==== Front PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0288068 PONE-D-23-04772 Research Article Biology and Life Sciences Evolutionary Biology Evolutionary Systematics Phylogenetics Phylogenetic Analysis Biology and Life Sciences Taxonomy Evolutionary Systematics Phylogenetics Phylogenetic Analysis Computer and Information Sciences Data Management Taxonomy Evolutionary Systematics Phylogenetics Phylogenetic Analysis Biology and Life Sciences Genetics Genomics Biology and Life Sciences Organisms Eukaryota Plants Fruits Citrus Biology and Life Sciences Microbiology Virology Virus Effects on Host Gene Expression Biology and Life Sciences Genetics Genomics Microbial Genomics Viral Genomics Biology and Life Sciences Microbiology Microbial Genomics Viral Genomics Biology and Life Sciences Microbiology Virology Viral Genomics Biology and Life Sciences Biochemistry Enzymology Enzymes Proteases Biology and Life Sciences Biochemistry Proteins Enzymes Proteases Biology and Life Sciences Computational Biology Genome Analysis Gene Prediction Biology and Life Sciences Genetics Genomics Genome Analysis Gene Prediction Biology and Life Sciences Computational Biology Genome Analysis Transcriptome Analysis Biology and Life Sciences Genetics Genomics Genome Analysis Transcriptome Analysis Complete genome sequencing and characterization of a potential new genotype of Citrus tristeza virus in Iran A potential new genotype of Citrus tristeza virus in Iran https://orcid.org/0000-0002-2183-0033 Ghorbani Abozar Conceptualization Writing – original draft 1 * Faghihi Mohammad Mehdi Validation Writing – review & editing 2 Falaki Faezeh Validation Visualization 3 Izadpanah Keramatollah Supervision Writing – review & editing 4 1 Nuclear Science and Technology Research Institute, Nuclear Agriculture Research School, Karaj, Iran 2 Plant Protection Research Department, Fars Agricultural and Natural Resources Research and Education Centre, AREEO, Zarghan, Iran 3 Department of Plant Protection, College of Agriculture Sciences and Food Industries, Science and Research Branch, Islamic Azad University, Tehran, Iran 4 Plant Virology Research Centre, College of Agriculture, Shiraz University, Shiraz, Iran Farzadfar Shirin Editor Iranian Research Institute of Plant Protection, ISLAMIC REPUBLIC OF IRAN Competing Interests: The authors have declared that no competing interests exist. * E-mail: abghorbany@aeoi.org.ir 29 6 2023 2023 18 6 e028806817 2 2023 17 6 2023 © 2023 Ghorbani et al 2023 Ghorbani et al https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Citrus tristeza virus (CTV) is one of the economically destructive viruses affecting citrus trees worldwide, causing significant losses in fruit production. Comparative genomic studies have shown genetic diversity in various regions of the genome of CTV isolates, which has classified the virus into several genotypes. In recent years, some orange citrumelo-tolerant rootstocks showed yellowing, decline, and vein clearing in northern Iran (Mazandaran province, Sari). We confirmed the presence of CTV in the symptomatic trees by reverse transcription PCR (RT-PCR). The complete genome of a Sari isolate of CTV (Sari isolate) was sequenced using next-generation sequencing (NGS) technology. In addition, phylogenetic analysis, differential gene expression of the virus and identification of its variants in a population were studied. We obtained the final contigs of the virus (nt) and annotated all genomes to viral ORFs, untranslated regions (UTRs), intergenic regions, and 5’ and 3’ ends of the genome. Phylogenetic analysis of the Sari isolate and other genotypes of CTV showed that the Sari isolates were placed in a distinct cluster without a sister group. Based on the number of specific transcripts (TPM) in CTV RNA -Seq, P13 was the most highly expressed gene related to the host range of the virus and its systemic infection. The ORFs of the polyprotein, P33, and P18 showed variation in a single population of the sari isolate. The CTV has a potential for variation in a population in a host, and these variations may contribute to the best fit of the CTV in different situations. In Iran, whole genome sequencing of the CTV was performed for the first time, and we gained new insights into CTV variation in a population. The authors received no specific funding for this work. Data AvailabilityAll relevant data are within the paper and its Supporting Information files. Data Availability All relevant data are within the paper and its Supporting Information files. ==== Body pmcIntroduction Citrus tristeza is an economically destructive disease affecting citrus trees throughout the world, causing significant losses in fruit production [1]. The causal agent of the disease, Citrus tristeza virus (CTV), is an RNA plant virus of the genus Closterovirus (family Closteroviridae) composed of a variety of strains. The virus host range is limited to Citrus and related species [2]. The symptomology and severity of CTV infection widely vary depending on the type of viral strain, host cultivar, and root-stock/scion combination. However, classic disease symptoms include stem-pitting, vein clearing, leaf cupping, and yellowing [3]. The CTV is distributed in the world as mild or severe strains. The main mode of transmission of CTV is through multiple aphid vectors including Aphis gossypii, Toxoptera citricida, A. citricola, T. aurantii, A. craccivora, and Myzus persicae [4–6]. Other spread pathways include graft transmission and plant material infested with aphid vectors [7]. CTV is a single-stranded positive-sense RNA virus and the genome is encapsulated by the major and minor coat proteins (CP and CPm, respectively) [8]. The complete genomes have been sequenced from the biologically and geographically distinct strains and reveal that the CTV has the largest plant viral genome. The sequences range from 19,226 to 19,306 nucleotides and are organized into 12 open reading frames (ORFs) which potentially encode for 17 proteins [9–11]. The most comprehensively studied part of the CTV genome is the CP gene which encodes for the major coat protein (25 KDa). The CP gene is commonly used for molecular typing of CTV isolates around the world [9,12–14]. ORF1 encodes a replication-associated protein (p349) directly translated from the genome (gRNA) and proteins p33, p6, p65, p61, p27, p25, p18, p13, p20 and p23 (5’ to 3’) expressed via 3′-terminal subgenomic RNAs (sgRNAs). Based on genome-wide sequence diversity, CTV isolates are classified as strains or genotypes. The recognized genotypes of CTV are constantly expanding and to date include T36, VT, T3, RB, T68, T30, HA16-5, S1, AT -1, and Taiwan-Pum. CTV strains are known to recombine frequently and the Maximum likelihood (ML) phylogenetic method has been used for classification [15]. Factors that may influence genetic diversity include geographic differences and mode of transmission [16]. Studying the whole genome of diverse isolates from around the world provides a deeper understanding of molecular epidemiology. In particular, the use of next-generation sequencing (NGS) tools such as RNA sequencing (RNA-Seq) is now a major focus in the field of plant virology for accurate and specific whole-genome analyses and rapid diagnoses [17,18]. In this study, high-throughput sequencing (HTS) was used to determine the genetic diversity and phylogenetic relationships for the Sari isolate of CTV. Materials and methods Ethics statement This research was carried out in the laboratories of the Shiraz University and Nuclear Science and Technology Research Institute. No other permits were required to conduct this research. We also confirm that no endangered or protected species were involved in the studies. Sample collection Samples of leaves and young shoot tips of sweet orange trees on citrumelo rootstocks showing various virus-like symptoms, including stem-pitting, vein clearing, leaf cupping, and yellowing, were collected in Mazandaran Province, Sari, Iran, in 2021–22. A total of five orchards were visited, and samples were stored individually in microfuge tubes at −80°C until processing. Samples were used for RT-PCR and RNA-Seq tests. RAN extraction and initial RT-PCR screening of CTV Total RNA was extracted from 100 mg of leaves using the TRIzol® reagent (USA) following the manufacturer’s instructions. RNA was quantified by Nanodrop® spectrophotometer (Thermo Fisher Scientific, USA). Total RNA was treated by DNase (Thermo Scientific). For initial RT-PCR screening of CTV, cDNA was synthesized with Random hexamer primers and an M-MuLV Reverse Transcriptase cDNA synthesis kit (Thermo Scientific). RT-PCR reaction was carried out in a total volume of 20 μL of reaction mixture containing 1 μL of cDNA as template, Taq DNA polymerase (Takara Bio, Otsu, Shiga, Japan), (1.25 U/50 μL) and capsid protein gene primers (forward: 5′ ATGGACGACGAAACAAAGAA 3′), (reverse: 5′ TCAACGTGTGTTGAATTTCC 3′) [19]. PCR reactions were performed using the Ampliqon Taq DNA Polymerase 2x Master Mix (Denmark) in a total volume of 12.5 μL containing 20 ng cDNA and 10 μM of each primer. The PCR condition comprised one initial denaturation cycle at 95°C for 10 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 75°C for 30 s, with a final extension step at 75°C for 10 min. Aliquots of PCR-amplified fragments were loaded on 1% agarose gels in Tris-borate (TBE) buffer (0.09 M Tris base, 0.09 M boric acid, 0.002 M EDTA, pH 8.0). A 100-bp DNA Ladder (Promega, Madison, WI) was used as a nucleic acid marker. After electrophoresis, the gels were stained with ethidium bromide at 0.5 μg/ml and then analyzed using a BIO imaging system (Syngene, Frederick, MD). RNA library prep and CTV whole genome sequencing Total RNA from three leaf samples of a tree was used for RNA-Seq. The rRNA was removed from the total RNA using a Ribo-zero rRNA Removal Kit (Epicentre, WI, USA). RNA-Seq libraries using TruSeq Stranded Total RNA for Illumina were prepared according to the manufacturer’s instructions and sequenced on the Illumina HiSeq 2000 platform (Novogene, China), generating paired-end reads of 150 bp. Bioinformatics analysis Data analysis of FASTQ files was performed using CLC Genomics Workbench (version 20, QIAGEN, Venlo, The Netherlands). Sequencing adaptors and low-quality sequences with ambiguous nucleotides were trimmed to obtain sequences of approximate size (using default parameters: Reads less than 15 nt were trimmed, ambiguous nucleotides maximum 2). FASTQ files of paired-end sequences from the library were assembled into transcriptomes de novo using CLC Genomic Workbench (word size 15, minimum length of contigs 150 nt). To distinguish and retrieve viral sequences from the entire transcriptome, the assembled transcriptome contigs were mapped to the chromosol and non-chromosol reference genome of Citrus (Citrus sinensis, GCF_000317415). Subsequently, the unmapped contigs were compared with sequences available in the NCBI viral reference database (https://www.ncbi.nlm.nih.gov/genome/viruses/) using the CLC BLAST tool, which is more reliable than other sequence similarity programs for virus identification (the E-value cut-off was 1e-5). Following the initial analysis, putative virus-associated contigs were compared with sequences in the NCBI NR (non-redundant proteins) database. Subsequently, endogenous virus-like sequences were removed from the data set, and virus-related contigs were retained for further analysis. Viral sequence mapping and genome assembly To assemble the whole viral genomes, the reads transcriptome sequences were aligned with a reference whole viral genome sequence (NC_001661). Sequences associated with the viral genome were mapped to the viral reference genome using Geneious Prime 2019, and consensus sequences were generated with a threshold of 95% identity. The viral-associated sequences were then analyzed using Geneious version R10 (Biomatters, New Zealand) for sequence trimming, nucleotide analysis, viral ORF determination, gene annotation, and phylogenetic analysis. In addition, the phylogenetic maximum likelihood tree was constructed using a 50% bootstrap threshold with 1000 bootstrap repeats and a score defined using the Kimura 2-parameter model (MEGA 11). Genomic diversity of CTV at interpopulation and intrapopulation levels To evaluate the genetic diversity of the selected CTVs at the ORF level, new reference sequences (accession number: OP900953) were generated from the RNA-Seq data examined using CLC Genomics Workbench. The clean reads were mapped to the viral contig genome. The minimum coverage, minimum variant frequency, and maximum variant P values were set to 2, 0.01, and 10−6, respectively. Single-nucleotide variants (SNVs) were filtered out as synonymous SNVs. The frequency and distribution of polymorphisms in ORFs of CTV (Sari isolate) for which transcriptome profiling was performed were assessed and values were compared. The Protein Data Bank (PDB) was downloaded from RCSB PDB (https://www.rcsb.org) to visualize SNVs in tertiary protein structures using CLC Genomics Workbench. Profiling the gene expression using RNA-Seq data Reads trimmed to RNA-Seq data were subjected to expression analysis by mapping all sequences to the synthesized master sequences. Transcript per million (TPM) was calculated for the detected ORFs using CLC Genomics Workbench, with the default parameters of the software and the length fraction and similarity fraction of 0.8. Phylogenetic analysis Phylogenetic trees for sequences deposited in the NCBI nucleotide database were constructed based on whole-genome and phylogenetic analysis. Briefly, the tree construction was based on the ClustalW alignment of the concatenating sequence of CTV using Geneious Prime 2019 and applying the maximum likelihood method in the MEGA11 program (Tamura et al., 2021). The substitution models used for each phylogenetic tree were selected via the best-fit model tool of MEGA software. Carrot yellow leaf virus (NC013007) was used as an out-group to root the tree, and bootstrapping (threshold: 60) was carried out using 1000 replicates. Results and discussion Symptomatology and conventional RT-PCR During the 2021–22 field surveys in different districts of Mazandaran Province, Sari, Iran, sweet orange trees (on citrumelo rootstocks) showed the typical tristeza symptoms including chlorosis, yellow leaves, leaf cupping, vein clearing, vein flecking, stem pitting and grooving, poor growth and decline condition, (Fig 1). Samples that showed diverse virus-like symptoms were screened by RT-PCR for the presence of CTV. The virus was detected in all symptomatic samples (5 samples) as indicated by the amplification of specific fragments with approximately 670 bp (Fig 2). No amplification was observed with the RNA templates of healthy citrus plants. 10.1371/journal.pone.0288068.g001 Fig 1 Citrus tristeza virus symptoms on sweet orange trees on citrumelo rootstocks. Yellowing of leaves (A) andstem pitting and grooving at graft union (B). 10.1371/journal.pone.0288068.g002 Fig 2 Electrophoresis pattern of RT-PCR products using total RNA extracts. Lane 1: A healthy orange seedling, Lane 2: Infected trees, Lane 3: CTV positive control, Lane 4: DNA ladder (Thermo Scientific, UK). Genome assembly of CTV After preprocessing the raw data (42,133,736 reads, 150 nt), clean reads (39,652,356) were obtained from the whole transcriptome sequencing sample. Subsequently, citrus-related reads (80%) were removed by comparing transcriptome contigs with the citrus sequences available in NCBI using MEGABLAST. Assembly of the remaining viral-associated reads produced 0.6% CTV-related contigs of 300 to 18,397 nt. No additional contigs with high sequence similarity to other viruses or viroids were detected from the transcriptomic reads. After assembly, we obtained the final contigs of the virus (19,300 nt), and we annotated all genomes at viral ORFs, untranslated regions (UTRs), intergenic regions, and 5’ and 3’ ends of the genome (Fig 3 and Table 1). 10.1371/journal.pone.0288068.g003 Fig 3 Schematic diagram of the CTV genome organization. The open boxes represent ORFs and their translation products. 10.1371/journal.pone.0288068.t001 Table 1 Genome features and ORFs ofCTV sequence of Sari isolate. Type Length (nt) Product Locus_tag 3’UTR 273 CDS 630 23-kDa protein CTVgp11 CDS 549 20-kDa protein CTVgp10 CDS 360 13-kDa protein CTVgp09 CDS 504 18-kDa protein CTVgp08 CDS 672 25-kDa coat protein CTVgp07 CDS 723 27-kDa protein CTVgp06 CDS 1611 61-kDa protein CTVgp05 CDS 1785 65-kDa protein CTVgp04 CDS 156 6-kDa protein CTVgp03 CDS 912 33-kDa protein CTVgp02 mat_peptide 7818 replicas CTVgp01 mat_peptide 1475 papain-like protease CTVgp01 mat_peptide 1454 papain-like protease CTVgp01 CDS 10750 401-kDa viral polyprotein CTVgp01 5’UTR 107 *CDS: Protein Coding Sequence. * mat_peptide: Mature peptide. Phylogenetic analysis of full-length CTV sequences Phylogenetic analysis of the Sari isolate and other genotypes of CTV that were downloaded from NCBI was performed. The maximum likelihood method and whole genome sequence of CTV genotypes were used for genotype clustering. Phylogenetic analysis of our data revealed that the Sari isolate (accession number OP900953) was placed in a distinct cluster from other genotypes and not in a sister group with a known genotype (Fig 4). On the other hand, identifying the similarity matrix of the Sari isolate with others showed at least 80% identity with other genotypes and the highest similarity (92%) with the T3 genotype (S1 File). 10.1371/journal.pone.0288068.g004 Fig 4 Phylogenetic tree based on full-length genomes of the Sari isolate (Sari, shown with the red circle) of CTV, and the isolates from GenBank shown as accession number and country of origin. The tree was constructed by the maximum likelihood method using MEGA 11 software. Numbers on branches are bootstrap values of 1,000 replicates. Beet yellows virus was used as an outgroup : T30, : L1, : T3, : HA-65, : VT, : T68, : S1, : HA-65, : A18, : This study, : RB, : M1, : T36, : Outgroup. Differential expression of CTV ORFs Raw transcriptomic data were used to profile the differential gene expression of CTV in citrus transcriptomic data. Differentially expressed genes (DEGs) were characterized for RNA-Seq data (adjusted-value p < 0.01) (Fig 5). Based on the number of specific transcripts (TPM) identified in CTV RNA-Seq. P13 which is positioned toward the 3′ termini of the genome near the CP gene, was the most highly expressed gene than the 5′ terminal gene encoding polyprotein and P6 protein which is related to the host range (Fig 5). P13 has the same function as P18 and P23. A quantitative comparison of TPM reads showed that the gene P13 is the most abundantly expressed transcript, followed by genes P20 and CPm. The P6 ORF showed lower TPM in this study. 10.1371/journal.pone.0288068.g005 Fig 5 Expression levels (transcript per million, TPM) of Citrus tristeza virus (CTV) Gene IDs in RNA-seq data of citrus infected with CTV. The P13 protein resulted in systemic infection of calamondin was required for infection of a broader range of citrus varieties [20]. It is also reported to interact with the P20, P23 and P33 [21]. However, other functions of the P13 have not been elucidated yet and the highest expression of this gene warrants further study of its function. The P20 protein has a key role in the suppression of RNA silencing [22] and might block the loading of CTV sRNAs into the RNA silencing complex or interfere with it through alternative mechanisms [23]. The CPm protein was the third highest-expressed gene with functions in virus movement and assembly. These results show that CTV needs more copies of P13, P20, and CPm as they are related to the virus infection, replication and movement. SNV profiling on CTV draft genome Using RNA-Seq data, this study was able to determine the SNVs on an unprecedented scale for the CTV population. For better coverage and access to all micro and macro variants of CTV in the citrus tree, we mapped the raw reads to the CTV sequence obtained from this study. Identification of these SNVs is critical to understanding the potential of CTV variation. SNV was determined by annotating ORFs for the virus population. At least 15 sites displayed substantial differences with frequency ranging from 33% to 100% across the mapped reads when applied with a threshold of 1% for SNV detection. We filtered synonymous SNVs that did not change amino acids. The positions of SNVs in the coding regions of CTV annotated ORFs were in the polyprotein ORF (13 SNVs), P33 ORF (1 SNV) and P18 ORF (1 SNV) (Table 2). The CP genes were the most conserved and represented the same SNVs reported by previous studies [24]. Most SNVs in polyprotein were on papain-like proteins and four SNVs were observed in replication protein. Fig 6 shows the exact location of SNVs in the tertiary structure of the polyprotein which may suggest potential areas for further research into the mechanisms underlying virus-host interactions and understanding the molecular mechanisms underlying the effects of specific SNVs on the virus. Polyproteins are the biggest protein in CTV and have several functions. 10.1371/journal.pone.0288068.g006 Fig 6 The tertiary structure of polyprotein and location of SNVs (red color). A and B are figures of polyproteins from different views. 10.1371/journal.pone.0288068.t002 Table 2 SNVs in the full-length genome of CTV, Sari isolate. Name Type Reference Allele Count Coverage Frequency Polyprotein Glu236Asp (Papain-like protease) SNV A T 3 3 100 Polyprotein Ala242Val (Papain-like protease) SNV C T 3 3 100 Polyprotein Ile246Thr (Papain-like protease) SNV T C 3 3 100 Polyprotein Arg248Pro (Papain-like protease) SNV G C 3 3 100 Polyprotein Ile252Leu (Papain-like protease) MNV GA CC 3 3 100 Polyprotein Leu255Arg (Papain-like protease) MNV TC GA 3 3 100 Polyprotein Ala313Val (Papain-like protease) SNV C T 3 3 100 Polyprotein Tyr323His (Papain-like protease) SNV T C 3 3 100 Polyprotein Arg327Trp (Papain-like protease) SNV A T 4 4 100 Polyprotein Thr2748Ala (Replicase) SNV A G 3 3 100 Polyprotein Asp2919Glu (Replicase) MNV TT AC 3 3 100 Polyprotein Arg2931Pro (Replicase) SNV G C 3 3 100 Polyprotein Val2934Ala (Replicase) MNV TA CG 3 3 100 P33 Val111Leu SNV G T 2 3 66.66 P18 Ala166Val SNV C T 2 6 33.33 The P33 protein has multiple functions. It is a unique non-conserved movement protein that also interacts with plant immunity [25]. In addition, the P33 has an important role in the ability of a CTV variant to protect the host from superinfection by a second closely related virus variant [26]. While the CP protein of the virus is involved in virion assembly and virus translocation, P33 controls the asymmetrical accumulation of the positive- and negative-stranded RNAs during viral replication [27]. A recent study demonstrated that p33 participates in many different viral processes, and interacts with multiple protein partners such as CP, p20, and p23 [21]. The P33, P18, and P13 have been shown to expand the virus host range. For instance, several citrus genotypes can be infected with virus mutants containing deletions in those three genes [20]. The differences between strains in the different regions showed the recombination in the parental CTV genome that changed over a long time in different hosts [28]. It has been suggested that if a mixture of severe and mild strains of CTV exist in infected plant cells at different levels, the restriction of disease development can happen by a larger amount of mild viral genome, even though the other strain of the virus remains at low ratios in the viral populations [29]. Mixed viral infections of citrus trees are usually expected as they may be visited by viruliferous aphids multiple times leading to the transmission of different strains of CTV to the same tree. Consequently, it is supposed that in the numerous infected citrus trees, there are co-infections of different strains of the virus [29]. The distribution of the mild strains of CTV in a region implies good adaptation of the virus to its host [29,30]. This study does not provide direct evidence of mixed infections of different strains or variants in the sample or sequences. However, our findings do support the idea that mixed infections are possible in citrus trees. Previous studies have shown that the CTV genotypes can be changed after passage through different hosts [31]. Studies demonstrated the existence of genotype population modification in the genotype of a single isolate after passage through two different hosts, demonstrating that the presence and dominance of population genotypes were modified by virus transmission from sweet orange to Mexican lime [31,32]. So, CTV has a variation potential in a population in a host which our results confirm previous studies and these variations can support CTV for best fit in a different situation. Conclusion We sequenced and analyzed the complete genome of a CTV isolate for the first time from Iran. Phylogenetic analysis of the whole genome shows that this isolate is distinct from other isolates in the GenBank. Additionally, our study of the differential gene expression of the virus revealed that the P13 ORF was highly expressed in infected plants. Previous research has suggested that P13 plays a key role in the systemic infection and host range of the virus. Therefore, the high expression of P13 in infected plants suggests that it may be important for the virus to successfully infect and replicate within its host. The potential implications of this finding include the possibility of targeting P13 for the development of new control strategies for CTV. Our study of the potential variation of the virus in citrus trees revealed that the Sari isolate of CTV had mild variation, which could contribute to the virus’s best fit in different environmental conditions. This potential variation has also been reported in previous studies [31,32], which suggests that it could be a fitness tool for the virus. Our findings add to this body of research and provide new insights into the potential for CTV to adapt to different host environments. Supporting information S1 File Similarity matrix of full-length genomes of the Sari isolate of CTV and the isolates from GenBank. (CSV) Click here for additional data file. S1 Raw images (TIF) Click here for additional data file. 10.1371/journal.pone.0288068.r001 Decision Letter 0 Zhou Jianhong Staff Editor © 2023 Jianhong Zhou 2023 Jianhong Zhou https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version0 27 Apr 2023 PONE-D-23-04772Complete genome sequencing and characterization of a potential new genotype of Citrus tristeza virus in IranPLOS ONE Dear Dr. Ghorbani, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jun 10 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Jianhong Zhou Staff Editor PLOS ONE Journal requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. In your Methods section, please provide additional information regarding the permits you obtained for the work. Please ensure you have included the full name of the authority that approved the field site access and, if no permits were required, a brief statement explaining why. 3. Thank you for stating the following financial disclosure: “NO, The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” At this time, please address the following queries: a) Please clarify the sources of funding (financial or material support) for your study. List the grants or organizations that supported your study, including funding received from your institution. b) State what role the funders took in the study. If the funders had no role in your study, please state: “The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” c) If any authors received a salary from any of your funders, please state which authors and which funders. d) If you did not receive any funding for this study, please state: “The authors received no specific funding for this work.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 5. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. Additional Editor Comments: The paper writes on complete CTV genomes from Iran. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Partly Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: Manuscript novelty is mainly based on reporting a full genome of an Iranian CTV isolate for the first time. The manuscript needs several corrections and revisions and it is not acceptable in this format. I entered suggestions and comments using Editing Tools in the PDF file of the manuscript and send it as an attached file. After revision, I recommend to re-review it. Reviewer #2: It's a very important article and affirmative information. Overall, the manuscript describes important results indicating a potential new genotype of the Citrus tristeza virus in Iran which should appeal to the journal's readers worldwide. In addition, the characterization of the virus was well described and key to the role of the P13 in the plant. It needs some very minor revisions in this article. The following are some suggestions to make it suitable to publish with red color in the attached article. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Samah Abdel Salam Mokbel ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Attachment Submitted filename: PONE-D-23-04772_reviewer.pdf Click here for additional data file. Attachment Submitted filename: Attached article PONE-D-23-04772.pdf Click here for additional data file. 10.1371/journal.pone.0288068.r002 Author response to Decision Letter 0 Submission Version1 31 May 2023 Please note that PLOS ONE requires submissions reporting blot or gel data to comply in full with the reporting requirements described at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements. We now require authors to provide the original unadjusted and uncropped images for any blot or gel data reported in PLOS ONE submissions. In our internal checks for your submission, we noted that you did not provide original raw image files supporting blot/gel data in response to our previous request. Response: We replaced Fig 2 with other fig form our gel Figures and added the original Fig as supporting information. Reviewer #1: The manuscript novelty is mainly based on reporting a full genome of an Iranian CTV isolate for the first time. The manuscript needs several corrections and revisions and it is not acceptable in this format. I entered suggestions and comments using Editing Tools in the PDF file of the manuscript and send it as an attached file. After revision, I recommend to re-review it. Response: Many thanks for your careful review of the manuscript. Surly, your comments would improve our manuscript. We respond to your comments point by point in this file and show changes using highlights in the text. I hope our response would meet your concerns. Line 32. Please delete, Not related to the results of this work. Response: Done Line 35. FTV? Response: This was corrected to “CTV” Line 103. What was the original tissues for RNA extraction? (One or more trees? sample pooling?...) Response: We added “Total RNA from three leaf samples of a tree was used for RNA-Seq” in the text. Line 105. Please add where did the Illumina sequencing was done? (by the authors' lab or commercial services) Response: We added the “HiSeq 2000 platform (Novogene, China)” to the text. Line 137. I can not find data regarding these reference sequences at the Results Section. Response: We edited this section and added “(accession number: OP900953)” in the text Line 140. Please provide the full name of SNP on first mention in the text Response: We edited the text as“Single-nucleotide variant (SNV)” Line 142. Please clear which isolates were used for SNPs? Response: Sari isolate. We corrected the text. Line 149. 1-Provide the full name of RPKM on first mention in the text. 2-In different sections of the text, RPKM and TPM were used instead of each other and confusing. Please check, which expression value setting is used? Response: TMP is correct. We edited the text. Line 169. All or one of these samples was used for NGS? Response: We added “Total RNA from three leaf samples of a tree was used for RNA-Seq” in the text. Lines 186-187. In fig 4., please add a legend describing color of circles for each genotype. Response: Thank you for your best suggestion; we added a legend describing color for Fig 4. Line 188. Please give a name to this isolate and refer to it in the text. Response: Thank you for your suggestion; we used “Sari isolate” Line 188. Please show identity table for full genome and ORFs according to CTV sequences used in this analysis. Response: Thank you for your suggestion. We added a Table entitled “Table 1. Genome features and ORFs of CTV sequence of Sari isolate” to our manuscript. Line 212. One sample was used for RNA seq and SNVs would be better than SNPs to use in this study. Response: We changed “SNP” to “SNV” in the whole text. Line 222-223. what is the aim of showing this figure? Response: The aim of showing the figure that displays the location of Single Nucleotide Variations (SNVs) in the tertiary structure of the polyprotein of citrus tristeza virus is to visually demonstrate the location and distribution of genetic variations within the polyprotein. The figure allows the reader to quickly identify the specific sites of genetic variation and understand how they may relate to the function and structure of the protein. Also, the figure may provide insights into how the virus has evolved over time, and may suggest potential areas for further research into the mechanisms underlying virus-host interactions. Additionally, the information presented in the figure can be used as a guide for the design of future studies, such as experiments aimed at understanding the molecular mechanisms underlying the effects of specific SNVs on the virus. But we just analyzed for polyprotein and information for tertiary structure of P33 and P18 was missed in the PDB database. So, to make it more we added this sentence in the text (Section: SNV profiling on CTV draft genome). “that may suggest potential areas for further research into the mechanisms underlying virus-host interactions and understanding the molecular mechanisms underlying the effects of specific SNVs on the virus.” Line 223. Three dimensional structure or tertiary structure Response: Thank you for your correction; we changed the “Three-dimensional structure” to the “tertiary structure” in the whole text. Line 238-247. Do your findings support this discussion? According your findings, are there mixed infection of different strains or variants in your sample or sequences? Response: Our study provides evidence of variation in the CTV population in the infected citrus trees in Iran, which is consistent with the idea of mixed infections of different strains of the virus. However, our study did not directly investigate the presence of mixed infections in our samples or sequences, and further research would be needed to confirm this hypothesis. Because of your question, we added this paragraph to the manuscript. “This study does not provide direct evidence of mixed infections of different strains or variants in the sample or sequences. Line 260. How this key role can be inferred from high expression? Response: Thank you for your comment. We edited this section in the Conclusion section. “We sequenced and analyzed the complete genome of a CTV isolate for the first time from Iran. Phylogenetic analysis of the whole genome shows that this isolate is distinct from other isolates in the GenBank. Additionally, our study of the differential gene expression of the virus revealed that the P13 ORF was highly expressed in infected plants. Previous research has suggested that P13 plays a key role in the systemic infection and host range of the virus (Tatineni et al., 2011.) Tatineni S, Robertson CJ, Garnsey SM, Dawson WO. A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proceedings of the National Academy of Sciences. 2011;108(42):17366-71 Lines 260-262. Previous works showed this potential variation in CTV populations as a fitness tool. Response: Thank you for your comment. We are aware that previous studies have reported on the potential variation in CTV populations as a fitness tool, and our study builds upon this important finding. Our research not only confirms the presence of mild variants within a population of the Sari isolate but also highlights the potential implications of this variation for the virus's ability to adapt to different environments and hosts. So, we edited this section in the Conclusion section.. This potential variation has also been reported in previous studies, which suggests that it could be a fitness tool for the virus. Our findings add to this body of research and provide new insights into the potential for CTV to adapt to different host environments.” Line 270. In M&M Section, you mentioned about sampling from sweet orange trees on citrumelo rootstoks, so, is it showing in Fig 1-A ? (not citrumelo tree?). Response: We edited the Fig 1 caption. “Fig 1. Citrus tristeza virus symptoms on sweet orange trees on citrumelo rootstocks. Yellowing of leaves (A) and stem pitting and grooving at graft union (B).” Line 271. “grooving at” We edited and separate these two words in the text. Reviewer #2: It's a very important article and affirmative information. Overall, the manuscript describes important results indicating a potential new genotype of the Citrus tristeza virus in Iran which should appeal to the journal's readers worldwide. In addition, the characterization of the virus was well described and key to the role of the P13 in the plant. It needs some very minor revisions in this article. The following are some suggestions to make it suitable to publish with red color in the attached article. Response: Many thanks for your best editing of the manuscript. Surly, your comments would improve our manuscript. We respond to your comments point by point in this file and show changes using highlights in the text. I hope our response meets your concerns. Lines 34-35. FTV? Response: This was corrected in the text. Line 206. Separate Response: This was corrected in the text. Line 208. Add “,” Response: This was corrected in the text. Line 227. Remove “Fig 6” word. Response: This was corrected in the text. Line 366. add “and” Response: This was corrected in the text. Line 371. Separate Response: This was corrected in the text. Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0288068.r003 Decision Letter 1 Farzadfar Shirin Guest Editor © 2023 Shirin Farzadfar 2023 Shirin Farzadfar https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 19 Jun 2023 Complete genome sequencing and characterization of a potential new genotype of Citrus tristeza virus in Iran PONE-D-23-04772R1 Dear Dr. Ghorbani, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Guest Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10.1371/journal.pone.0288068.r004 Acceptance letter Farzadfar Shirin Guest Editor © 2023 Shirin Farzadfar 2023 Shirin Farzadfar https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 21 Jun 2023 PONE-D-23-04772R1 Complete genome sequencing and characterization of a potential new genotype of Citrus tristeza virus in Iran Dear Dr. Ghorbani: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Shirin Farzadfar Guest Editor PLOS ONE ==== Refs References 1 Bar-Joseph M , Marcus R , Lee RF . The continuous challenge of citrus tristeza virus control. Annual Review of Phytopathology. 1989;27 (1 ):291–316. 2 Dawson WO , Garnsey SM , Tatineni S , Folimonova SY , Harper SJ , Gowda S . Citrus tristeza virus-host interactions. Frontiers in Microbiology. 2013;4 :88. doi: 10.3389/fmicb.2013.00088 23717303 3 Moreno P , Ambrós S , Albiach‐Martí MR , Guerri J , Pena L . Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Molecular Plant Pathology. 2008;9 (2 ):251–68. doi: 10.1111/j.1364-3703.2007.00455.x 18705856 4 Yokomi R , Polek M , Gumpf D . Transmission and spread of Citrus tristeza virus in Central California. Citrus Tristeza Virus Complex and Tristeza Diseases American Phytopathological Society, St Paul, MN. 2010:151–65. 5 Delkhosh H , Tousi N , D’Onghia K . Historical review of Citrus tristeza virus and its vectors in Iran. Citrus tristeza virus and Toxoptera citricidus: a serious threat to the Mediterranean citrus industry. 2009:135–40. 6 Benítez-Galeano MJ , Vallet T , Carrau L , Hernández-Rodríguez L , Bertalmío A , Rivas F , et al . Complete genome sequence of a novel recombinant citrus tristeza virus, a resistance-breaking isolate from Uruguay. Genome Announcements. 2018;6 (22 ):e00442–18. doi: 10.1128/genomeA.00442-18 29853501 7 Hajeri S , Killiny N , El-Mohtar C , Dawson WO , Gowda S . Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing). Journal of Biotechnology. 2014;176 :42–9. doi: 10.1016/j.jbiotec.2014.02.010 24572372 8 Febres V , Ashoulin L , Mawassi M , Frank A , Bar-Joseph M , Manjunath K , et al . The p27 protein is present at one end of citrus tristeza virus particles. Phytopathology. 1996;86 (12 ):1331–5. 9 Pappu H , Pappu S , Niblett C , Lee R , Civerolo E . Comparative sequence analysis of the coat proteins of biologically distinct citrus tristeza closterovirus isolates. Virus Genes. 1993;7 :255–64. doi: 10.1007/BF01702586 8279124 10 Karasev A , Boyko V , Gowda S , Nikolaeva O , Hilf M , Koonin E , et al . Complete sequence of the citrus tristeza virus RNA genome. Virology. 1995;208 (2 ):511–20. doi: 10.1006/viro.1995.1182 7747424 11 Harper S , Dawson T , Pearson M . Isolates of Citrus tristeza virus that overcome Poncirus trifoliata resistance comprise a novel strain. Archives of Virology. 2010;155 :471–80.20352212 12 Roy A , Ramachandran P , Brlansky R . Grouping and comparison of Indian citrus tristeza virus isolates based on coat protein gene sequences and restriction analysis patterns. Archives of Virology. 2003;148 :707–22. doi: 10.1007/s00705-002-0947-7 12664295 13 Biswas KK , Tarafdar A , Sharma SK . Complete genome sequence of mandarin decline Citrus tristeza virus of the Northeastern Himalayan hill region of India: comparative analyses determine recombinant. Archives of Virology. 2012;157 :579–83. doi: 10.1007/s00705-011-1165-y 22160128 14 Wu G-W , Tang M , Wang G-P , Jin F-Y , Yang Z-K , Cheng L-J , et al . Genetic diversity and evolution of two capsid protein genes of citrus tristeza virus isolates from China. Archives of Virology. 2015;160 :787–94. doi: 10.1007/s00705-014-2281-2 25387862 15 Wang J , Zhou T , Shen P , Zhang S , Cao M , Zhou Y , et al . Complete genome sequences of two novel genotypes of Citrus tristeza virus infecting Poncirus trifoliata in China. Journal of Plant Pathology. 2020;102 :903–7. 16 Korkmaz S , Karanfil A , Satar S , Uslu T , Koç NK , Çevik B . Effects of graft and aphid transmission on the genetic diversity and population structure of Turkish citrus tristeza virus isolates. European Journal of Plant Pathology. 2022;162 (2 ):369–88. 17 Jones S , Baizan-Edge A , MacFarlane S , Torrance L . Viral diagnostics in plants using next generation sequencing: computational analysis in practice. Frontiers in Plant Science. 2017;8 :1770. doi: 10.3389/fpls.2017.01770 29123534 18 Ghorbani A , Izadpanah K , Dietzgen RG . Gene expression and population polymorphism of maize Iranian mosaic virus in Zea mays, and intracellular localization and interactions of viral N, P, and M proteins in Nicotiana benthamiana. Virus Genes. 2018;54 :290–6.29450759 19 Huang Z , Rundell PA , Guan X , Powell CA . Detection and isolate differentiation of Citrus tristeza virus in infected field trees based on reverse transcription-polymerase chain reaction. Plant Disease. 2004;88 (6 ):625–9. doi: 10.1094/PDIS.2004.88.6.625 30812582 20 Tatineni S , Robertson CJ , Garnsey SM , Dawson WO . A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proceedings of the National Academy of Sciences. 2011;108 (42 ):17366–71. doi: 10.1073/pnas.1113227108 21987809 21 Dao TNM , Kang S-H , Bak A , Folimonova SY . A non-conserved p33 protein of Citrus tristeza virus interacts with multiple viral partners. Molecular Plant-Microbe Interactions. 2020;33 (6 ):859–70. doi: 10.1094/MPMI-11-19-0328-FI 32141354 22 Chen AY , Peng JH , Polek M , Tian T , Ludman M , Fátyol K , et al . Comparative analysis identifies amino acids critical for citrus tristeza virus (T36CA) encoded proteins involved in suppression of RNA silencing and differential systemic infection in two plant species. Molecular Plant Pathology. 2021;22 (1 ):64–76. doi: 10.1111/mpp.13008 33118689 23 Ruiz-Ruiz S , Navarro B , Peña L , Navarro L , Moreno P , Di Serio F , et al . Citrus tristeza virus: Host RNA silencing and virus counteraction. Citrus Tristeza Virus: Methods and Protocols. 2019;195–207. 24 Erkiş-Güngör G , Çevik B . Genetic Diversity and phylogenetic analysis of Citrus tristeza virus isolates from Turkey. Advances in Virology. 2019;2019. doi: 10.1155/2019/7163747 30906322 25 Sun YD , Folimonova SY . The p33 protein of Citrus tristeza virus affects viral pathogenicity by modulating a host immune response. New Phytologist. 2019;221 (4 ):2039–53. doi: 10.1111/nph.15482 30220089 26 Folimonova SY . Superinfection exclusion is an active virus-controlled function that requires a specific viral protein. Journal of Virology. 2012;86 (10 ):5554–61. doi: 10.1128/JVI.00310-12 22398285 27 Satyanarayana T , Gowda S , Ayllón MaA, Albiach-Martí MaR, Rabindran S, Dawson WO. The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulation. Journal of Virology. 2002;76 (2 ):473–83.11752137 28 Biswas KK , Palchoudhury S , Sharma SK , Saha B , Godara S , Ghosh DK , et al . Analyses of 3’half genome of citrus tristeza virus reveal existence of distinct virus genotypes in citrus growing regions of India. VirusDisease. 2018;29 :308–15. doi: 10.1007/s13337-018-0456-2 30159365 29 Herrera-Isidrón L , Ochoa-Sánchez JC , Rivera-Bustamante R , Martínez-Soriano JP . Sequence diversity on four ORFs of Citrus tristeza virus correlates with pathogenicity. Virology Journal. 2009;6 :1–10.19126194 30 Harper SJ . Citrus tristeza virus: evolution of complex and varied genotypic groups. Frontiers in Microbiology. 2013;4 :93. doi: 10.3389/fmicb.2013.00093 23630519 31 Camps R , Fiore N , Riquelme N , Barros-Parada W , Besoain X . Genotype variation of citrus tristeza virus after passage on different hosts, and changes in the virus genotype populations by the vector Aphis gossypii. Phytopathologia Mediterranea. 2022;61 (1 ):55–63. 32 Harper S , Cowell S , Dawson W . Finding balance: Virus populations reach equilibrium during the infection process. Virology. 2015;485 :205–12. doi: 10.1016/j.virol.2015.07.017 26291064