==== Front PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0287694 PONE-D-23-03115 Research Article Biology and life sciences Organisms Viruses RNA viruses Flaviviruses Hepacivirus Hepatitis C virus Biology and life sciences Microbiology Medical microbiology Microbial pathogens Viral pathogens Flaviviruses Hepacivirus Hepatitis C virus Medicine and health sciences Pathology and laboratory medicine Pathogens Microbial pathogens Viral pathogens Flaviviruses Hepacivirus Hepatitis C virus Biology and life sciences Organisms Viruses Viral pathogens Flaviviruses Hepacivirus Hepatitis C virus Biology and life sciences Microbiology Medical microbiology Microbial pathogens Viral pathogens Hepatitis viruses Hepatitis C virus Medicine and health sciences Pathology and laboratory medicine Pathogens Microbial pathogens Viral pathogens Hepatitis viruses Hepatitis C virus Biology and life sciences Organisms Viruses Viral pathogens Hepatitis viruses Hepatitis C virus Biology and Life Sciences Molecular Biology Macromolecular Structure Analysis Protein Structure Protein Structure Prediction Biology and Life Sciences Biochemistry Proteins Protein Structure Protein Structure Prediction Physical Sciences Chemistry Chemical Compounds Organic Compounds Amino Acids Amino Acid Substitution Physical Sciences Chemistry Organic Chemistry Organic Compounds Amino Acids Amino Acid Substitution Biology and Life Sciences Biochemistry Proteins Amino Acids Amino Acid Substitution Biology and life sciences Molecular biology Macromolecular structure analysis RNA structure Biology and life sciences Biochemistry Nucleic acids RNA RNA structure Biology and Life Sciences Molecular Biology Macromolecular Structure Analysis Protein Structure Protein Structure Comparison Biology and Life Sciences Biochemistry Proteins Protein Structure Protein Structure Comparison Biology and Life Sciences Molecular Biology Macromolecular Structure Analysis Protein Structure Biology and Life Sciences Biochemistry Proteins Protein Structure Biology and Life Sciences Molecular Biology Molecular Biology Techniques Sequencing Techniques Protein Sequencing Research and Analysis Methods Molecular Biology Techniques Sequencing Techniques Protein Sequencing Biology and Life Sciences Genetics Mutation Point Mutation An amino acid substitution in HCV core antigen limits its use as a reliable measure of HCV infection compared with HCV RNA HCV core antigen limits its use HCV core antigen limits its use Hansoongnern Payuda Conceptualization Formal analysis Methodology Resources Writing – original draft Writing – review & editing 1 Pratedrat Pornpitra Methodology 1 Nilyanimit Pornjarim Methodology 1 Wasitthankasem Rujipat Data curation Investigation Methodology Visualization Writing – review & editing 1 2 Posuwan Nawarat Data curation 1 Wanlapakorn Nasamon Visualization Writing – original draft 1 https://orcid.org/0000-0002-9250-661X Kodchakorn Kanchanok Methodology 3 Kongtawelert Prachya Formal analysis Methodology 3 Pimsing Napaporn Data curation Investigation 4 https://orcid.org/0000-0002-2337-6807 Poovorawan Yong Conceptualization Funding acquisition Investigation Methodology Project administration Resources Validation Writing – original draft 1 5 * 1 Center of Excellence in Clinical Virology, Department of Pediatrics, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand 2 National Biobank of Thailand, National Science and Technology Development Agency, Pathum Thani, Thailand 3 Thailand Excellence Center for Tissue Engineering and Stem Cells, Department of Biochemistry, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand 4 Non-Communicable Disease Control Group, Phetchabun Provincial Health Office, Phetchabun, Thailand 5 Fellow of the Royal Society of Thailand (FRS[T]), the Royal Society of Thailand, Sanam Sueapa, Bangkok, Thailand Gededzha Maemu Petronella Editor University of the Witwatersrand, SOUTH AFRICA Competing Interests: The authors have declared that no competing interests exist. * E-mail: yong.p@chula.ac.th 29 6 2023 2023 18 6 e02876943 2 2023 12 6 2023 © 2023 Hansoongnern et al 2023 Hansoongnern et al https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Hepatitis C virus (HCV) is a viral pathogen that causes chronic hepatitis, which can lead to cirrhosis and hepatocellular carcinoma. Detection of HCV RNA is the standard method used to diagnose the disease and monitor antiviral treatment. A quantification assay for the HCV core antigen (HCVcAg) has been proposed as a simplified alternative to the HCV RNA test for predicting active HCV infection, with the aim of achieving the global goal of eliminating hepatitis. The objective of this study was to determine the correlation between HCV RNA and HCVcAg, as well as the impact of amino acid sequence heterogeneity on HCVcAg quantification. Our findings demonstrated a strong positive correlation between HCV RNA and HCVcAg across all HCV genotypes (1a, 1b, 3a, and 6), with correlation coefficients ranging from 0.88 to 0.96 (p < 0.001). However, in some cases, samples with genotypes 3a and 6 exhibited lower HCVcAg levels than expected based on the corresponding HCV RNA values. Upon the core amino acid sequence alignment, it was observed that samples exhibiting low core antigen levels had an amino acid substitution at position 49, where threonine was replaced by either alanine or valine. Core mutation at this position may correlate with one of the epitope regions recognized by anti-HCV monoclonal antibodies. The present findings suggest that the utilization of HCVcAg as a standalone marker for HCV RNA might not provide adequate sensitivity for the detection of HCV infection, especially in cases where there are variations in the amino acid sequence of the core region and a low viral load of HCV RNA. The National Research Council of Thailand, Thailand Grand Challenge Fund RES_64_058_30_020 https://orcid.org/0000-0002-2337-6807 Poovorawan Yong The Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University https://orcid.org/0000-0002-2337-6807 Poovorawan Yong http://dx.doi.org/10.13039/100007693 King Chulalongkorn Memorial Hospital https://orcid.org/0000-0002-2337-6807 Poovorawan Yong “This study was part of a viral hepatitis elimination project in Thailand and was supported by the National Research Council of Thailand, Thailand Grand Challenge Fund (RES_64_058_30_020), Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, and King Chulalongkorn Memorial Hospital. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript” Data AvailabilityHCV core nucleotide sequences from this study are available from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under the accession numbers OQ351363-OQ351716. Data Availability HCV core nucleotide sequences from this study are available from GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under the accession numbers OQ351363-OQ351716. ==== Body pmcIntroduction The hepatitis C virus (HCV) is a causative agent of acute and chronic hepatitis worldwide. The World Health Organization (WHO) estimates that about 58 million people have chronic HCV infection, and 1.5 million new cases of HCV infection occur each year [1]. Approximately 70% of HCV-infected individuals develop chronic HCV infection, which places them at risk for hepatic fibrosis, cirrhosis, and hepatocellular carcinoma [1, 2]. Although there is no vaccine for HCV, direct-acting antivirals (DAAs) have revolutionized treatment, achieving cure rates of over 95% [3]. The World Health Organization (WHO) has launched a global strategy to eliminate viral hepatitis by 2030, which aims to increase screening and treatment rates, reduce new infections, and ultimately reduce hepatitis-related mortality by 60% [4]. Over the past decade, Thailand has observed a decline in HCV infection rates [5, 6]. However, approximately 1% of the general population (around 700,000 people) still carry HCV antibodies, and about 400,000 are viremic [6]. To support the global hepatitis elimination strategy, the Ministry of Public Health (MoPH) in Thailand has integrated HCV diagnostic screening and treatment cost subsidization into the Universal Health Coverage program for the general population [7]. The standard diagnosis for HCV infection involves testing for anti-HCV antibodies and confirming the presence of chronic infection by testing for HCV RNA in antibody-positive individuals [1, 8]. HCV RNA detection is considered the gold standard for diagnosing HCV infection and monitoring treatment due to its high sensitivity and specificity [9]. HCV core antigen (HCVcAg) quantification also correlates well with HCV RNA and HCVcAg levels [10–12] and is suggested as an alternative approach to evaluate active HCV infection and monitor the success of antiviral therapy [9, 13, 14]. HCVcAg is cost-effective and uses the same testing platform as HCV antibody tests, making it useful for HCV diagnostic screening. However, its effectiveness in monitoring treatment response is debatable due to limitations in detecting low viral titers [15]. To address this concern, the Thai National Health Security Office (NHSO), MoPH has implemented HCVcAg and HCV RNA assays as confirmatory diagnostic tests for the 2023 HCV reimbursement program. In addition, the use of HCVcAg as an alternative marker to HCV RNA for population diagnostic screening and confirmatory HCV infection needs to be evaluated. HCVcAg is a 21-kDa structural protein consisting of 191 amino acids [16] that are highly conserved among different HCV genotypes [17]. Genetic variability in the core protein can occur, however, posing a challenge for accurately detecting HCV infection. A prior study described an association between amino acid substitutions at positions 48 (A48T) and 49 (T49A/P) in the HCV core region and false negative HCVcAg results [18]. Thus, the current study sought to assess the relationship between HCV RNA and core antigen levels by HCV genotype and to determine the effect of amino acid sequence heterogeneity on HCVcAg quantification. Materials and methods Sample collection A total of 354 serum samples were collected from patients in Phetchabun province, which has a high prevalence of HCV infection compared to other areas in Thailand. The samples were obtained as leftover plasma from a previous diagnostic screening project that included HCV antibody testing, as well as qualitative and quantitative HCV RNA testing (viral load), as described in a previous study [19]. Briefly, all samples were screened for anti-HCV antibodies with a rapid diagnostic test (Bioline HCV, Abbott Diagnostics, Korea Inc. Korea). Samples initially positive for anti-HCV were subjected to a qualitative HCV RNA assay by using the COBAS AmpliPrep/COBAS TaqMan HCV Test, v2.0 (Roche Molecular Systems, Pleasanton, CA). The study was approved by the Institutional Review Board of the Faculty of Medicine of Chulalongkorn University (IRB Number 028/63) and was conducted under the principles of the Declaration of Helsinki. Written informed consent was obtained from participants before enrollment. HCV genotyping Viral RNA was extracted from sera by using the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, after cDNA synthesis using ImProm-II Reverse Transcription System (Promega, Madison, WI). Of the 354 HCV RNA-positive samples, partial core amplification was conducted in two groups. The initial group of 76 samples was genotyped using a previously published primer set [20], resulting in nucleotide sequences that were insufficiently long for analysis of the three-dimensional modeling of amino acid substitutions in the core region or re-amplification due to sample depletion. Therefore, the remaining 278 samples were subjected to the amplification of the core protein gene using a new primer set, forward primer HCV252F (5’ TAGCCGAGTAGTGTTGGGTC 3’) and reverse primer HCV410R (5’ ATGTACCCCATGAGGTCGGC 3’). The forward and reverse primers bound the 5’UTR at nucleotide positions 251–270 and the core region at nucleotide positions 732–751, respectively (based on H77, HCV reference strain with the accession number NC_004102). The partial core gene was amplified using AccuStart II GelTrack PCR Super Mix (QuantaBio, Beverly, MA). The PCR conditions included an initial denaturation at 95°C for 3 minutes followed by 40 cycles of denaturation at 95°C for 30 seconds, annealing at 48°C for 30 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 7 minutes. Amplicons were purified using GeneAll Expin™ Gel SV (GeanAll Biotechnology CO., LTD., Seoul, Korea) and subjected to Sanger sequencing (1st Base, Malaysia). HCV genotypes were classified by phylogenetic analysis after alignment with reference sequences from each HCV genotype available from the GenBank database (mentioned below). HCV core nucleotide sequences from this study were submitted to GenBank under the accession numbers OQ351363-OQ351716. Multiple sequence alignments were generated using Clustal X version 2.0 [21], with the reference genome as follows; 1a_M62321, 1a_M67463, 1b_D90208, 1b_M58335, 1c_D14853, 1g_AM910652, 1h_KC248198, 2a_D00944, 2a_AB047639, 2b_AB030907, 2c_D50409, 3a_D17763, 3a_D28917, 3b_D49374, 4a_Y11604, 5a_AF064490, 5a_Y13184, 6a_Y12083, 6a_AY859526, 6b_D84262, 6c_EF424629, 6d_D84263, 6e_DQ314805, 6f_DQ835760, 6g_D63822, 6h_D84265, 6i_DQ835770, 6j_DQ835769, 6k_D84264, 6l_EF424628, 6m_DQ835767, 6n_DQ278894, 6n_DQ835768, 6o_EF424627, 6p_EF424626, 6q_EF424625, 6r_EU408328, 6s_EU408329, 6t_EF632071, 6t_EU246939, 6u_EU246940, 6v_EU158186, 6v_EU798760, 6w_DQ278892, 6w_EU643834, 6xa_EU408330, 7a_EF108306. Phylogenetic trees were constructed using the Neighbor-joining approach with Kimura’s 2 parameters model. Bootstrap resampling tree were generated with 1000 replicates. HCV genotype was assigned according to the same cluster with the respective reference genotype (S1–S3 Figs). HCV RNA and HCVcAg quantification HCV RNA viral load was quantified by RT-PCR using the cobas 4800 System (Roche Diagnostics, Manheim, Germany) according to the manufacturer’s instructions. The upper and lower limits of detection for HCV genotypes 1–6 were 108 and 15 IU/ml, respectively. HCVcAg was evaluated by Abbott Architect i1000SR analyzer using the ARCHITECT HCV Ag assay (Abbott Diagnostics, Wiesbaden, Germany), a quantitative chemiluminescent immunoassay utilizing the anti-HCV monoclonal antibody-coated microparticles to detect HCVcAg. Briefly, the sample is first combined with pre-treatment 1 and 2 reagents before being mixed with assay-specific diluents and anti-HCV-coated microparticles. After washing, acridinium-labeled anti-HCV conjugate is added to the mixture, and then pre-trigger and trigger solutions are added. The resulting reaction is measured as relative light units (RLUs). The concentration of HCVcAg in the sample is determined by comparing the RLUs to a previously generated ARCHITECT HCV Ag calibration curve. Sample values ≥ 3 fmol/L (≥ 0.477 Log10 fmol/L) and < 3 fmol/L were considered positive and non-reactive, respectively. Samples with concentration values ranging from ≥ 3.00 fmol/L to < 10.00 fmol/L underwent duplicate testing, and those that were retested with a concentration ≥ 3.00 fmol/L were considered reactive positive. The Abbott ARCHITECT HCV Ag assay, developed by Abbott HmbH & Co. KG in Wiesbaden, Germany, demonstrated a sensitivity of 97.8% and specificity greater than 99.5%. Statistical analysis Data were log10 transformed and analyzed using Spearman’s rank correlation and Mann-Whitney U tests with IBM SPSS statistics software (IBM Corporation, Armonk, NY). A p-value of < 0.05 was considered significant. Results All 354 HCV antibody-positive samples possessed detectable HCV RNA. HCV genotyping on these samples revealed genotype 1a (n = 56, 15.8%), 1b (n = 23, 6.5%), 3a (n = 107, 30.2%), and 6 (n = 168, 47.5%) (Table 1). HCVcAg was detectable in the majority of the samples (> 95%, mean = 5,699 fmol/L) and showed that levels of HCVcAg somewhat correlate with HCV RNA (Fig 1). Two genotype 6 samples had HCV RNA levels of 4.04 x 103 and 8.85 x 103 IU/ml but were non-reactive with HCVcAg values < 3 fmol/L. This positive correlation between HCV RNA and HCVcAg was found in samples from all genotypes (p < 0.001). The highest and lowest correlation was observed for samples of genotype 1b (r = 0.96) and genotype 6 (r = 0.88), respectively. For many samples of genotypes 3a and 6, however, HCVcAg levels were lower than would be expected. 10.1371/journal.pone.0287694.g001 Fig 1 Correlations between HCV RNA and HCVcAg for different HCV genotypes. HCV RNA viral loads in IU/ml (x-axis) were plotted against detectable HCVcAg in fmol/L (y-axis) for samples (circles). Correlation scores from the line plot (r-value) and statistical significance (p-value) are indicated for each HCV genotype. Samples with lower levels of HCVcAg relative to the HCV RNA are arrowed for genotype 3a (samples C-1 to C-7) and genotype 6 (samples C-8 to C-13). 10.1371/journal.pone.0287694.t001 Table 1 Amino acid residue in the HCVcAg at position 49 for each genotype. Genotype No. of samples (%) Average HCV RNA level (IU/ml) The amino acid at residue 49, No. for each genotype (%) T A or V 1a 56 (15.8%) 5.01 x 106 56 (100%) - 1b 23 (6.5%) 4.09 x 106 23 (100%) - 3a 107 (30.2%) 4.70 x 106 100 (93.5%) 7 (6.5%) 6 168 (47.5%) 8.02 x 106 162 (96.4%) 6 (3.6%) Total 354 (100%) There was no significant difference in the HCVcAg/HCV RNA ratio for samples of genotype 1a, 1b, and 6. In contrast, samples of genotype 3a had a lower HCVcAg/HCV RNA ratio than the genotype 1a, 1b, and 6 samples (p < 0.05), which suggests that the levels of HCVcAg were lower relative to HCV RNA for genotype 3a samples (Fig 1). Although certain genotype 6 samples had lower levels of HCVcAg in relation to HCV RNA, the HCVcAg/HCV RNA ratio did not exhibit a significant difference between samples with genotype 6 and genotype 1. Nevertheless, slight variation was observed in the HCVcAg/HCV RNA ratios among genotype 6 samples, which were subsequently analyzed for amino acid substitutions. Samples associated with lower HCVcAg levels than expected from their corresponding HCV RNA values were classified as genotypes 3a and 6. Amino acid sequences of the samples with low HCVcAg levels (samples C-1 to C-13) were compared with randomly selected samples with core antigen levels corresponding to HCV RNA values (samples N-1 to N-27) to determine the amino acid substitution associated with the HCVcAg underestimate. While the C-1 to C-7 and N-1 to N-15 were characterized as genotype 3a, the C-8 to C-13 and N-16 to N-27 were characterized as genotype 6. The accession number of case (C) and control (N) samples is shown in supplementary data (S1 File). The amino acid sequence alignment of partial HCVcAg residues of C-1 to C-13 and N-1 to N-27 showed high conservation (Fig 2). Thirteen samples (C-1 to C-13) from both genotypes 3a and 6 had a core mutation at position 49 (threonine to alanine or valine) compared to control samples that lacked an amino acid substitution. These findings suggest that a core mutation at residue 49 may affect the levels of HCVcAg determined using the ARCHITECT HCV Ag platform. 10.1371/journal.pone.0287694.g002 Fig 2 Alignment of the partial amino acid sequences of HCVcAg belonging to genotype 3a and genotype 6. Residue comparison of seven genotypes 3a samples of relatively low HCVcAg (C-1 to C-7) to other genotype 3a samples (N-1 to N-15). Residue comparison of six genotypes 6 samples of relatively low HCVcAg (C-8 to C-13) and other genotypes 6 samples (N-16 to N-27). Dots indicate identical residues. Boxes denote the threonine to alanine/valine change at position 49 observed for samples C-1 to C-13. The tertiary structure of the control and mutant (T49A/V) HCV core protein was predicted using the IntFOLD server. According to the server’s quality and confidence scoring, the global model quality scores of the tertiary structure ranged from 0 to 1. Scores > 0.4 had more complete and confident models and were very close to the native structure. Peptides 2–45 of the HCV N-terminal core protein (PDB ID: 1CWX) were compared with the predicted HCV proteins. The scores of the 3D structure from the control sequence, the T49A mutant, and the T49V mutant were 0.3645, 0.3529, and 0.3630, respectively. These scores may be low because there is no available native structure of the full-length HCV core protein in the protein data bank (PDB) that can compare the first 136 residues of predicted HCV proteins. To evaluate the effect of the core mutation at position 49 on the tertiary structure of the HCV core protein, the 3D structure of the mutants (T49A/V) was compared to the control sequence. The replacements of threonine (T), a hydrophilic and polar amino acid, with the non-polar and hydrophobic amino acids, alanine (A) or valine (V), at position 49 were likely to be buried within the protein structure and obscured by neighboring amino acids (Fig 3). 10.1371/journal.pone.0287694.g003 Fig 3 Tentative tertiary structure prediction of the HCV core protein from the control (A), T49A mutant (B), and T49V mutant (C) sequences. The global model quality score of the HCV core protein from the control sequence, T49A, and T49V mutant was 0.3645, 0.3529, and 0.3630, respectively. Discussion In this study, almost half of the samples in this study were of HCV genotype 6, which is consistent with a previous report indicating that the most prevalent genotype in Phetchabun was genotype 6, followed by genotypes 3 and 1 [19, 20]. The findings shown here revealed a positive correlation between HCV RNA and HCVcAg levels, confirming the results of prior studies [22, 23]. The correlation coefficients for all hepatitis C virus (HCV) genotypes demonstrated strong positive associations, ranging from 0.88 to 0.96 (p < 0.001). However, genotypes 3a and 6 exhibited weaker correlations compared to other genotypes, consistent with previous reports identifying greater variance in genotype 3a compared to genotypes 1a, 1b, and 4 [15]. Furthermore, our findings align with a previous study that detected greater variability of low HCVcAg levels and false negative results in samples from Thai patients with genotype 3a, potentially attributable to variations in amino acid mutations identified in this study [24]. The HCV core amino acid sequence is highly conserved among genotypes, particularly at positions 21–60 [25]. Mutation of the amino acid sequences in conserved regions may affect the sensitivity of core antigen detection [26]. Alanine and threonine at positions 48 and 49, respectively, are the most common residues in the core protein of all HCV genotypes. Substitution at these residues can occur in 0.1–15.7% of samples [18]. The current study found that 6% of HCV genotype 3a isolates had an amino acid substitution at position 49 (T49A). This matches the results from a previous study, which revealed a point mutation (T49P) in four (4%) of 107 HCV genotype 1b samples with lower HCVcAg relative to HCV RNA levels than control samples that lacked residue substitution [27]. In addition to HCV genotype 3a, a core mutation at position 49 (T49A/V) was also found in 4% of HCV genotype 6 isolates, the most prevalent genotype in Phetchabun [20]. Bioinformatics analysis predicts that the amino acid at position 49 of the HCV core region is part of the antibody epitope [28]. Mutation at residue 49 (T49P) reduced fluorescence enzyme immunoassay sensitivity [27]. Thus, core mutation at this position may correlate with one of the epitope regions recognized by an anti-HCV monoclonal antibody. Polar amino acids are usually found at the surface of proteins, while hydrophobic residues are mostly buried in the protein structure. In the current study, amino acid substitution at position 49 was accomplished by replacing polar and hydrophilic threonine with non-polar and hydrophobic alanine/valine. This substitution may affect the polarity, antigenicity, and tertiary structure of the HCV core protein, reducing the affinity of anti-HCV monoclonal antibody binding to HCVcAg. Multiple amino acid substitutions in the HCV core region (positions 47 to 49) may severely impair antibody binding, limiting the detection of HCVcAg [29]. Thus, HCVcAg levels may not be a reliable indicator of infection, especially among patients with low or undetectable levels. Inaccurate detection of HCVcAg can also lead to the wrong choice of treatment. Three-dimensional modeling of the HCV core protein provides a tentative prediction of its tertiary structure. Tertiary structures were built directly from the amino acid sequence. No native structures of the full-length HCV core protein were available in the protein data bank (PDB) to compare with the predicted 3D structures. Thus, it remained unclear whether the predicted 3D structures had the correct fold and were close to the native structure. Moreover, the HCV core protein binding site for the anti-HCV monoclonal antibody used by the ARCHITECT HCV Ag platform could not be defined because the antibody molecule lacked structure in the protein-ligand interaction. Regarding the potential use of HCVcAg as an alternative marker for detecting HCV infection, antigen assay has shown promising results for a diagnostic evaluation with high sensitivity, specificity, and accuracy (approximately 99%–100%) when tested on samples from HCV-infected Thai individuals [24]. However, the most significant variation in the correlation between HCV RNA and HCVcAg has been observed in genotype 3 samples, resulting in a 97% negative predictive value (2/290 samples were defined as negative by antigen testing). Our findings suggest that this may be associated with the T49A/V substitution, which is prevalent in approximately 6% of individuals with HCV genotype 3a in Thailand. If the antigen assay is used as a replacement for nucleic acid testing in a community screening, there is a risk of missing some HCV chronic patients who carry this mutation. Moreover, while the Thai NHSO currently implements HCVcAg as a confirmatory test for HCV diagnosis, policymakers should be aware of the assay’s limitations and foster further follow-up studies to evaluate its utility, define the false negative rate, and determine the proportion of Thai patients who carry this mutation. In summary, this study revealed a strong correlation between HCV RNA and HCVcAg levels. However, some samples had HCVcAg levels that were lower than those expected from the corresponding HCV RNA levels. These samples were classified as genotypes 3a and 6, which are predominant in Phetchabun. In these samples, the amino acid alignment of the HCV core region had a point mutation at position 49 (T49A/V). Thus, while HCVcAg measurement may be used to identify infection when HCV RNA testing is unavailable, HCV RNA should remain the standard method for detecting active HCV infection and monitoring treatment. Supporting information S1 Fig Phylogenetic analysis of HCV genotype 1a expansion. (TIF) Click here for additional data file. S2 Fig Phylogenetic analysis of HCV genotype 3a expansion. (TIF) Click here for additional data file. S3 Fig Phylogenetic analysis of HCV genotype 6f expansion. (TIF) Click here for additional data file. S1 File List of Core randomized samples. The accession number of case (C) and control (N) of HCV core sample. (DOCX) Click here for additional data file. We are grateful to all staff from the sub-district health-promoting centers, district hospitals, and general hospitals in Phetchabun province. Without their collaboration, this research study may not have been possible. 10.1371/journal.pone.0287694.r001 Decision Letter 0 Gededzha Maemu Petronella Academic Editor © 2023 Maemu Petronella Gededzha 2023 Maemu Petronella Gededzha https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version0 22 Mar 2023 PONE-D-23-03115An amino acid substitution in HCV core antigen limits its use as a reliable measure of HCV infection compared with HCV RNAPLOS ONE Dear Dr. Poovorawan, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by May 06 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Maemu Petronella Gededzha, Ph.D Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at  https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and  https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.  When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript:  "This study was part of a viral hepatitis elimination project in Thailand and was supported by the National Research Council of Thailand, Thailand Grand Challenge Fund (RES_64_058_30_020), Center of Excellence in Clinical Virology, Faculty of Medicine, Chulalongkorn University, and King Chulalongkorn Memorial Hospital. We are grateful to all staff from the sub-district health-promoting centers, district hospitals, and general hospitals in Phetchabun province. Without their collaboration, this research study may not have been possible. " We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.  Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:  "NO - Include this sentence at the end of your statement: The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript." Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide. 5. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.  Additional Editor Comments: When preparing your revised manuscript, you are asked to carefully consider the reviewer comments which are attached Major: i. It is not clear whether the samples used in this study are part of the samples tested positive in their previous study (Reference 13) or it’s a new cohort. ii. If it is a new cohort please describe the cohort in details and indicate how many samples were screened by Anti-HCV? iii. What is the sensitivity and specificity of the HCVcAg in this cohort? iv. Include phylogenetic tree and indicate which method was used to construct the tree v. Figure 1 resolution is poor and it is difficult to interpret the results vi. Elaborate further in the discussion about the mutations detected in the core and treatment choice. Minor comments: vii. Please list the names, sources of all reagents used in the methodology. viii. Reference the methods used eg. Sanger sequencing. ix. Line 81-84-Write minutes and seconds in full. x. Line 94: Which instrument was used? Eg i2000. xi. Line 96-97: Where the specimens with concentration values ≥ 3.00 fmol/L to < 10.00 fmol/L retested in duplicate? What was the outcome? xii. Line 106: Include the viral of the samples not detected. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: No ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This is an absolutely important piece of data for HCV detection and eradication. The research cautions against the use of HCVcAg quantification as the sole method to test for HCV infection as some HCV genotypes with low levels of HCVcAg might results in false-negative detection of HCV. A few comments to take note of and rectify or clarify: Line 81 - mention the genotype of the reference strain. Line 85 - Give an explanation for the use of two different amplification methods. Line 89 - Accession numbers not available yet on GeneBank. Line 93 - State the upper value first followed by the lower limit. Line 111- Table 1 - add a column with the average HCV RNA levels. Line 120 - 123 - Rephrase and avoid long sentences for clarity. Line 150-151 - Rectify the sentence construction - plural. Reviewer #2: The authors provide in this interesting work several evidences supporting the substitution of amino acid of HCV core antigen and the fact that it limit its use as reliable measure of HCV infection. They further showed that HCV RNA can be an alternative marker to be used. However there are several aspects to be improved in order to present convincing evidences and conclusions. Major points 1. The introduction does not provide sufficient background of the study, it is therefor important that the author must write a comprehensive introduction. 2. The abstract needs some improvement Minor points 3. Page 5, briefly explain the ARCHITECT HCV Ag assay 4. Page 6, line 117-18 need to be re-visited, the statement does not make sense at all. The explanation for the results need to be re-visited, especially on page 6, 7, it does not make sense at all. Results must be self-explanatory 5. It is important to discuss the method used to do phylogenetic analysis obtained ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Hazel Tumelo Mufhandu Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10.1371/journal.pone.0287694.r002 Author response to Decision Letter 0 Submission Version1 1 May 2023 Response to reviewers Editor Comments: Question: It is not clear whether the samples used in this study are part of the samples tested positive in their previous study (Reference 13) or it’s a new cohort. Answer: All samples used in this study were leftover from a previous population study, Pratedrat P; PlosOne 2023: PMID: 36656832 (reference 19). We have revised this section in material and method in lines 85-90. Question: If it is a new cohort, please describe the cohort in details and indicate how many samples were screened by Anti-HCV? Answer: Samples in this study are part of a new cohort (reference 19). Briefly, in a total of 170,163 residents in Phetchabun province, Thailand, 10,621 tested positive for anti-HCV RDT. Among the HCV serological positive, 3,930 samples were positive for qualitative HCV RNA testing. Of these, 1,027 available samples were further tested for the viral load to fulfill the Thai Universal Health Coverage eligibility criteria for HCV treatment. A total of 354 serum samples in this study were the leftover samples from the 1027 samples. We have cited the new cohort reference in material and method (lines 85-90). Question: What is the sensitivity and specificity of the HCVcAg in this cohort? Answer: The manufacturer's instructions indicated that the sensitivity and specificity of the HCVcAg assay at a 3 fmol/L cut-off were 97.8% and 99.5%, respectively (lines 148-152). While the sensitivity and specificity of HCVcAg were not determined in the current cohort, a previous study on Thai HCV patients reported that the HCVcAg assay had a diagnostic performance of 99% sensitivity, 100% specificity, 100% positive predictive value, 97% negative predictive value, and 99% accuracy in predicting HCV active infection (Wasitthankasem R; Peer J 2017: PMID: 29134150). This information was discussed in lines 254-262. Question: Include phylogenetic tree and indicate which method was used to construct the tree. Answer: The HCV genotyping was classified by phylogenetic analysis using the Neighbor-joining approach with Kimura’s 2 parameters model (lines 121-133). The phylogenetic trees are included in the supplement figures. Question: Figure 1 resolution is poor and it is difficult to interpret the results. Answer: We have improved the resolution accordingly. Question: Elaborate further in the discussion about the mutations detected in the core and treatment choice. Answer: We have discussed this point accordingly in lines 254-267. Question: Please list the names and sources of all reagents used in the methodology. Answer: We have included information about the reagents utilized in the Materials and Methods section, in lines 111-116. Question: Reference the methods used eg. Sanger sequencing. Answer: The information about the methods has been included in the Materials and Methods section, especially in lines 115-116 and 121-133. Question: Lines 81-84, write minutes and seconds in full. Answer: We have edited as a suggestion (lines 112-115). Question: Line 94: Which instrument was used? Eg i2000. Answer: The instrument used in this study is the Abbott Architect i1000SR analyzer (line 138) Question: Line 96-97: Where the specimens with concentration values ≥ 3.00 fmol/L to < 10.00 fmol/L retested in duplicate? What was the outcome? Answer: To ensure accuracy, samples with a concentration ranging from ≥ 3.00 fmol/L to < 10.00 fmol/L underwent duplicate testing. All retested samples were found to be ≥ 3.00 fmol/L and therefore were assigned as reactive for HCVcAg (lines 148-150). Question: Line 106: Include the viral of the samples not detected. Answer: The results for two samples with HCV genotype 6 and HCV RNA levels of 4.04 x 103 and 8.85 x 103 IU/ml have been included in lines 162-163, indicating that despite their high RNA levels, they tested non-reactive for HCVcAg with values below 3 fmol/L. Reviewer #1 This is an absolutely important piece of data for HCV detection and eradication. The research cautions against the use of HCVcAg quantification as the sole method to test for HCV infection as some HCV genotypes with low levels of HCVcAg might results in false-negative detection of HCV. A few comments to take note of and rectify or clarify: Question: Line 81 - mention the genotype of the reference strain. Answer: The primer positions were assigned according to the HCV prototype reference, H77, with accession number NC_004102 (lines 108-110). Question: Line 85 - Give an explanation for the use of two different amplification methods. Answer: The initial 76 samples were genotyped using primer sets that were too short of analyzing the 3D structure of the HCV core amino acid sequence. Furthermore, these samples could not be re-amplified for further PCR analysis. As a result, new primer sets were utilized for PCR amplification in the remaining 268 samples, which allowed for the analysis of a more extended nucleotide sequence and the 3D structure of the HCV core region (lines 100-105). Question: Line 89 - Accession numbers not available yet on GeneBank. Answer: The nucleotide sequences generated from this study were deposited in the GenBank database under accession numbers OQ351363-OQ351716. As per the GenBank policy, the sequence data will be made publicly available one year after submission to the GenBank repository or upon manuscript publication. Question: Line 93 - State the upper value first, followed by the lower limit. Answer: We have edited accordingly in line 137. Question: Line 111- Table 1 - add a column with the average HCV RNA levels. Answer: The average HCV RNA levels have been added to Table 1. Question: Line 120 - 123 - Rephrase and avoid long sentences for clarity. Answer: The sentence has been revised accordingly (lines 173-178). Question: Line 150-151 - Rectify the sentence construction - plural. Answer: The sentence has been revised accordingly in lines 204-207. Reviewer #2 The authors provide in this interesting work several evidences supporting the substitution of amino acid of HCV core antigen and the fact that it limits its use as reliable measure of HCV infection. They further showed that HCV RNA can be an alternative marker to be used. However, there are several aspects to be improved in order to present convincing evidences and conclusions. Question: The introduction does not provide sufficient background of the study. It is therefore important that the author must write a comprehensive introduction. Answer: The background knowledge has been included in more detail in the introduction (lines 50-62 and 67-73). Question: The abstract needs some improvement Answer: The abstract has been improved accordingly. Question: Page 5, briefly explain the ARCHITECT HCV Ag assay Answer: The ARCHITECT HCV Ag assay details were described in lines 141-152. Question: Page 6, line 117-18 need to be re-visited, the statement does not make sense at all. The explanation for the results needs to be re-visited, especially on page 6, 7, it does not make sense at all. Results must be self-explanatory. Answer: The sentence has been revised accordingly (lines 173-178). Question: It is important to discuss the method used to do phylogenetic analysis obtained. Answer: Phylogenetic trees were constructed using the Neighbor-joining approach using Kimura’s 2 parameters with 1000 bootstrap. The methodology of phylogenetic analysis used in this study was added in lines 121-133 and Figure S1-S3. Attachment Submitted filename: Response_to_Reviewer.docx Click here for additional data file. 10.1371/journal.pone.0287694.r003 Decision Letter 1 Gededzha Maemu Petronella Academic Editor © 2023 Maemu Petronella Gededzha 2023 Maemu Petronella Gededzha https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 12 Jun 2023 An amino acid substitution in HCV core antigen limits its use as a reliable measure of HCV infection compared with HCV RNA PONE-D-23-03115R1 Dear Dr. Poovorawan, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Maemu Petronella Gededzha, Ph.D Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #1: All comments have been addressed Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: (No Response) Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: (No Response) Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: (No Response) Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: (No Response) Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: (No Response) Reviewer #2: (No Response) ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: Yes: Hazel Tumelo Mufhandu Reviewer #2: Yes: Shonisani Wendy Limani ********** 10.1371/journal.pone.0287694.r004 Acceptance letter Gededzha Maemu Petronella Academic Editor © 2023 Maemu Petronella Gededzha 2023 Maemu Petronella Gededzha https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 20 Jun 2023 PONE-D-23-03115R1 An amino acid substitution in HCV core antigen limits its use as a reliable measure of HCV infection compared with HCV RNA Dear Dr. Poovorawan: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Maemu Petronella Gededzha Academic Editor PLOS ONE ==== Refs References 1 World Health Organization. Hepatitis C. 2022. [cited 2022 January 30]. Available from: https://www.who.int/news-room/fact-sheets/detail/hepatitis-c 2 Rabaan AA , Al-Ahmed SH , Bazzi AM , Alfouzan WA , Alsuliman SA , Aldrazi FA , et al . Overview of hepatitis C infection, molecular biology, and new treatment. J Infect Public Health. 2020 May; 13 : 773–783. doi: 10.1016/j.jiph.2019.11.015 .31870632 3 Miller MM . Sofosbuvir-velpatasvir: A single-tablet treatment for hepatitis C infection of all genotypes. Am J Health Syst Pharm. 2017 Jul; 74 : 1045–1052. doi: 10.2146/ajhp60632 .28687550 4 Thomas DL . Global elimination of chronic hepatitis. N Engl J Med. 2019 May; 380 : 2041–2050. doi: 10.1056/NEJMra1810477 .31116920 5 Posuwan N , Vuthitanachot V , Chinchai T , Wasitthankasem R , Wanlapakorn N , Poovorawan Y . Serological evidence of hepatitis A, B, and C virus infection in older adults in Khon Kaen, Thailand and the estimated rates of chronic hepatitis B and C virus infection in Thais, 2017. PeerJ. 2019 Aug; 7 : e7492. doi: 10.7717/peerj.7492 .31489265 6 Wasitthankasem R , Posuwan N , Vichaiwattana P , Theamboonlers A , Klinfueng S , Vuthitanachot V , et al . Decreasing hepatitis C virus infection in Thailand in the past decade: evidence from the 2014 national survey. PLoS One. 2016 Feb; 11 : e0149362. doi: 10.1371/journal.pone.0149362 .26871561 7 Rattanavipapong W , Anothaisintawee T , Teerawattananon Y . Revisiting policy on chronic HCV treatment under the Thai Universal Health Coverage: an economic evaluation and budget impact analysis. PLoS One. 2018 Feb; 13 : e0193112. doi: 10.1371/journal.pone.0193112 .29466415 8 Kumbhar N , Ramachandran K , Kumar G , Pasupuleti SSR , Sharma MK , Gupta E . Utility of hepatitis C virus core antigen testing for diagnosis and treatment monitoring in HCV infection: a study from India. Indian J Med Microbiol. 2021; 39 : 462–466. doi: 10.1016/j.ijmmb.2021.07.002 Epub 2021 Jul 19. PMID: .34294505 9 Elbrolosy AM , Elhamouly MS , Eed EM , El Gedawy GA , Abozeid M , Elabd NS . Hepatitis C core antigen: a simple predictive marker for treatment response to the new direct-acting antiviral drugs in chronic HCV Egyptian patients. Egypt Liver J. 2021;11 : 19. 1. 10.1186/s43066-021-00092-w. 10 Kesli R , Polat H , Terzi Y , Kurtoglu MG , Uyar Y . Comparison of a newly developed automated and quantitative hepatitis C virus (HCV) core antigen test with the HCV RNA assay for clinical usefulness in confirming anti-HCV results. J Clin Microbiol. 2011 Dec; 49 : 4089–93. doi: 10.1128/JCM.05292-11 .21940466 11 Veillon P , Payan C , Picchio G , Maniez-Montreuil M , Guntz P , Lunel F . Comparative evaluation of the total hepatitis C virus core antigen, branched-DNA, and amplicor monitor assays in determining viremia for patients with chronic hepatitis C during interferon plus ribavirin combination therapy. J Clin Microbiol. 2003 Jul; 41 : 3212–20. doi: 10.1128/JCM.41.7.3212-3220.2003 .12843066 12 Xiang Y , Lai XF , Chen P , Yang Y . The correlation of HCV RNA and HCV core antigen in different genotypes of HCV. J Clin Lab Anal. 2019 Jan; 33 : e22632. doi: 10.1002/jcla.22632 .30069909 13 Fan Z , Liu J , Wang F , Liu J , Ding X , Liu S . HCV core antigen is a useful predictor during pegylated-interferon/ribavirin therapy in patients with hepatitis C virus genotype 1b. Medicine (Baltimore). 2019 Mar; 98 : e14795. doi: 10.1097/MD.0000000000014795 .30855495 14 Lamoury FMJ , Soker A , Martinez D , Hajarizadeh B , Cunningham EB , Cunningham P , et al . Hepatitis C virus core antigen: a simplified treatment monitoring tool, including for post-treatment relapse. J Clin Virol. 2017 Jul; 92 : 32–38. doi: 10.1016/j.jcv.2017.05.007 .28521211 15 Ottiger C , Gygli N , Huber AR . Detection limit of architect hepatitis C core antigen assay in correlation with HCV RNA, and renewed confirmation algorithm for reactive anti-HCV samples. J Clin Virol. 2013 Nov; 58 : 535–540. doi: 10.1016/j.jcv.2013.08.028 .24041472 16 Li HC , Lo SY . Hepatitis C virus: virology, diagnosis and treatment. World J Hepatol. 2015 Jun;7 : 1377–1389. doi: 10.4254/wjh.v7.i10.1377 .26052383 17 Suzuki T , Ishii K , Aizaki H , Wakita T . Hepatitis C viral life cycle. Adv Drug Deliv Rev. 2007 Oct; 59 : 1200–1212. doi: 10.1016/j.addr.2007.04.014 .17825945 18 Nguyen LT , Dunford L , Freitas I , Holder P , Nguyen LA , O’Gorman J , et al . Hepatitis C virus core mutations associated with false-negative serological results for genotype 3a core antigen. J Clin Microbiol. 2015 Aug; 53 : 2697–2700. doi: 10.1128/JCM.01062-15 .25994168 19 Pratedrat P , Nilyanimit P , Wasitthankasem R , Posuwan N , Auphimai C , Hansoongnern P , et al . Qualitative hepatitis C virus RNA assay identifies active infection with sufficient viral load for treatment among Phetchabun residents in Thailand. PLoS One. 2023 Jan; 18 : e0268728. doi: 10.1371/journal.pone.0268728 .36656832 20 Wasitthankasem R , Pimsingh N , Treesun K , Posuwan N , Vichaiwattana P , Auphimai C , et al . Prevalence of hepatitis C virus in an endemic area of Thailand: burden assessment toward HCV elimination. Am J Trop Med Hyg. 2020 Jul; 103 : 175–182. doi: 10.4269/ajtmh.19-0817 .32394881 21 Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007 Nov; 23: 2947–2948. doi: 10.1093/bioinformatics/btm404. PMID: 17846036. 22 Lin SF , Tung SY , Wei KL , Chen CH , Hu TH , Shen CH , et al . Clinical utility of hepatitis C virus core antigen assay in the monitoring of direct-acting antivirals for chronic hepatitis C. PLoS One. 2020 Mar; 15 : e0229994. doi: 10.1371/journal.pone.0229994 .32126125 23 Pérez-García A , Aguinaga A , Navascués A , Castilla J , Ezpeleta C . Hepatitis C core antigen: diagnosis and monitoring of patients infected with hepatitis C virus. Int J Infect Dis. 2019 Dec; 89 : 131–136. doi: 10.1016/j.ijid.2019.09.022 .31580940 24 Wasitthankasem R , Vichaiwattana P , Auphimai C , Siripon N , Klinfueng S , Tangkijvanich P , et al . HCV core antigen is an alternative marker to HCV RNA for evaluating active HCV infection: implications for improved diagnostic option in an era of affordable DAAs. PeerJ. 2017 Nov; 5 : e4008. doi: 10.7717/peerj.4008 .29134150 25 Bukh J , Purcell RH , Miller RH . Sequence analysis of the core gene of 14 hepatitis C virus genotypes. Proc Natl Acad Sci U S A. 1994 Aug; 91 : 8239–8243. doi: 10.1073/pnas.91.17.8239 .8058787 26 Saeed M , Suzuki R , Kondo M , Aizaki H , Kato T , Mizuochi T , et al . Evaluation of hepatitis C virus core antigen assays in detecting recombinant viral antigens of various genotypes. J Clin Microbiol. 2009 Dec; 47 : 4141–4143. doi: 10.1128/JCM.01437-09 .19812276 27 Tokita H , Kaufmann GR , Matsubayashi M , Okuda I , Tanaka T , Harada H , et al . Hepatitis C virus mutations reduce the sensitivity of a fluorescence enzyme immunoassay. J Clin Microbiol. 2000 Sep; 38 : 3450–3452. doi: 10.1128/jcm.38.9.3450-3452.2000 .10970401 28 Dehghani B , Hashempour T , Hasanshahi Z , Moayedi J . Bioinformatics analysis of domain 1 of HCV-core protein: Iran. Int J Pept Res Ther. 2020; 26 : 303–320. doi: 10.1007/s10989-019-09838-y .32435167 29 Murayama A , Sugiyama N , Watashi K , Masaki T , Suzuki R , Aizaki H , et al . Japanese reference panel of blood specimens for evaluation of hepatitis C virus RNA and core antigen quantitative assays. J Clin Microbiol. 2012 Jun; 50 : 1943–1949. doi: 10.1128/JCM.00487-12 .22495557