoderma atroviride B13 Chryseobacterium sp. F14 Trichoderma hamatum B14 Citrobacter sp. F15 Trichoderma harzianum B15 Klebsiella sp. F16 Trichoderma koningii B16 Leclercia sp. F17 Trichoderma longibrachiatum B17 Leifsonia sp. F18 Trichoderma spirale B18 Lelliottia amnigena F19 Trichoderma virens B19 Lysinibacillus sp. F20 Trichoderma sp. B20 Micrococcus sp. F21 Epiphytic Cunninghamella elegans B21 Paenibacillus sp. F22 Diaporthe columnaris B22 Pantoea sp. F23 Fusarium oxysporum B23 Priestia megaterium F24 Macrophomina phaseolina B24 Priestia sp. F25 Mucor moelleri B25 Pseudomonas sp. F26 Oidiodendron maius B26 Staphylococcus sp. F27 Penicillium paraherquei B27 Stenotrophomonas sp. F28 Phomopsis columnaris F29 Phomopsis sp. F30 Trichoderma asperellum F31 Trichoderma atroviride F32 Trichoderma citrinoviride F33 Trichoderma crassum F34 Trichoderma gamsii F35 Trichoderma hamatum F36 Trichoderma spirale F37 Trichoderma sulphureum F38 Trichoderma sp. Regarding the fungal community, different species of the Trichoderma genus were identified (Trichoderma asperellum, T. atroviride, T. citrinoviride, T. crissum, T. gamsii, T. hamatum, T. harzianum, T. koningii, T. longibrachiatum, T. spirale, T. sulphureum, T. virens,), both endophytically and epiphytically. Furthermore, other genera were identified: Cunninghamella, Diaporthe, Fusarium, Macrophomina, Mucor, Oidiodendron, Penicillium, Phomopsis, Rosellinia, Sclerotium, Setophoma and Trametes. Several bacterial genera were identified, comprising Acinetobacter, Bacillus, Chryseobacterium, Citrobacter, Enterobacter, Erwinia, Klebsiella, Leclercia, Leifsonia, Lelliottia, Lysinibacillus, Micrococcus, Paenibacillus, Pantoea, Priestia, Pseudomonas, Staphylococcus and Stenotrophomonas. Among the identified genera, Trichoderma (49.20%), Fusarium (14.28%), and Phomopsis (11.1%) were the most prevalent fungi, followed by Diaporthe (6.34%), Mucor (4.76%) and Penicillium (3.17%), whilst for bacteria, the most prevalent were Bacillus (27.12%), followed by Priestia (16.95%), Lysinibacillus (13.56%), Pseudomonas (10.17%), Pantoea (5.08%), Paenibacillus (3.39%), Micrococcus (3.39%), and Klebsiella (3.39%). Discussion Blueberry production has been facing several challenges in the form of drought and nutrient scarcity due to the ongoing climate change, the unregulated application of chemical fertilizers, and diseases caused by several pathogens (Tournas & Katsoudas, 2005; Guo et al., 2021a; Jiang et al., 2022; Zhang, Liu & Zhang, 2022; Zhao et al., 2022). Thus, an urgent strategy to tackle these issues, whilst following the call for sustainable agriculture as proposed by the European Green Deal is in serious need. To answer this call, several microorganisms, from plant growth-promoting bacteria to antagonistic microorganisms and mycorrhizal fungi have been extensively explored as a solution (Redman et al., 2021; Acuña-Rodríguez et al., 2022; Bello et al., 2022; Wei et al., 2022). With this in mind, the characterization of the native fungal and bacterial community structure of the rhizosphere of V. corymbosum ‘Brigitta’ could disclose several microorganisms that could be explored as agents to improve the resilience of the plants, promote plant growth and development, and pose as a second key player against plant diseases. In this study, the Ascomycota and Basidiomycota phyla expectedly dominated the fungal communities. There have been previous reports of the high predominance of these groups associated with the rhizosphere of not only Vaccinium spp. (Li et al., 2020; Dong et al., 2022; Zhou et al., 2022), but other crop and non-crop plants as well (Fuentes et al., 2020; Cheng et al., 2022; Liu et al., 2022). This is easily explained as these phyla encompass a plethora of plant-associated microbes, such as mycorrhizal fungi, saprophytic organisms, and plant pathogens (Berbee, 2001; Hannula et al., 2012). Serendipita and Peniccilium were two of the most abundant genera distributed across all or most of the collected samples. Serendipita spp., such as Serendipita indica or S. vermifera, have been previously described as mycorrhizal endophytic fungi of several plants, which confer protection towards infection, detoxification of xenobiotics, tolerance to hydric and mechanical stress, enhancement of plant and root growth and modification of soil physicochemical properties (Sun et al., 2014; Hosseini, Mosaddeghi & Dexter, 2017; Sarkar et al., 2019; Hosseini & Mosaddeghi, 2021; Wang et al., 2022). Moreover, Trzewik, Marasek-Ciolakowska & Orlikowska (2020) reported protective behavior of S. indica towards infection by the phytopathogen Phytophthora cinnamomic in V. corymbosum, extending the beneficial interaction of Serendipita spp. with blueberry plants (Trzewik, Marasek-Ciolakowska & Orlikowska, 2020). On the other hand, Penicillium spp. are common soil colonizers due to their key role in phosphorous cycling, an important macronutrient, as they are able to solubilize it for plant uptake (Wakelin et al., 2004; Pandey et al., 2008; Sharma et al., 2013; de Oliveira Mendes et al., 2014). In fact, the application of Penicillium spp., as biofertilizers is already commercially available (Richardson et al., 2009). The particular association of this genus with V. corymbosum has also been reported and co-inoculation of mycorrhizal fungi and Penicillium chrysosporium has been shown to promote the growth of blueberry plants in early stages (Arriagada et al., 2012; Pescie et al., 2021). Other genera were found to be prominent in singular or few of the collected samples, namely the Archaeorhizomyces, Atractospora, and Pezoloma genera. Despite scarce information about the Archaeorhizomyces genus, it is known to ubiquitously colonize soil samples (Rosling et al., 2011). However, the nature of its relationship with the plant and other mycorrhizal fungi still remains unknown (Choma et al., 2016; Cruz-Paredes et al., 2019). Nevertheless, association with Vaccinium spp. has been previously reported (Li et al., 2020; Rodriguez-Mena et al., 2022). The Atractospora genus is mainly characterized as saprophytic, associated with submerged wood in freshwater (Réblová, Fournier & Štěpánek, 2016). Atractospora spp. have been previously identified in different soil samples (Xie et al., 2019a; Shen et al., 2020; Lemmel et al., 2021), yet plant-fungus relationships have not been dwelled on. Ericoid mycorrhizal fungi (EMF) interact closely with Ericaceae plants, in which Vaccinium spp. are included, establishing mutualistic relationships characterized by the exchange of carbon, nitrogen, and phosphorous compounds (Read, Leake & Perez-Moreno, 2011; Leopold, 2016). Pezoloma is a known genus of EMF and was the most abundant genus in the R6 sample. Although this was not a ubiquitously present genus in our samples, it has been previously described as part of the core rhizobiome of different Vaccinium spp. (Li et al., 2020). Additionally, other EMF have been identified in our samples, namely, the genera Oidiodendron, which has been previously associated with conferring zinc tolerance (Vallino et al., 2009; Khouja et al., 2013; Chiapello, Martino & Perotto, 2015) and Hyaloscypha (Leopold, 2016; Fehrer et al., 2019; Wei & Chen, 2022). The Alternaria genus was also part of the rhizobiome of several of the analyzed samples. This genus is composed of both saprophytic and pathogenic species by producing host-selective toxins responsible for tissue necrosis (Thomma, 2003). Alternaria atenuata and A. tenuissima have already been reported to have caused leaf spot diseases in V. corymbosum in different countries (Kwon et al., 2014; You et al., 2014; Nadziakiewicz et al., 2018). Identification of phytopathogenic microorganisms is of great importance to better establish control plans (Hanson et al., 2000). Gathering these observations, we conclude that the identified genera that compose the rhizobiome structure of the collected samples were overall expected as they compose both ubiquitous and mutualistic organisms of V. corymbosum. Moreover, the predominance of the Acidobacteria, Proteobacteria, and Actinobacteria phyla regarding the bacterial communities also comes with no surprise as previous reports have stated the abundance of these groups, not only in rhizosphere soils of several plants (Fuentes et al., 2020; Cheng et al., 2022), but in Vaccinium spp. in particular (Li et al., 2020; Gonçalves et al., 2022; Rodriguez-Mena et al., 2022). The presence of Acidobacteria seems to be dependent on the soil pH conditions and, in general, acidic soils seem to favor the growth of these bacteria (Sait, Davis & Janssen, 2006; Rousk et al., 2010; Darnell & Cruz-Huerta, 2011). However, this correlation is also dependent on the subgroups of this phylum (Sait, Davis & Janssen, 2006; Rousk et al., 2010). In our study, Bryobacter, Subgroup_2, and Candidatus Solibacter were three of the most dominant genera regarding the overall bacterial composition of our samples, belonging to subgroup 1, 2, and 3 of Acidobacteria. This is in accordance with the required acidity to grow blueberry plants, which has been proposed to not surpass pH 6 as it causes nutrient uptake deficiency (Darnell & Cruz-Huerta, 2011). Moreover, some species of several subgroups of Acidobacteria have been shown to play an important role in nutrient-deficient soils and inhospitable habitats (Rawat et al., 2012). Bradyrhizobium and Acidibacter were the most dominant genera in the Proteobacteria phylum. Inoculation of Bradyrhizobium spp. has been proven to have a positive impact on the growth of some legumes due to their nitrogen-fixing capacity (Elsheikh & Ibrahim, 1999; Egamberdiyeva, Qarshieva & Davranov, 2004; Bedmar, Robles & Delgado, 2005; Badawi, Biomy & Desoky, 2011; Delamuta et al., 2015). Nonetheless, this is not the first time this genus was identified as one of the most abundant genera associated with the rhizosphere of Vaccinium spp. and, simultaneously, with higher nitrogen content in blueberry plants (Morvan et al., 2020). The Acidibacter genus, similar to the Actinobacteria genus Acidothermus has been already reported as one of the most abundant genera of Vaccinium spp. rhizobiome (Chen et al., 2019; Guo et al., 2021b; Rodriguez-Mena et al., 2022; Wang, Sun & Xu, 2022). The relevance of these genera is stressed in previous reports that prove that their relative abundance has been shown to be modulated according to the soil nutrient availability, namely upon application of fertilizers, suggesting this group is an indicator of soil properties (Fu et al., 2021; Ren et al., 2021). Our results reveal the presence of bacterial taxa common in blueberry plants’ rhizosphere, simultaneously reflecting the physicochemical properties of the soil, which are important modulators of bacterial ecology (Li et al., 2017; Tiquia et al., 2002; Zhang et al., 2017). Despite showing expected fungal and bacterial taxa, our analysis revealed an increased heterogeneity among the fungal communities across the different samples. The alpha diversity analysis proves that both diversity and richness indices disclose a higher variation than the bacterial communities. Corroborating these data, the beta diversity analysis by NMDS clustered the samples according to the 16S sequencing, while no correlation between samples was found according to the ITS sequencing. This observation may be justified by a higher sensitivity by fungi upon soil properties’ shifts, namely water, nitrogen, and carbon content (He et al., 2017; Kaisermann et al., 2015; Wang et al., 2019). Furthermore, fungi and plant, namely arbuscular mycorrhizal fungi, establish spatial, physiological, and plant attributes-dependent structures, which contribute to variation in the identified community even in samples from the same root system (Deveautour et al., 2021; Mummey & Rillig, 2008; Powell & Bennett, 2016). The core rhizobiome was another parameter of great importance as it aided in a better characterization of the ubiquitous microorganisms of the analyzed rhizosphere. Serendipita genus was one of the dominant genera among the common OTUs identified in our samples, which is not surprising considering its aforementioned mycorrhizal characteristics. Moreover, although not showing a particularly noticeable predominance, the Trichoderma genus, part of the Ascomycota phylum, was present in all our samples. These common soil colonizers have been thoroughly studied regarding their beneficial interaction with plants, particularly their significant impact on competing with phytopathogens and exchange of metabolites which can induce physiological changes in the plant and alter fruit quality (Lombardi et al., 2020; de Sousa et al., 2020; Vitti et al., 2016). Their antimicrobial and mycoparasitic characteristics have been extensively reviewed and have important biotechnological applications in agriculture for phytopathogens control (Alfiky & Weisskopf, 2021; Harman et al., 2004; Reithner et al., 2011). Thus, the presence of Trichoderma spp. is desired as they are naturally occurring phytopathogenic-competing microbes (Kamble et al., 2021; Xu et al., 2022). Apart from the previously mentioned taxa Bryobacter, Subgroup_2, Candidatus Solibacter, and Acidothermus, other bacterial genera stood out among the common OTUs, namely IMCC26256, MB-A2-108, 67-14, all belonging to the Actinobacteria phylum and Haliangium, a Proteobacteria. Contrarily to the fungal communities, many more bacterial OTUs were common to all samples (20 ITS OTUs vs 1,152 16S rRNA OTUs), suggesting a much more stable bacterial community of the analyzed soils. The application of microorganisms as a biotechnological alternative to climate change effects mitigation in plant growth, and the relevance of the rhizosphere have been the subject of extensive study and review (Alshaal et al., 2017; Drigo, Kowalchuk & van Veen, 2008; Hakim et al., 2021; Naamala & Smith, 2020; Rodriguez & Durán, 2020). Following this demand, this study also aimed to isolate naturally occurring microorganisms with plant growth-promoting potential. Even though assessment of plant growth-promoting activity in blueberry plants is scarce, several of the identified fungi and bacteria belong to taxa that have been previously identified as potential PGPM and its use as biofertilizers have been proposed (Casarrubia et al., 2020; de Silva et al., 2000; Ważny et al., 2022). Moreover, some of them have also been revealed to enhance tolerance to heavy metals, salinity, and water stress, particularly, fungi from the Phomopsis, Oidiodendron, Trametes, Trichoderma, and Diaporthe genera (da Silva Santos et al., 2022; Lombardi et al., 2020; Malik et al., 2020; Ważny et al., 2022; Xie et al., 2019b) and bacteria from the Bacillus, Enterobacter, Lysinibacillus, Micrococcus, Pantoea, Paenibacillus, Priestia, Pseudomonas, Acinetobacter, Chryseobacterium, Citrobacter, Klebsiella, Leclercia, Leifsonia, Staphylococcus and Stenotrophomonas genera (Afrasayab, Faisal & Hasnain, 2010; Ajmal et al., 2022; Alexander et al., 2019; Chhetri et al., 2022; Dubey et al., 2021; Gupta et al., 2019; Khan et al., 2020; Kour et al., 2020; Nascimento et al., 2020; Naureen et al., 2017; Nordstedt et al., 2021; Rana et al., 2020; Sansinenea, 2019; Snak et al., 2021). From the species of fungi identified, Mucor moelleri, Cunninghamella elegans, and some species of Trochoderma, such as T. harzianum, T. atroviride, and T. asperellum have been particularly studied for their plant growth-promoting (PGP) properties (Freitas et al., 2019; Hernandez et al., 2023; Nartey et al., 2022; Rao et al., 2022; Yu et al., 2021). Moreover, the bacterial species Lelliottia amigena and Pristia megaterium have also been previously reported to promote plant growth (Elakhdar, El-Akhdar & Abo-Koura, 2020; Sharma et al., 2022). The isolation rate of Trichoderma spp. and Bacillus spp. stood out from the remaining taxa pointing towards a promising scale-up of biomass production of these microorganisms for in-field application. The presence of phytopathogenic agents was also identified by the presence of Fusarium oxysposrum, Rosellinia necatrix, Setophoma terrestris, and Diaporthe columnaris, which also raises the threat to the efficacy of biofertilizers and demand for the formulation of biocontrol products to combat these disease-causing agents (Moya-Elizondo et al., 2019; Sawant, Song & Seo, 2022; Sayago et al., 2020). Overall, the isolation of these microorganisms and their PGP potential described in the literature opens doors for further assessment of their PGP properties in V. corymbosum and understanding their potential for biotechnological application to reduce the impacts of climate change in the production of blueberry. Conclusions Characterizing the root fungal and bacterial communities is of great interest to producers as tight links are established and could provide answers to the demand for new biotechnological alternatives to climate change consequences in plants, such as bioformulations that promote the colonization of the rhizosphere with PGPMs and antagonists of phytopathogens. In this study, the microbial structure of V. corymbosum ‘Brigitta’ rhizosphere was unveiled, disclosing a predominance of common soil colonizers among fungi and bacteria, which expectedly reflect the physicochemical composition of blueberry plants’ soils and the establishment of naturally occurring mutualistic links. Even though this study focused on a single region of the country, the data obtained here is representative of a highly worldwide used blueberry-produced group and is of great use for further studies with different Portuguese regions. Overall, we found a native microbial community that, according to what has been previously described, is capable of establishing mycorrhizal relationships and that confer beneficial physiological traits to the host plant. In order to provide applied solutions to mitigate climate change consequences in blueberry plants, we isolated and identified a plethora of naturally-occurring microorganisms that have previously been reported to have PGP activity and confer tolerance to hydric stress, a serious climate change threat. Further research should focus on testing the PGP and antagonistic potential of this collection of microorganisms in V. corymbosum and assess their potential to alleviate symptoms of climate change, such as drought, carbon accumulation andnutrient deficiency in blueberry plants, in order to increase their resilience against unfavorable climatic conditions and pathogenic agents. Supplemental Information 10.7717/peerj.15525/supp-1 Supplemental Information 1 ITS common OTUs between samples, and their taxonomic identification. k: kingdom; p: phylum; c: class; o: order; f: family; g: genus; s:species. Click here for additional data file. 10.7717/peerj.15525/supp-2 Supplemental Information 2 16s common OTUs between samples, and their taxonomic identification. k: kingdom; p: phylum; c: class; o: order; f: family; g: genus; s:species. Click here for additional data file. 10.7717/peerj.15525/supp-3 Supplemental Information 3 Descriptive list of the endophytic and epiphytic fungi isolated and respective BLAST results. Click here for additional data file. 10.7717/peerj.15525/supp-4 Supplemental Information 4 Descriptive list of the endophytic and epiphytic bacteria isolated and respective BLAST results. Click here for additional data file. 10.7717/peerj.15525/supp-5 Supplemental Information 5 Taxonomy tree depicting the abundance of each classification among the whole taxon (first number below taxon name) and among the selected taxon (second number below taxon name) regarding ITS sequencing. Click here for additional data file. 10.7717/peerj.15525/supp-6 Supplemental Information 6 Taxonomy tree depicting the abundance of each classification among the whole taxon (first number below taxon name) and among the selected taxon (second number below taxon name) regarding 16S rRNA sequencing. Click here for additional data file. Additional Information and Declarations Competing Interests Author Contributions Field Study Permissions Data Availability The authors declare that they have no competing interests. Anicia Gomes conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft. Rodrigo Narciso analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft. Laura Regalado analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft. Margarida Cardeano Pinheiro performed the experiments, prepared figures and/or tables, and approved the final draft. Filipa Barros performed the experiments, prepared figures and/or tables, and approved the final draft. Sara Sario analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft. Conceição Santos conceived and designed the experiments, authored or reviewed drafts of the article, and approved the final draft. Rafael J. Mendes conceived and designed the experiments, performed the experiments, analyzed the data, prepared figures and/or tables, authored or reviewed drafts of the article, and approved the final draft. The following information was supplied relating to field study approvals (i.e., approving body and any reference numbers): Field sampling was approved by Enxertada Indie Farmers under the project STOP.SUZUKII. The following information was supplied regarding data availability: The sequences of each sample are available at NCBI BioProject and BioSample: PRJNA940484; SAMN33569924, SAMN33569925, SAMN33569926, SAMN33569927, SAMN33569928, SAMN33569929, SAMN33569930, SAMN33569931, SAMN33569932, SAMN33569933, SAMN33569934, SAMN33569935, SAMN33569936, SAMN33569937, SAMN33569938, SAMN33569939, SAMN33569940, SAMN33569941, SAMN33569942, SAMN33569943. ==== Refs References Abhilash et al. (2016) Abhilash PC Dubey RK Tripathi V Gupta VK Singh HB Plant growth-promoting microorganisms for environmental sustainability Trends in Biotechnology 2016 34 11 847 850 10.1016/J.TIBTECH.2016.05.005 27265889 Acuña-Rodríguez et al. (2022) Acuña-Rodríguez IS Ballesteros GI Atala C Gundel PE Molina-Montenegro MA Hardening blueberry plants to face drought and cold events by the application of fungal endophytes Agronomy 2022 12 5 1000 10.3390/AGRONOMY12051000 Afrasayab, Faisal & Hasnain (2010) Afrasayab S Faisal M Hasnain S Comparative study of wild and transformed salt tolerant bacterial strains on Triticum aestivum growth under salt stress Brazilian Journal of Microbiology 2010 41 4 946 955 10.1590/S1517-83822010000400013 24031574 Ajmal et al. (2022) Ajmal AW Yasmin H Hassan MN Khan N Jan BL Mumtaz S Heavy metal-resistant plant growth-promoting Citrobacter werkmanii strain WWN1 and Enterobacter cloacae strain JWM6 enhance wheat (Triticum aestivum L.) growth by modulating physiological attributes and some key antioxidants under multi-metal stress Frontiers in Microbiology 2022 13 387 10.3389/FMICB.2022.815704 Alexander et al. (2019) Alexander A Singh VK Mishra A Jha B Plant growth promoting rhizobacterium Stenotrophomonas maltophilia BJ01 augments endurance against N2 starvation by modulating physiology and biochemical activities of Arachis hypogea PLOS ONE 2019 14 9 e0222405 10.1371/JOURNAL.PONE.0222405 31513643 Alfiky & Weisskopf (2021) Alfiky A Weisskopf L Deciphering Trichoderma-plant–pathogen interactions for better development of biocontrol applications Journal of Fungi 2021 7 1 61 10.3390/JOF7010061 33477406 Alshaal et al. (2017) Alshaal T El-Ramady H Al-Saeedi AH Shalaby T Elsakhawy T Omara AED Gad A Hamad E El-Ghamry A Mosa A Amer M Abdalla N Naeem M Ansari A Gill S The rhizosphere and plant nutrition under climate change Essential Plant Nutrients: Uptake, Use Efficiency, and Management 2017 Cham Springer 275 308 Arriagada et al. (2012) Arriagada C Manquel D Cornejo P Soto J Sampedro I Ocampo J Effects of the co-inoculation with saprobe and mycorrhizal fungi on Vaccinium corymbosum growth and some soil enzymatic activities Journal of Soil Science and Plant Nutrition 2012 12 2 283 294 10.4067/S0718-95162012000200008 Badawi, Biomy & Desoky (2011) Badawi FSF Biomy AMM Desoky AH Peanut plant growth and yield as influenced by co-inoculation with Bradyrhizobium and some rhizo-microorganisms under sandy loam soil conditions Annals of Agricultural Sciences 2011 56 1 17 25 10.1016/J.AOAS.2011.05.005 Becker et al. (2019) Becker MM Nunes GS Ribeiro DB Silva FEPS Catanante G Marty JL Determination of the antioxidant capacity of red fruits by miniaturized spectrophotometry assays Journal of the Brazilian Chemical Society 2019 30 5 1108 1114 10.21577/0103-5053.20190003 Bedmar, Robles & Delgado (2005) Bedmar EJ Robles EF Delgado MJ The complete denitrification pathway of the symbiotic, nitrogen-fixing bacterium Bradyrhizobium japonicum Biochemical Society Transactions 2005 33 1 141 144 10.1042/BST0330141 15667287 Bello et al. (2022) Bello F Montironi ID Medina MB Munitz MS Ferreira FV Williman C Vázquez D Cariddi LN Musumeci MA Mycofumigation of postharvest blueberries with volatile compounds from Trichoderma atroviride IC-11 is a promising tool to control rots caused by Botrytis cinerea Food Microbiology 2022 106 3 104040 10.1016/J.FM.2022.104040 35690443 Berbee (2001) Berbee ML The phylogeny of plant and animal pathogens in the Ascomycota Physiological and Molecular Plant Pathology 2001 59 4 165 187 10.1006/PMPP.2001.0355 Berendsen, Pieterse & Bakker (2012) Berendsen RL Pieterse CMJ Bakker PAHM The rhizosphere microbiome and plant health Trends in Plant Science 2012 17 8 478 486 10.1016/J.TPLANTS.2012.04.001 22564542 Casarrubia et al. (2020) Casarrubia S Martino E Daghino S Kohler A Morin E Khouja HR Murat C Barry KW Lindquist EA Martin FM Perotto S Modulation of plant and fungal gene expression upon Cd exposure and symbiosis in ericoid mycorrhizal Vaccinium myrtillus Frontiers in Microbiology 2020 11 341 10.3389/FMICB.2020.00341 32210940 Chen et al. (2019) Chen S Zhu Y Shao T Long X Gao X Zhou Z Relationship between rhizosphere soil properties and disease severity in highbush blueberry (Vaccinium corymbosum) Applied Soil Ecology 2019 137 12 187 194 10.1016/J.APSOIL.2019.02.015 Cheng et al. (2022) Cheng Y Zhou L Liang T Man J Wang Y Li Y Chen H Zhang T Deciphering rhizosphere microbiome assembly of Castanea henryi in plantation and natural forest Microorganisms 2022 10 1 42 10.3390/MICROORGANISMS10010042 Chhetri et al. (2022) Chhetri G Kim I Kim J So Y Seo T Chryseobacterium tagetis sp. nov., a plant growth promoting bacterium with an antimicrobial activity isolated from the roots of medicinal plant (Tagetes patula) The Journal of Antibiotics 2022 75 6 312 320 10.1038/s41429-022-00525-7 35440770 Chiapello, Martino & Perotto (2015) Chiapello M Martino E Perotto S Common and metal-specific proteomic responses to cadmium and zinc in the metal tolerant ericoid mycorrhizal fungus Oidiodendron maius Zn Metallomics 2015 7 5 805 815 10.1039/C5MT00024F 25761960 Choma et al. (2016) Choma M Bárta J Šantrůčková H Urich T Low abundance of Archaeorhizomycetes among fungi in soil metatranscriptomes Scientific Reports 2016 6 38455 10.1038/srep38455 28009005 Cruz-Paredes et al. (2019) Cruz-Paredes C Svenningsen NB Nybroe O Kjøller R Frøslev TG Jakobsen I Suppression of arbuscular mycorrhizal fungal activity in a diverse collection of non-cultivated soils FEMS Microbiology Ecology 2019 95 3 20 10.1093/FEMSEC/FIZ020 da Silva Santos et al. (2022) da Silva Santos S da Silva Aa Polonio JC Polli AD Orlandelli RC dos Santos Oliveira JADS Brandão Filho JUT Azevedo JL Pamphile JA Influence of plant growth-promoting endophytes Colletotrichum siamense and Diaporthe masirevici on tomato plants (Lycopersicon esculentum Mill.) Mycology 2022 13 4 257 270 10.1080/21501203.2022.2050825 36405335 Daniel (2005) Daniel R The metagenomics of soil Nature Reviews Microbiology 2005 3 6 470 478 10.1038/nrmicro1160 15931165 Darnell & Cruz-Huerta (2011) Darnell RL Cruz-Huerta N Uptake and assimilation of nitrate and iron in cultivated and wild Vaccinium species International Journal of Fruit Science 2011 11 2 136 150 10.1080/15538362.2011.578518 de Macêdo et al. (2017) de Macêdo IYL Garcia LF Oliveira Neto JR de Siqueira Leite KC Ferreira VS Ghedini PC de Souza Gil E Electroanalytical tools for antioxidant evaluation of red fruits dry extracts Food Chemistry 2017 217 326 331 10.1016/J.FOODCHEM.2016.08.082 27664641 de Oliveira Mendes et al. (2014) de Oliveira Mendes G Moreira De Freitas AL Liparini Pereira O Ribeiro Da Silva I Bojkov Vassilev N Dutra Costa M Mechanisms of phosphate solubilization by fungal isolates when exposed to different P sources Annals of Microbiology 2014 64 1 239 249 10.1007/S13213-013-0656-3 de Silva et al. (2000) de Silva A Patterson K Rothrock C Moore J Growth promotion of highbush blueberry by fungal and bacterial inoculants HortScience 2000 35 7 1228 1230 10.21273/HORTSCI.35.7.1228 de Sousa et al. (2020) de Sousa TP Chaibub AA da Silva GB de Filippi MCC Trichoderma asperellum modulates defense genes and potentiates gas exchanges in upland rice plants Physiological and Molecular Plant Pathology 2020 112 3 101561 10.1016/J.PMPP.2020.101561 de Souza et al. (2014) de Souza VR Pereira PAP da Silva TLT de Oliveira Lima LC Pio R Queiroz F Determination of the bioactive compounds, antioxidant activity and chemical composition of Brazilian blackberry, red raspberry, strawberry, blueberry and sweet cherry fruits Food Chemistry 2014 156 362 368 10.1016/j.foodchem.2014.01.125 24629981 Delamuta et al. (2015) Delamuta JRM Ribeiro RA Ormeño-Orrillo E Parma MM Melo IS Martínez-Romero E Hungria M Bradyrhizobium tropiciagri sp. nov. and Bradyrhizobium embrapense sp. nov nitrogenfixing symbionts of tropical forage legumes International Journal of Systematic and Evolutionary Microbiology 2015 65 12 4424 4433 10.1099/IJSEM.0.000592 26362866 Deveautour et al. (2021) Deveautour C Donn S Bennett AE Power S Powell JR Variability of arbuscular mycorrhizal fungal communities within the root systems of individual plants is high and influenced by host species and root phosphorus Pedobiologia 2021 84 2 150691 10.1016/J.PEDOBI.2020.150691 Dong et al. (2022) Dong M Wang B Tian Y Chen L Li Y Sun H Diversity of fungal assemblages in rhizosphere and endosphere of blueberry (Vaccinium spp.) under field conditions revealed by culturing and culture-independent molecular methods Canadian Journal of Microbiology 2022 68 10 622 632 10.1139/CJM-2022-0093 35926235 Drigo, Kowalchuk & van Veen (2008) Drigo B Kowalchuk GA van Veen JA Climate change goes underground: effects of elevated atmospheric CO2 on microbial community structure and activities in the rhizosphere Biology and Fertility of Soils 2008 44 5 667 679 10.1007/S00374-008-0277-3 Dubey et al. (2021) Dubey A Kumar A Latif Khan M Payasi DK The open microbiology journal plant growth-promoting and bio-control activity of Micrococcus luteus strain AKAD 3-5 isolated from the soybean (Glycine max (L.) Merr.) rhizosphere The Open Microbiology Journal 2021 15 1 188 197 10.2174/1874285802115010188 Egamberdiyeva, Qarshieva & Davranov (2004) Egamberdiyeva D Qarshieva D Davranov K The use of Bradyrhizobium to enhance growth and yield of soybean in calcareous soil in Uzbekistan Journal of Plant Growth Regulation 2004 23 1 54 57 10.1007/S00344-004-0069-4 Elakhdar, El-Akhdar & Abo-Koura (2020) Elakhdar I El-Akhdar I Abo-Koura HA Alleviation of salt stress on wheat (Triticum aestivum L.) by plant growth promoting bacteria strains Bacillus halotolerans MSR-H4 and Lelliottia amnigena MSR-M49 Journal of Advances in Microbiology 2020 20 1 44 58 10.9734/JAMB/2020/v20i130208 Elsheikh & Ibrahim (1999) Elsheikh EAE Ibrahim KA The effect of Bradyrhizobium inoculation on yield and seed quality of guar (Cyamopsis tetragonoloba L.) Food Chemistry 1999 65 2 183 187 10.1016/S0308-8146(98)00192-7 FAOSTAT (2023) FAOSTAT 2023 Crops and livestock products https://www.fao.org/faostat/en/#data/QCL/visualize 26 January 2023 Fehrer et al. (2019) Fehrer J Réblová M Bambasová V Vohník M The root-symbiotic Rhizoscyphus ericae aggregate and Hyaloscypha (Leotiomycetes) are congeneric: phylogenetic and experimental evidence Studies in Mycology 2019 92 1 195 225 10.1016/J.SIMYCO.2018.10.004 31998413 Ferreira & Musumeci (2021) Ferreira Fv Musumeci MA Trichoderma as biological control agent: scope and prospects to improve efficacy World Journal of Microbiology & Biotechnology 2021 37 5 102 10.1007/S11274-021-03058-7 34009500 Freitas et al. (2019) Freitas A Junior C França L Chagas B de Oliveira Miller L Claudio De Oliveira J Efficiency of Trichoderma asperellum UFT 201 as plant growth promoter in soybean African Journal of Agricultural Research 2019 14 5 263 271 10.5897/AJAR2018.13556 Fu et al. (2021) Fu H Li H Yin P Mei H Li J Zhou P Wang Y Ma Q Jeyaraj A Thangaraj K Chen X Li X Guo G Integrated application of rapeseed cake and green manure enhances soil nutrients and microbial communities in tea garden soil Sustainability 2021 13 5 2967 10.3390/SU13052967 Fuentes et al. (2020) Fuentes A Herrera H Charles TC Arriagada C Fungal and bacterial microbiome associated with the rhizosphere of native plants from the atacama desert Microorganisms 2020 8 2 209 10.3390/MICROORGANISMS8020209 32033093 Gonçalves et al. (2022) Gonçalves AC Sánchez-Juanes F Meirinho S Silva LR Alves G Flores-Félix JD Insight into the taxonomic and functional diversity of bacterial communities inhabiting blueberries in Portugal Microorganisms 2022 10 11 2193 10.3390/MICROORGANISMS10112193 36363783 Guo et al. (2021a) Guo X Li S Wang D Huang Z Sarwar N Mubeen K Shakeel M Hussain M Effects of water and fertilizer coupling on the physiological characteristics and growth of rabbiteye blueberry PLOS ONE 2021a 16 7 e0254013 10.1371/JOURNAL.PONE.0254013 34228763 Guo et al. (2021b) Guo X Wan Y Shakeel M Wang D Xiao L Effect of mycorrhizal fungi inoculation on bacterial diversity, community structure and fruit yield of blueberry Rhizosphere 2021b 19 2 100360 10.1016/J.RHISPH.2021.100360 Gupta et al. (2019) Gupta P Kumar V Usmani Z Rani R Chandra A Gupta VK A comparative evaluation towards the potential of Klebsiella sp. and Enterobacter sp. in plant growth promotion, oxidative stress tolerance and chromium uptake in Helianthus annuus (L.) Journal of Hazardous Materials 2019 377 391 398 10.1016/J.JHAZMAT.2019.05.054 31173990 Hakim et al. (2021) Hakim S Naqqash T Nawaz MS Laraib I Siddique MJ Zia R Mirza MS Imran A Rhizosphere engineering with plant growth-promoting microorganisms for agriculture and ecological sustainability Frontiers in Sustainable Food Systems 2021 5 16 10.3389/FSUFS.2021.617157 Hannula et al. (2012) Hannula SE Boschker HTS de Boer W van Veen JA 13C pulse-labeling assessment of the community structure of active fungi in the rhizosphere of a genetically starch-modified potato (Solanum tuberosum) cultivar and its parental isoline New Phytologist 2012 194 3 784 799 10.1111/J.1469-8137.2012.04089.X 22413848 Hanson et al. (2000) Hanson E Hancock J Ramsdell DC Schilder A VanEe G Ledebuhr R Sprayer type and pruning affect the incidence of blueberry fruit rots HortScience 2000 35 2 235 238 10.21273/HORTSCI.35.2.235 Harman et al. (2004) Harman GE Howell CR Viterbo A Chet I Lorito M Trichoderma species—opportunistic, avirulent plant symbionts Nature Reviews Microbiology 2004 2 1 43 56 10.1038/NRMICRO797 15035008 He et al. (2017) He D Shen W Eberwein J Zhao Q Ren L Wu QL Diversity and co-occurrence network of soil fungi are more responsive than those of bacteria to shifts in precipitation seasonality in a subtropical forest Soil Biology and Biochemistry 2017 115 499 510 10.1016/J.SOILBIO.2017.09.023 Hernandez et al. (2023) Hernandez AYM De F Neto A Antunes JEL Bonifácio A de Freitas ADS Araújo FF Dutra AF Leite MRL Sousa RS Araújo ASF Co-inoculation of Beijerinckia indica subsp. indica and Cunninghamella elegans spp. enriches cattle manure and promotes the growth of pepper (Capsicum baccatum) International Journal of Recycling of Organic Waste in Agriculture 2023 12 3 457 466 10.30486/IJROWA.2023.1957320.1455 Hilário et al. (2020) Hilário S Lopes A Santos L Alves A Botryosphaeriaceae species associated with blueberry stem blight and dieback in the Centre Region of Portugal European Journal of Plant Pathology 2020 156 1 31 44 10.1007/S10658-019-01860-6 Hosseini & Mosaddeghi (2021) Hosseini F Mosaddeghi MR Effects of Serendipita indica inoculation of four wheat cultivars on hydraulic properties and aggregate stability of a calcareous soil Plant and Soil 2021 469 1–2 347 367 10.1007/S11104-021-05142-1 Hosseini, Mosaddeghi & Dexter (2017) Hosseini F Mosaddeghi MR Dexter AR Effect of the fungus Piriformospora indica on physiological characteristics and root morphology of wheat under combined drought and mechanical stresses Plant Physiology and Biochemistry 2017 118 4 107 120 10.1016/J.PLAPHY.2017.06.005 28624682 Jiang et al. (2022) Jiang B Liu R Fang X Wu W Han Y Chen H Xu F Gao H Botrytis cinerea infection affects wax composition, content and gene expression in blueberry fruit Postharvest Biology and Technology 2022 192 112020 10.1016/J.POSTHARVBIO.2022.112020 Kaisermann et al. (2015) Kaisermann A Maron PA Beaumelle L Lata JC Fungal communities are more sensitive indicators to non-extreme soil moisture variations than bacterial communities Applied Soil Ecology 2015 86 158 164 10.1016/J.APSOIL.2014.10.009 Kamble et al. (2021) Kamble Mv Joshi SM Hadimani S Jogaiah S Biopriming with rhizosphere Trichoderma harzianum elicit protection against grapevine downy mildew disease by triggering histopathological and biochemical defense responses Rhizosphere 2021 19 4 100398 10.1016/J.RHISPH.2021.100398 Khan et al. (2020) Khan MS Gao J Chen X Zhang M Yang F Du Y Moe TS Munir I Xue J Zhang X Isolation and characterization of plant growth-promoting endophytic bacteria Paenibacillus polymyxa SK1 from Lilium lancifolium BioMed Research International 2020 2020 1 1 17 10.1155/2020/8650957 Khouja et al. (2013) Khouja HR Abbà S Lacercat-Didier L Daghino S Doillon D Richaud P Martino E Vallino M Perotto S Chalot M Blaudez D OmZnT1 and OmFET, two metal transporters from the metal-tolerant strain Zn of the ericoid mycorrhizal fungus Oidiodendron maius, confer zinc tolerance in yeast Fungal Genetics and Biology 2013 52 53 64 10.1016/J.FGB.2012.11.004 23232015 Knoema (2023) Knoema The production of blueberries in the World 2023 https://knoema.com/data/agriculture-indicators-production+blueberries Kour et al. (2020) Kour D Rana KL Sheikh I Kumar V Yadav AN Dhaliwal HS Saxena AK Alleviation of drought stress and plant growth promotion by Pseudomonas libanensis EU-LWNA-33, a drought-adaptive phosphorus-solubilizing bacterium Proceedings of the National Academy of Sciences India Section B—Biological Sciences 2020 90 4 785 795 10.1007/S40011-019-01151-4 Kumar, Patel & Meena (2018) Kumar A Patel JS Meena VS Meena V Rhizospheric microbes for sustainable agriculture: an overview Role of Rhizospheric Microbes in Soil 2018 Singapore Springer 1 31 Kwon et al. (2014) Kwon JH Kang DW Cheon MG Kim J First report of Alternaria leaf spot caused by Alternaria sp. on highbush blueberry (Vaccinium corymbosum) in South Korea Plant Disease 2014 98 10 1434 10.1094/PDIS-04-14-0344-PDN Lane (1991) Lane DJ Stackebrandt E Goodfellow M 16S/23S rRNA sequencing Nucleic Acid Techniques in Bacterial Systematic 1991 Hoboken John Wiley and Sons 115 175 Lemmel et al. (2021) Lemmel F Maunoury-Danger F Leyval C Cébron A Altered fungal communities in contaminated soils from French industrial brownfields Journal of Hazardous Materials 2021 406 3 124296 10.1016/J.JHAZMAT.2020.124296 33268205 Leopold (2016) Leopold DR Ericoid fungal diversity: challenges and opportunities for mycorrhizal research Fungal Ecology 2016 24 114 123 10.1016/J.FUNECO.2016.07.004 Li et al. (2017) Li F Chen L Zhang J Yin J Huang S Bacterial community structure after long-term organic and inorganic fertilization reveals important associations between soil nutrients and specific taxa involved in nutrient transformations Frontiers in Microbiology 2017 8 FEB 187 10.3389/FMICB.2017.00187 28232824 Li et al. (2020) Li J Mavrodi Ov Hou J Blackmon C Babiker EM Mavrodi Dv Comparative analysis of rhizosphere microbiomes of southern highbush blueberry (Vaccinium corymbosum L.), darrow’s blueberry (V. darrowii Camp), and rabbiteye blueberry (V. virgatum Aiton) Frontiers in Microbiology 2020 11 370 10.3389/FMICB.2020.00370 32226421 Linares et al. (2020) Linares C Díaz J Negev M Martínez GS Debono R Paz S Impacts of climate change on the public health of the Mediterranean Basin population—current situation, projections, preparedness and adaptation Environmental Research 2020 182 4–5 109107 10.1016/J.ENVRES.2019.109107 32069750 Liu et al. (2022) Liu B Hu Y Wang Y Xue H Li Z Li M Effects of saline-alkali stress on bacterial and fungal community diversity in Leymus chinensis rhizosphere soil Environmental Science and Pollution Research 2022 29 46 70000 70013 10.1007/S11356-022-20270-6 35579830 Lobos & Hancock (2015) Lobos GA Hancock JF Breeding blueberries for a changing global environment: a review Frontiers in Plant Science 2015 6 SEPTEMBER 782 10.3389/FPLS.2015.00782 26483803 Lombardi et al. (2020) Lombardi N Caira S Troise AD Scaloni A Vitaglione P Vinale F Marra R Salzano AM Lorito M Woo SL Trichoderma applications on strawberry plants modulate the physiological processes positively affecting fruit production and quality Frontiers in Microbiology 2020 11 1364 10.3389/FMICB.2020.01364 32719661 Malik et al. (2020) Malik A Butt TA Naqvi STA Yousaf S Qureshi MK Zafar MI Farooq G Nawaz I Iqbal M Lead tolerant endophyte Trametes hirsuta improved the growth and lead accumulation in the vegetative parts of Triticum aestivum L Heliyon 2020 6 7 e04188 10.1016/J.HELIYON.2020.E04188 32671237 Morvan et al. (2020) Morvan S Meglouli H Lounès-Hadj Sahraoui A Hijri M Into the wild blueberry (Vaccinium angustifolium) rhizosphere microbiota Environmental Microbiology 2020 22 9 3803 3822 10.1111/1462-2920.15151 32623832 Moya-Elizondo et al. (2019) Moya-Elizondo EA Doussoulin H San Martin J Ruiz B del Valle P First report of Fusarium oxysporum causing fusarium wilt on blueberry (Vaccinium corymbosum) in Chile Plant Disease 2019 103 10 2669 10.1094/PDIS-02-19-0275-PDN Mummey & Rillig (2008) Mummey DL Rillig MC Spatial characterization of arbuscular mycorrhizal fungal molecular diversity at the submetre scale in a temperate grassland FEMS Microbiology Ecology 2008 64 2 260 270 10.1111/J.1574-6941.2008.00475.X 18363704 Naamala & Smith (2020) Naamala J Smith DL Relevance of plant growth promoting microorganisms and their derived compounds, in the face of climate change Agronomy 2020 10 8 1179 10.3390/AGRONOMY10081179 Nadziakiewicz et al. (2018) Nadziakiewicz M Kurzawińska H Mazur S Tekielska D Alternaria alternata—the main causal agent of disease symptoms in juniper, rose, yew and highbush blueberry in nurseries in southern Poland Folia Horticulturae 2018 30 1 15 25 10.2478/fhort-2018-0002 Nartey et al. (2022) Nartey LK Pu Q Zhu W Zhang S Li J Yao Y Hu X Antagonistic and plant growth promotion effects of Mucor moelleri, a potential biocontrol agent Microbiological Research 2022 255 126922 10.1016/J.MICRES.2021.126922 Nascimento et al. (2020) Nascimento FX Hernandez AG Glick BR Rossi MJ The extreme plant-growth-promoting properties of Pantoea phytobeneficialis MSR2 revealed by functional and genomic analysis Environmental Microbiology 2020 22 4 1341 1355 10.1111/1462-2920.14946 32077227 Naureen et al. (2017) Naureen Z Ur Rehman N Hussain H Hussain J Gilani SA al Housni SK Mabood F Khan AL Farooq S Abbas G Harrasi AA Exploring the potentials of Lysinibacillus sphaericus ZA9 for plant growth promotion and biocontrol activities against phytopathogenic fungi Frontiers in Microbiology 2017 8 AUG 1477 10.3389/FMICB.2017.01477 28861045 Nordstedt et al. (2021) Nordstedt NP Roman-Reyna V Jacobs JM Jones ML Comparative genomic understanding of gram-positive plant growth-promoting Leifsonia Phytobiomes Journal 2021 5 3 263 274 10.1094/PBIOMES-12-20-0092-SC Pandey et al. (2008) Pandey A Das N Kumar B Rinu K Trivedi P Phosphate solubilization by Penicillium spp. isolated from soil samples of Indian Himalayan region World Journal of Microbiology and Biotechnology 2008 24 1 97 102 10.1007/S11274-007-9444-1 Pescie et al. (2021) Pescie MA Fradkin M Lavado RS Chiocchio VM Endophytic fungi in blueberry cultivars, in three production areas of Argentina Physiological and Molecular Plant Pathology 2021 115 2 101662 10.1016/J.PMPP.2021.101662 Powell & Bennett (2016) Powell JR Bennett AE Unpredictable assembly of arbuscular mycorrhizal fungal communities Pedobiologia 2016 59 1–2 11 15 10.1016/J.PEDOBI.2015.12.001 R Core Team (2013) R Core Team R: A language and environment for statistical computing. Version 2.15.3. Vienna: R Foundation for Statistical Computing 2013 https://www.r-project.org Rana et al. (2020) Rana KL Kour D Kaur T Sheikh I Yadav AN Kumar V Suman A Dhaliwal HS Endophytic microbes from diverse wheat genotypes and their potential biotechnological applications in plant growth promotion and nutrient uptake Proceedings of the National Academy of Sciences India Section B—Biological Sciences 2020 90 5 969 979 10.1007/S40011-020-01168-0 Rao et al. (2022) Rao Y Zeng L Jiang H Mei L Wang Y Trichoderma atroviride LZ42 releases volatile organic compounds promoting plant growth and suppressing Fusarium wilt disease in tomato seedlings BMC Microbiology 2022 22 1 1 12 10.1186/S12866-022-02511-3 34979903 Rawat et al. (2012) Rawat SR Männistö MK Bromberg Y Häggblom MM Comparative genomic and physiological analysis provides insights into the role of acidobacteria in organic carbon utilization in arctic tundra soils FEMS Microbiology Ecology 2012 82 2 341 355 10.1111/j.1574-6941.2012.01381.x 22486608 Read, Leake & Perez-Moreno (2011) Read DJ Leake JR Perez-Moreno J Mycorrhizal fungi as drivers of ecosystem processes in heathland and boreal forest biomes Canadian Journal of Botany 2011 82 1243 1263 10.1139/B04-123 Réblová, Fournier & Štěpánek (2016) Réblová M Fournier J Štěpánek V Two new lineages of aquatic ascomycetes: Atractospora gen. nov. and Rubellisphaeria gen. et sp. nov., and a sexual morph of Myrmecridium montsegurinum sp. nov Mycological Progress 2016 15 21 10.1007/S11557-016-1166-Z Redman et al. (2021) Redman RS Kim YO Cho S Mercer M Rienstra M Manglona R Biaggi T Zhou XG Chilvers M Gray Z Rodriguez RJ A symbiotic approach to generating stress tolerant crops Microorganisms 2021 9 5 920 10.3390/MICROORGANISMS9050920 33922997 Reithner et al. (2011) Reithner B Ibarra-Laclette E Mach RL Herrera-Estrella A Identification of mycoparasitism-related genes in Trichoderma atroviride Applied and Environmental Microbiology 2011 77 13 4361 4370 10.1128/AEM.00129-11 21531825 Ren et al. (2021) Ren H Wang H Yu Z Zhang S Qi X Sun L Wang Z Zhang M Ahmed T Li B Effect of two kinds of fertilizers on growth and rhizosphere soil properties of bayberry with decline disease Plants 2021 10 11 2386 10.3390/PLANTS10112386 34834750 Richardson et al. (2009) Richardson AE Hocking PJ Simpson RJ George TS Richardson AE Hocking PJ Simpson RJ George TS Plant mechanisms to optimise access to soil phosphorus Crop and Pasture Science 2009 60 2 124 143 10.1071/CP07125 Rodriguez & Durán (2020) Rodriguez R Durán P Natural holobiome engineering by using native extreme microbiome to counteract the climate change effects Frontiers in Bioengineering and Biotechnology 2020 8 568 10.3389/fbioe.2020.00568 32582678 Rodriguez-Mena et al. (2022) Rodriguez-Mena S Camacho M Santos Bde los Miranda L Camacho-Sanchez M Microbiota modulation in blueberry rhizosphere by biocontrol bacteria Microbiology Research 2022 13 4 809 824 10.3390/microbiolres13040057 Rosling et al. (2011) Rosling A Cox F Cruz-Martinez K Ihrmark K Grelet GA Lindahl BD Menkis A James TY Archaeorhizomycetes: unearthing an ancient class of ubiquitous soil fungi Science 2011 333 6044 876 879 10.1126/science.1206958 21836015 Rousk et al. (2010) Rousk J Bååth E Brookes PC Lauber CL Lozupone C Caporaso JG Knight R Fierer N Soil bacterial and fungal communities across a pH gradient in an arable soil The ISME Journal 2010 4 10 1340 1351 10.1038/ismej.2010.58 20445636 Sait, Davis & Janssen (2006) Sait M Davis KER Janssen PH Effect of pH on isolation and distribution of members of subdivision 1 of the phylum Acidobacteria occurring in soil Applied and Environmental Microbiology 2006 72 3 1852 1857 10.1128/AEM.72.3.1852-1857.2006 16517631 Sansinenea (2019) Sansinenea E Singh H Keswani C Reddy M Sansinenea E García-Estrada C Bacillus spp.: as plant growth-promoting bacteria Secondary Metabolites of Plant Growth Promoting Rhizomicroorganisms: Discovery and Applications 2019 Singapore Springer 225 237 Sarkar et al. (2019) Sarkar D Rovenich H Jeena G Nizam S Tissier A Balcke GU Mahdi LK Bonkowski M Langen G Zuccaro A The inconspicuous gatekeeper: endophytic Serendipita vermifera acts as extended plant protection barrier in the rhizosphere New Phytologist 2019 224 2 886 901 10.1111/NPH.15904 31074884 Sarma et al. (2015) Sarma BK Yadav SK Singh S Singh HB Microbial consortium-mediated plant defense against phytopathogens: readdressing for enhancing efficacy Soil Biology and Biochemistry 2015 87 7 25 33 10.1016/J.SOILBIO.2015.04.001 Sattiraju et al. (2019) Sattiraju KS Kotiyal S Arora A Maheshwari M Plant growth-promoting microbes: contribution to stress management in plant hosts Environmental Biotechnology: For Sustainable Future 2019 10 20 199 236 10.1007/978-981-10-7284-0_8 Sawant, Song & Seo (2022) Sawant SS Song J Seo HJ Characterization of Bacillus velezensis RDA1 as a biological control agent against white root rot disease caused by Rosellinia necatrix Plants 2022 11 19 2486 10.3390/PLANTS11192486 36235351 Sayago et al. (2020) Sayago P Juncosa F Albarracín Orio AG Luna DF Molina G Lafi J Ducasse DA Bacillus subtilis ALBA01 alleviates onion pink root by antagonizing the pathogen Setophoma terrestris and allowing physiological status maintenance European Journal of Plant Pathology 2020 157 3 509 519 10.1007/S10658-020-02012-X Sharma et al. (2022) Sharma A Song XP Singh RK Vaishnav A Gupta S Singh P Guo DJ Verma KK Li YR Impact of carbendazim on cellular growth, defence system and plant growth promoting traits of Priestia megaterium ANCB-12 isolated from sugarcane rhizosphere Frontiers in Microbiology 2022 13 4688 10.3389/FMICB.2022.1005942 Sharma et al. (2013) Sharma SB Sayyed RZ Trivedi MH Gobi TA Phosphate solubilizing microbes: sustainable approach for managing phosphorus deficiency in agricultural soils SpringerPlus 2013 2 587 10.1186/2193-1801-2-587 25674415 Shen et al. (2020) Shen Q Yang J Su D Li Z Xiao W Wang Y Cui X Comparative analysis of fungal diversity in rhizospheric soil from wild and reintroduced Magnolia sinica estimated via high-throughput sequencing Plants 2020 9 5 600 10.3390/PLANTS9050600 32397167 Smrke et al. (2021) Smrke T Veberic R Hudina M Zitko V Ferlan M Jakopic J Fruit quality and yield of three highbush blueberry (Vaccinium corymbosum L.) cultivars grown in two planting systems under different protected environments Horticulturae 2021 7 12 591 10.3390/HORTICULTURAE7120591 Snak et al. (2021) Snak A Vendruscolo ECG dos Santos MF Fiorini A Mesa D Genome sequencing and analysis of plant growth-promoting attributes from Leclercia adecarboxylata Genetics and Molecular Biology 2021 44 1 1 10 10.1590/1678-4685-GMB-2020-0130 Sun et al. (2014) Sun C Shao Y Vahabi K Lu J Bhattacharya S Dong S Yeh KW Sherameti I Lou B Baldwin IT Oelmüller R The beneficial fungus Piriformospora indica protects Arabidopsis from Verticillium dahliae infection by downregulation plant defense responses BMC Plant Biology 2014 14 1 71 10.1186/S12870-014-0268-5 24655567 Thomma (2003) Thomma BPHJ Alternaria spp.: from general saprophyte to specific parasite Molecular Plant Pathology 2003 4 4 225 236 10.1046/J.1364-3703.2003.00173.X 20569383 Tiquia et al. (2002) Tiquia SM Lloyd J Herms DA Hoitink HAJ Michel FC Effects of mulching and fertilization on soil nutrients, microbial activity and rhizosphere bacterial community structure determined by analysis of TRFLPs of PCR-amplified 16S rRNA genes Applied Soil Ecology 2002 21 1 31 48 10.1016/S0929-1393(02)00040-9 Tournas & Katsoudas (2005) Tournas VH Katsoudas E Mould and yeast flora in fresh berries, grapes and citrus fruits International Journal of Food Microbiology 2005 105 1 11 17 10.1016/J.IJFOODMICRO.2005.05.002 16023239 Trzewik, Marasek-Ciolakowska & Orlikowska (2020) Trzewik A Marasek-Ciolakowska A Orlikowska T Protection of highbush blueberry plants against Phytophthora cinnamomi using Serendipita indica Agronomy 2020 10 10 1598 10.3390/AGRONOMY10101598 Vallino et al. (2009) Vallino M Martino E Boella F Murat C Chiapello M Perotto S Cu,Zn superoxide dismutase and zinc stress in the metal-tolerant ericoid mycorrhizal fungus Oidiodendron maius Zn FEMS Microbiology Letters 2009 293 1 48 57 10.1111/J.1574-6968.2009.01503.X 19278525 Vinale & Sivasithamparam (2020) Vinale F Sivasithamparam K Beneficial effects of Trichoderma secondary metabolites on crops Phytotherapy Research 2020 34 11 2835 2842 10.1002/PTR.6728 32578292 Vitti et al. (2016) Vitti A Pellegrini E Nali C Lovelli S Sofo A Valerio M Scopa A Nuzzaci M Trichoderma harzianum T-22 induces systemic resistance in tomato infected by Cucumber mosaic virus Frontiers in Plant Science 2016 7 October 2016 1520 10.3389/FPLS.2016.01520 27777581 Vohník (2020) Vohník M Ericoid mycorrhizal symbiosis: theoretical background and methods for its comprehensive investigation Mycorrhiza 2020 30 6 671 695 10.1007/s00572-020-00989-1 33043410 Wakelin et al. (2004) Wakelin SA Warren RA Harvey PR Ryder MH Phosphate solubilization by Penicillium spp. closely associated with wheat roots Biology and Fertility of Soils 2004 40 1 36 43 10.1007/S00374-004-0750-6 Wang et al. (2019) Wang J Liu G Zhang C Wang G Fang L Cui Y Higher temporal turnover of soil fungi than bacteria during long-term secondary succession in a semiarid abandoned farmland Soil and Tillage Research 2019 194 104305 10.1016/J.STILL.2019.104305 Wang, Sun & Xu (2022) Wang M Sun H Xu Z Analysis of blueberry plant rhizosphere bacterial diversity and selection of plant growth promoting rhizobacteria Current Microbiology 2022 79 331 10.1007/S00284-022-03031-Z 36156157 Wang et al. (2022) Wang X Fan X Wang W Song F Use of Serendipita indica to improve soybean growth, physiological properties, and soil enzymatic activities under different Cd concentrations Chemical and Biological Technologies in Agriculture 2022 9 1 1 12 10.1186/S40538-022-00331-1 Ważny et al. (2022) Ważny R Jędrzejczyk RJ Rozpądek P Domka A Turnau K Biotization of highbush blueberry with ericoid mycorrhizal and endophytic fungi improves plant growth and vitality Applied Microbiology and Biotechnology 2022 106 12 4775 4786 10.1007/S00253-022-12019-5 35729273 Wei & Chen (2022) Wei X Chen J Ericoid mycorrhizal fungi as biostimulants for improving propagation and production of ericaceous plants Frontiers in Plant Science 2022 13 1027390 10.3389/fpls.2022.1027390 36466284 Wei et al. (2022) Wei X Zhang W Zulfiqar F Zhang C Chen J Ericoid mycorrhizal fungi as biostimulants for improving propagation and production of ericaceous plants Frontiers in Plant Science 2022 13 425 10.3389/FPLS.2022.1027390 White et al. (1990) White TJ Bruns TD Lee SB Taylor JW Innis MA Gelfand DH Sninsky JJ White TJ Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics PCR Protocols: A Guide to Methods and Applications 1990 London Academic Press 315 322 Wolińska (2019) Wolińska A Metagenomic achievements in microbial diversity determination in croplands: a review Microbial Diversity in the Genomic Era 2019 2019 15 35 10.1016/B978-0-12-814849-5.00002-2 Xie et al. (2019a) Xie L Chen YL Long YY Zhang Y Liao ST Liu B Qin LP Nong Q Zhang WL Three new species of Conlarium from sugarcane rhizosphere in southern China MycoKeys 2019a 56 1 11 10.3897/MYCOKEYS.56.35857 31327928 Xie et al. (2019b) Xie XG Zhang FM Wang XX Li XG Dai CC Phomopsis liquidambari colonization promotes continuous cropping peanut growth by improving the rhizosphere microenvironment, nutrient uptake and disease incidence Journal of the Science of Food and Agriculture 2019b 99 4 1898 1907 10.1002/JSFA.9385 30267426 Xu et al. (2022) Xu H Yan L Zhang M Chang X Zhu D Wei D Naeem M Song C Wu X Liu T Chen W Yang W Changes in the density and composition of rhizosphere pathogenic Fusarium and beneficial Trichoderma contributing to reduced root rot of intercropped soybean Pathogens 2022 11 4 478 10.3390/PATHOGENS11040478/S1 35456153 You et al. (2014) You MP Lanoiselet V Wang CP Barbetti MJ First report of Alternaria leaf spot caused by Alternaria tenuissima on blueberry (Vaccinium corymbosum) in Western Australia Plant Disease 2014 98 3 423 10.1094/PDIS-07-13-0737-PDN Yu et al. (2020) Yu YY Xu Jda Huang TX Zhong J Yu H Qiu JP Guo JH Combination of beneficial bacteria improves blueberry production and soil quality Food Science & Nutrition 2020 8 11 5776 5784 10.1002/FSN3.1772 33282230 Yu et al. (2021) Yu Z Wang Z Zhang Y Wang Y Liu Z Biocontrol and growth-promoting effect of Trichoderma asperellum TaspHu1 isolate from Juglans mandshurica rhizosphere soil Microbiological Research 2021 242 1 126596 10.1016/J.MICRES.2020.126596 33007636 Zhang, Liu & Zhang (2022) Zhang Y Liu JB Zhang XX A more drought resistant stem xylem of southern highbush than rabbiteye blueberry is linked to its anatomy Agronomy 2022 12 5 1244 10.3390/AGRONOMY12051244 Zhang et al. (2017) Zhang Y Shen H He X Thomas BW Lupwayi NZ Hao X Thomas MC Shi X Fertilization shapes bacterial community structure by alteration of soil pH Frontiers in Microbiology 2017 8 JUL 1325 10.3389/FMICB.2017.01325 28769896 Zhao et al. (2022) Zhao L Sun W Zhao L Zhang L Yin Y Zhang Y Neofusicoccum vaccinii: a novel species causing stem blight and dieback of blueberries in China Plant Disease 2022 106 9 2338 2347 10.1094/PDIS-09-21-2068-RE 35100841 Zhou et al. (2022) Zhou Y Liu Y Zhang X Gao X Shao T Long X Rengel Z Effects of soil properties and microbiome on highbush blueberry (Vaccinium corymbosum) growth Agronomy 2022 12 6 1263 10.3390/AGRONOMY12061263