==== Front PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0287926 PONE-D-23-05797 Research Article Medicine and Health Sciences Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Medicine and Health Sciences Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Biology and Life Sciences Molecular Biology Molecular Biology Techniques Molecular Biology Assays and Analysis Techniques Gene Expression and Vector Techniques Hyperexpression Techniques Research and Analysis Methods Molecular Biology Techniques Molecular Biology Assays and Analysis Techniques Gene Expression and Vector Techniques Hyperexpression Techniques Medicine and Health Sciences Oncology Cancers and Neoplasms Carcinoma Adenocarcinoma Adenocarcinoma of the Lung Medicine and Health Sciences Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Adenocarcinoma of the Lung Research and Analysis Methods Bioassays and Physiological Analysis Cell Analysis Cell Viability Testing Cell Wound Assay Biology and life sciences Biochemistry Nucleic acids RNA Non-coding RNA Long non-coding RNA Medicine and Health Sciences Oncology Metastasis Medicine and Health Sciences Oncology Basic Cancer Research Metastasis Research and Analysis Methods Extraction Techniques Protein Extraction LINC01117 inhibits invasion and migration of lung adenocarcinoma through influencing EMT process LINC01117 inhibits invasion and migration of lung adenocarcinoma https://orcid.org/0000-0002-0759-7028 Liu Linjun Conceptualization Data curation Methodology Writing – original draft 1 Ren Wenjia Conceptualization Data curation Methodology 1 Du Licheng Formal analysis Investigation Validation 1 Xu Ke Formal analysis Supervision Writing – review & editing 2 * Zhou Yubai Conceptualization Formal analysis Investigation Supervision Writing – review & editing 1 * 1 Department of Environment and Life Sciences, Beijing University of Technology, Beijing, China 2 NHC Key Laboratory of Biosafety, National Institute for Viral Disease Control and Prevention, Beijing, China Li Zhiming Editor Columbia University Irving Medical Center, UNITED STATES Competing Interests: The authors have declared that no competing interests exist. * E-mail: xuke@ivdc.chinacdc.cn (KX); zhouyubai@bjut.edu.cn (YZ) 29 6 2023 2023 18 6 e028792627 2 2023 15 6 2023 © 2023 Liu et al 2023 Liu et al https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Background Studying the mechanism of action of LncRNAs in lung adenocarcinoma (LUAD) is of great importance for an in-depth understanding of the molecular mechanism of lung adeno carcinogenesis and development. Objective The aim is to identify a long non-coding RNA LINC01117 that is specifically and highly expressed in LUAD cells and to investigate its biological functions and molecular mechanisms in LUAD cells, providing a new potential target for targeting LUAD therapy. Methods This study used publicly available data downloaded from The Cancer Genome Atlas (TCGA) database. Construction of siRNA and overexpression plasmid-packed lentiviral constructs were used to knock down and increase the expression of LINC01117 in LUAD cells. The effect of LINC01117 on LUAD cell migration and invasion was verified by scratch assays and Transwell assays. Western blot assays were performed to verify the effect of knocking down LINC01117 expression on key proteins of the EMT process. The effect of overexpression and knockdown LINC01117 expression on key proteins of the EMT process and the nuclear and cytoplasmic distribution of YAP1, a key effector molecule of the Hippo pathway, was verified by Western blot assays. Results LINC01117 expression was upregulated in LUAD tissues and cell lines. Clinical correlation and prognostic analyses showed that LINC01117 was associated with poorer clinical features (staging and N classification) and poorer prognosis and could be analyzed as an independent prognostic factor. Cell migration and invasion were significantly inhibited in the knockdown group compared to the control group; in contrast, cell migration and invasion were promoted in the overexpression group. Overexpression of LINC01117 resulted in down-regulation of E-cadherin expression and increased expression levels of N-cadherin, vimentin, ZEB1, snail and slug; in contrast, knockdown of LINC01117 appeared to have the opposite effect. Furthermore, knockdown of LINC01117 increased the enrichment of YAP1 protein in the cytoplasm and reduced its level in the nucleus; overexpression of LINC01117 produced the opposite intracellular distribution results. Conclusions LINC01117 was highly expressed in LUAD, and knockdown of LINC01117 significantly inhibited the migration and invasion of LUAD cells, while overexpression of LINC01117 significantly promoted the migration and invasion of LUAD cells, and affected the EMT process, and was able to alter the distribution of YAP1 in the nucleus and cytoplasm. This suggests that LINC01117 may regulate the activity of the Hippo pathway by altering the nuclear and cytoplasmic distribution of YAP1, which in turn induces the EMT process in lung adenocarcinoma cells and thus exerts a pro-cancer effect. It suggests that LINC01117 may play a key role in the occurrence and development of LUAD. The author(s) received no specific funding for this work. Data AvailabilityAll relevant data are within the manuscript and its Supporting Information files. Data Availability All relevant data are within the manuscript and its Supporting Information files. ==== Body pmcIntroduction Lung cancer is a malignant tumors with extremely high morbidity and mortality rates worldwide, seriously affecting human health [1]. According to statistics, there will be approximately 2.2 million new cases and 1.8 million deaths of lung cancer worldwide in 2020, the highest cancer incidence and mortality rate among men and the second highest cancer incidence rate among women, second only to breast cancer [2]. Based on pathology, they can be divided into two main categories: small cell lung cancer and non-small cell carcinoma lung cancer, which can be subdivided into adenocarcinoma of the lung, squamous lung cancer and large cell carcinoma [3]. LUAD is the most prominent tissue subtype of non-small cell lung cancer (NSCLC), with high mortality and metastasis rates [4]. LUAD accounts for 40% of all lung cancers [5] and is commonly found in non-smokers and young women [6], mainly originating from the bronchial mucosal epithelium and bronchial mucus glands, and can occur in the small bronchi or central airways, mostly presenting as peripheral lung cancer, prone to local infiltration and early metastasis [7]. Immunotherapy is often used in advanced stages. Although there have been some improvements in the techniques and tools used to treat LUAD [8, 9], the five-year survival rate for patients is still less than 4% [10, 11]. Most of the RNAs in the human genome cannot be translated into proteins, and these are called non-coding RNAs [12]. Some non-coding RNAs are greater than 200 nucleotides in length and are called long non-coding RNAs (LncRNAs). Among them, long intergenic non-coding RNAs (LncRNAs) are a class of long-stranded non-coding RNAs that lie between coding genes and are usually smaller than protein-coding transcripts [13]. LncRNAs are expressed in low amounts but exhibit strong tissue specificity. Studies have shown that LncRNAs play important regulatory roles in epigenetic, cell cycle and differentiation and other life activities [14, 15]. In this study, a long-stranded intergenic non-coding RNA LINC01117, located on chromosome 2 and 656bp in length, was identified by bioinformatics analysis in the previous phase. Wang et al. found that LINC01117 could be developed as a biomarker for breast cancer patients through biomarker analysis [16], however, the biological function of LINC01117 in tumors and its molecular mechanism of action have not yet been reported. We found that LINC01117 expression was significantly upregulated in LUAD patient tissues and that high LINC01117 expression was negatively correlated with the prognosis of LUAD patients. We examined the effect of LINC01117 expression on the migration and invasive ability of LUAD cells by knocking down and overexpressing LINC01117, and we investigated the molecular mechanism of LINC01117 in the development of LUAD. In conclusion, LINC01117 as an oncogene promotes the development of lung cancer and through our study LINC01117 is expected to be a biomarker for lung cancer diagnosis and a potential therapeutic target. Materials and methods Materials Human non-small cell carcinoma lung cancer cell lines (H1650, H1299, A549, H460) and immortalized normal human bronchial epithelial cells 16HBE are kept in our laboratory. Dulbecco’s Phosphate Buffer (DPBS), RPMI-1640, Dulbecco’s Modified Eagle Media (DMEM), fetal bovine serum (FBS), 100×Pen Strep, 2.5% trypsin-EDTA were purchased from Gibco, USA. The reverse transcription and qRT-PCR kits were purchased from Takara; Trizol was purchased from ambion; trichloromethane, anhydrous ethanol and isopropanol were purchased from Beijing Chemical Factory; PMSF was purchased from Beijing Solarbio Technology Co. protein loading buffer, 20× protein transfer buffer, 10× SDS-PAGE electrophoresis buffer, and blocking solution were purchased from Beyotime Biotechnology Co. GAPDH, E-cadherin, N-cadherin, and vimentin antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA); RNA-free enzyme water, endotoxin-free plasmid macro extraction kit, and plasmid micro extraction kit were purchased from Beijing TIANGEN Biochemical Co. Methods Open access data acquisition and analysis A dataset including RNA sequencing data from 535 LUAD tumors and 59 non-tumors tissues, as well as other relevant clinical information, was downloaded from The Cancer Genome Atlas website (TCGA, https://gdc-portal.nci.nih.gov/). Differential expression analysis of RNA sequencing data was performed using the Wilcox test with R software. The clinical indicators of the samples in the LUAD cohort, such as gender, age, T, N, M and tumor stage, were classified into two groups. Wilcox test was used to analyze whether the expression level of the above prognostic genes was different between the two groups of different clinical indicators. These were analyzed as independent prognostic factors for LUAD by univariate and multifactorial Cox regression. Cell culture H1650, H1299 and 16HBE were maintained in 1640 medium and A549 and H460 cells were maintained in DMEM medium, all media were supplemented with 10% fetal bovine serum and penicillin 100 U/mL and streptomycin 100 mg/mL and incubated in a humidified incubator at 37°C and 5% CO2. Cell transfection LINC01117-siRNA sequence was synthesized by Beijing tsingke Biotechnology. Cells were inoculated into six-well plates the day before transfection and replaced with 2ml of antibiotic-free medium containing 10% FBS on the following day; the transfection system was prepared by adding LINC01117-siRNA to 200ul of transfection buffer to a final concentration of 50mMol/mL, shaking and centrifuging, followed by shaking and centrifuging with 4uL of transfection reagent and incubating for 10min at room temperature. And all of them were added to the cells in the six-well plate, and the control and experimental groups were set up. The transfected cells were incubated in a humidified incubator at 37°C and 5% CO2 for 24h-72h. Lentiviral packaging and infection The packaging plasmid (psPAX2), envelope plasmid (pMD2.G), and shuttle plasmid containing LINC01117 target gene were synthesized by Beijing tsingke Biotechnology Company. HEK293T cells were inoculated in 100 mm cell culture dishes with 3×106 cells per dish. 24 h later, when the cells reached 80% confluence, plasmid transfection was performed and plasmids were added according to the instructions (shuttle plasmid: psPAX2: pMD2.G = 4:3:1). After 48 h of transfection, the supernatant was collected and 10 mL of DMEM complete medium was replenished in a Petri dish. The supernatant was centrifuged at 3000 rpm, filtered through a 0.45μm membrane and stored at 4°C. After 24 h, the supernatant was collected again, centrifuged at 3000 rpm and filtered through a 0.45μm membrane. The supernatant was mixed and centrifuged at 100 000 g for 2 h at 4°C. The supernatant was carefully removed and the virus precipitate was suspended using 500μL DMEM and stored frozen at -80°C in a freezer. Total RNA extraction and reverse transcription The cells were washed with DPBS and the supernatant was aspirated; 500ul of trizol reagent was added to each well, repeatedly blown for 10min at room temperature, Trizol lysate and the lysed cells were transferred together into an ep-tube without RNase, one-fifth of Trizol chloroform was added, i.e. 100uL. Mix well by shaking vigorously for 15s, leave at room temperature for 10 min, centrifuge at 12000×g, 4°C for 15min; remove the upper aqueous phase into a new ep tube, add an equal volume of isopropanol and mix well, leave at room temperature for 10 min, centrifuge at 12000×g, 4°C for 10 min; discard the supernatant, add an equal volume of 75% ethanol as Trizol, wash with gentle blowing and centrifuge at 12000×g, 4°C for 5 min. Centrifuge for 5min; discard supernatant and allow to dry at room temperature; add RNase Free H2O to dissolve the precipitate when it changes from milky white to translucent, mix well and measure the concentration using an ultraviolet photometer. The cDNA was then reverse transcribed and stored at -20°C in the refrigerator. Real time PCR RNA levels were quantified using SYBR Green PCR Master Mix, with GAPDH as the internal reference gene, and the 2-ΔΔCT rule was used to calculate the relative expression of both. qRT-PCR primer sequences were as follows: GAPDH: Forward GTCTCCTCTGACTTCAACAGCG, Reverse Sequence ACCACCCTGTTGCTGTAGCCAA; LINC01117 Forward: GAAGUCACUGAGACACCAATT, LINC01117 Reverse: UUGGUGUCUCUCAGUGACUUCTT. Wound healing assay Cells were inoculated in six-well plates at approximately 4×105 cells per well; the next day the plates were scored perpendicular to the tip of a 10μL gun. The cells were washed 3 times with PBS to remove the scratched cells, medium containing 1% FBS was added and the width of the scratch was recorded under the microscope for 0h and recorded as W0h. The width of the scratch was recorded as W24h after incubation in a humidified incubator at 37°C 5% CO2 for 24h. Mobility was calculated using Image J and plotted using the formula: Mobility = (W0h - W24h)/W0h. Transwell assay Cells were suspended in serum-free medium and counted, and prepared into 2.5–5×105/ml cell suspension; inoculation of cells: Transwell chambers were placed in 24-well plates, and 200μL of cell suspension was added to the upper chamber (for invasion experiments, matrix gel was spread in the chambers in advance, and the matrix gel was mixed with serum-free medium at a ratio of 1:9 and dropped into the Transwell, the cells were incubated in a 37°C cell incubator for more than 2h, so that the matrix gel was denatured and solidified by heat). 500μL of complete medium containing 10% FBS was added to the lower chamber of the 24-well plate and incubated in a humidified constant temperature incubator at 37°C with 5% CO2 for 24–48 h. The cells were fixed with 4% paraformaldehyde for 15 min and stained with crystal violet for 15 min. The cells and crystalline violet were removed from the upper chamber, dried for a few minutes and observed under the microscope. 3 randomly selected fields of view were photographed and all the cells in the photographed fields of view were counted, and the number of Transwell in each group of cells was calculated to characterize the migration and invasion ability of the cells. Western blot Cytoplasmic/nuclear protein extraction: Cells grown in logarithmic phase were collected by centrifugation, leaving the cell precipitate to be prepared. Add PMSF-added Cytoplasmic Protein Extraction Reagent A. Vortex vigorously for 5s at maximum speed to completely suspend and disperse the cell precipitate. Add Cytoplasmic Protein Extraction Reagent B. Vortex at maximal speed for 5s, ice bath for 1min. Vortex at maximal speed for 5s. Centrifuge and immediately aspirate the supernatant, which is the cytoplasmic protein extracted. For the precipitate, the residual supernatant is completely aspirated and the PMSF-added nucleoprotein extraction reagent is added. The supernatant is immediately aspirated by centrifugation and the nucleoprotein is extracted. Total protein extraction: Cells were lysed on ice with cell lysis solution spiked with protease inhibitor, and cell debris and supernatant were separated by centrifugation at 12,000r/min for 5min at 4°C. The supernatant was taken and the total protein concentration was determined using the BCA method. The protein samples were added to the appropriate amount of loading buffer, boiled in a water bath for 5min and separated by 7.5%-12% SDS-PAGE, and the membranes were transferred at constant flow for 2h. The PVDF membranes with transferred proteins were closed in fast closing solution for 30min, incubated overnight at 4°C with proportionally diluted primary antibody, washed three times in TBST and incubated with horseradish peroxidase-associated secondary antibody (1:1000) After washing with TBST, the ECL chemiluminescent solution was reacted with a gel imager, and the results of the protein bands were photographed and the grey scale values were calculated using ImageJ. Statistical analysis All data were expressed as mean ± standard deviation (x±s), and the experimental data were statistically processed using the software GraphPad Prism 8.0. Comparisons between multiple groups were made using ANOVA, and comparisons between two groups were processed using t-test. p<0.05 indicates a significant difference with statistical significance. Results LINC01117 expression was upregulated in LUAD tissues and correlated with aggressive clinical features According to TCGA data, LINC01117 was significantly upregulated in LUAD tissues (Fig 1A). patients with elevated LINC01117 levels had poorer clinical characteristics, including clinical stage and N classification (Fig 1B and 1C), with higher stage associated with higher LINC01117 expression; patients with elevated LINC01117 levels had significantly shorter overall survival (OS), disease specific survival (DSS) and progression-free interval (PFI) were significantly shorter in patients with elevated LINC01117 levels (Fig 1D–1F, OS, HR = 1.66, p = 0.001; DSS, HR = 1.69, p = 0.006; PFI, HR = 1.39, p = 0.014). Univariate and multivariate analyses indicated that, independent of other clinical characteristics, LINC01117 was a valid prognostic biomarker Table 1. 10.1371/journal.pone.0287926.g001 Fig 1 LINC01117 is upregulated in lung adenocarcinoma tissues and is associated with worse clinical features. (A) LINC01117 is upregulated in lung adenocarcinoma tissues. (B, C) Association of LINC01117 with clinical staging. (D-F) Association of LINC01117 with patient OS, DSS and PFI. 10.1371/journal.pone.0287926.t001 Table 1 Univariate and multivariate analyses showed that LINC01117 was an independent prognostic marker for patients with lung cancer. Characteristics Total(N) Univariate analysis Multivariate analysis Hazard ratio (95% CI) P value Hazard ratio (95% CI) P value T stage 523 T1&T2 457 Reference T3&T4 66 2.317 (1.591–3.375) <0.001 1.804 (1.134–2.869) 0.013 N stage 510 N0 343 Reference N1&N2&N3 167 2.601 (1.944–3.480) <0.001 2.244 (1.523–3.307) <0.001 M stage 377 M0 352 Reference M1 25 2.136 (1.248–3.653) 0.006 1.547 (0.802–2.987) 0.193 Pathologic stage 518 Stage I&Stage II 411 Reference Stage III&Stage IV 107 2.664 (1.960–3.621) <0.001 1.328 (0.815–2.164) 0.254 Gender 526 Female 280 Reference Male 246 1.070 (0.803–1.426) 0.642 Age 516 < = 65 255 Reference >65 261 1.223 (0.916–1.635) 0.172 LINC01117 526 Low 265 Reference High 261 1.656 (1.236–2.220) <0.001 1.828 (1.292–2.585) <0.001 LINC01117 is highly expressed in LUAD cells We examined the role of LINC01117 in LUAD at the cellular level. We used RT-qPCR assays to validate LINC01117 expression levels in non-small cell carcinoma lung cancer and immortalized normal epithelial tissue cells, and showed that LINC01117 expression levels were significantly higher in LUAD cell lines H1650 and A549x than in normal human bronchial epithelial cells 16HBE, while in large cell carcinoma H1299 and H460 cell lines were inconsistent in expression (Fig 2A), so we selected LUAD cells H1650 and A549 cells for the follow-up study. The knockdown efficiency of siRNA and overexpression efficiency after lentiviral infection were then verified by RT-qPCR experiments, with knockdown efficiency reaching 70%-80% (Fig 2B and 2D) and overexpression ploidy reaching 3×103 and 3×105 (Fig 2C). 10.1371/journal.pone.0287926.g002 Fig 2 Expression of LINC01117 in lung adenocarcinoma cells. (A) Expression of LINC01117 in lung cancer cells. (B) Knockdown efficiency of LINC01117 in 1650 cells. (C) Expression of LINC01117 after overexpression. (D) Knockdown efficiency of LINC01117 in A549 cells. LINC01117 affects the migration of LUAD cells Transwell migration assay and wound healing assay were used to examine the changes in cell migration ability after LINC01117 downregulation and overexpression. In the wound healing assay, the cell migration area of the LINC01117 knockdown group was significantly smaller than that of the negative control group (Fig 3A–3D), and the cell migration area of the LINC01117 gene overexpression group was significantly larger than that of the negative control group (Fig 4A–4D); in the Transwell assay, the number of cells migrating to the lower chamber of the LINC01117 knockdown group was significantly smaller than that of the negative In the Transwell assay, the number of cells migrating to the lower chamber of the LINC01117 knockdown group was significantly less than that of the negative control group (Fig 3E and 3F), and the number of cells migrating to the lower chamber of the LINC01117 knockdown group was significantly more than that of the negative control group (Fig 4E and 4F). The results showed that knocking down the expression level of LINC01117 inhibited the in vitro migration of H1650 and A549 cells; on the contrary, the in vitro migration ability of H1650 and A549 cells increased after overexpression of LINC01117. 10.1371/journal.pone.0287926.g003 Fig 3 LINC01117 knockdown inhibits lung adenocarcinoma cell migration (A, B) Wound healing assay results for H1650 cells. (C, D) Wound healing assay results of A549 cells. (E, F) Transwell assay results of H1650 cells. (G, H) Transwell assay results of A549 cells. 10.1371/journal.pone.0287926.g004 Fig 4 LINC01117 overexpression promotes migration of lung adenocarcinoma cells (A, B) Wound healing assay results for H1650 cells. (C, D) Wound healing assay results of A549 cells. (E, F) Results of Transwell assay on H1650 cells. (G, H) Results of Transwell assay on A549 cells. LINC01117 affects invasion of LUAD cells Transwell assays examined changes in cell invasion ability after LINC01117 knockdown and overexpression. The number of H1650 and A549 cells invading into the lower lumen was significantly less in the LINC01117 knockdown group than in the control group (Fig 5A–5D), while the number of H1650 and A549 cells invading into the lower lumen was significantly more in the LINC01117 overexpression group than in the control group (Fig 5E–5H). This indicates that knocking down the expression level of LINC01117 inhibited the invasion of H1650 and A549 cells in vitro; Conversely, the invasion ability of H1650 and A549 cells increased after overexpression of LINC01117. 10.1371/journal.pone.0287926.g005 Fig 5 LINC01117 promotes lung adenocarcinoma cell invasion (A-D) Transwell invasion of H1650 and A549 cells after knockdown of LINC01117. (E-H) Transwell invasion results of H1650 and A549 cells after overexpression of LINC01117. LINC01117 affects the EMT process In tumors metastasis, epithelial mesenchymal transition (EMT) is considered to be one of the important molecular mechanisms. To investigate in depth the molecular mechanisms by which LINC01117 promotes metastasis in LUAD cells, we next explored the role that LINC01117 plays in the EMT process in LUAD. We examined the expression of E-cadherin, N-cadherin, Vimentin, ZEB1, snail and slug, proteins related to the EMT pathway, in A549 cells overexpressing and knocking down LINC01117 by Western blot. The results showed that overexpression of LINC01117 significantly elevated the expression of N-cadherin, Vimentin, ZEB1, snail and slug, while the expression of E-cadherin was inhibited, and on the contrary, the opposite result was obtained in the knockdown group. (Fig 6A and 6B), These experimental results suggest a close correlation between changes in LINC01117 expression and the expression levels of EMT-related markers such as E-cadherin, N-cadherin and Vimentin, strongly suggesting that LINC01117 may regulate lung adenocarcinoma progression by affecting EMT process. 10.1371/journal.pone.0287926.g006 Fig 6 LINC01117 affects the EMT process (A, B) Western blot assays examined the expression of key proteins of the EMT process in control and LINC01117 overexpression groups of A549 cells. LINC01117 affects the nuclear and cytoplasmic distribution of YAP1 cells The Hippo pathway has been widely demonstrated to play an important role in cancer, where YAP1, one of the key components of the Hippo pathway, interacts with EMT-related proteins to influence tumors cell migration and invasion. To investigate the role of LINC01117 in regulating the Hippo pathway in lung adenocarcinoma cells, we extracted total protein, cytoplasmic and nuclear proteins and assayed YAP1 levels in A549 cells with LINC01117 overexpression and knockdown. The results showed that although changes in LINC01117 expression did not significantly affect the overall intracellular levels of YAP1 protein, they significantly altered its distribution in the nucleus and cytoplasm, with knockdown of LINC01117 increasing the enrichment of YAP1 protein in the cytoplasm and decreasing its levels in the nucleus; whereas LINC01117 overexpression produced the opposite intracellular distribution results (Fig 7A and 7B). This suggests that LINC01117 may influence Hippo pathway activity by regulating the distribution of YAP1 in the nucleus and cytoplasm. 10.1371/journal.pone.0287926.g007 Fig 7 Effect of nuclear and cytoplasmic distribution of YAP1 in A549 cells overexpressing and knocking down LINC01117 (A, B) expression of YAP1 in the nucleus and cytoplasm in A549 cells overexpressing LINC01117; (C, D) expression of YAP1 in the nucleus and cytoplasm in A549 cells knocking down LINC01117. Discussion LUAD is a highly prevalent malignancy with a trend of increasing morbidity and mortality year by year. Although a combination of surgical treatment, radiotherapy, targeted therapy and immunotherapy has made considerable progress in the treatment of LUAD, metastasis remains the main cause of death in patients with LUAD [17]. Despite the extensive research in the direction of LUAD invasion and metastasis, few stable biomarkers have been identified and used to assess the risk of LUAD metastasis or to predict clinical outcomes. Therefore, the identification of validated key genes associated with LUAD invasion and metastasis is important for early diagnosis and improving the prognosis and clinical outcomes of LUAD patients. In recent years, an increasing number of aberrantly expressed genes have been identified to play a key role in the development and progression of various cancers, and LncRNAs can act as both oncogenes and tumors suppressor genes to regulate tumorigeneses and progression [17, 18]. Therefore, exploring the functions and mechanisms of action of differentially expressed LncRNAs in LUAD may lay the foundation for new diagnostic and therapeutic approaches for LUAD. EMT is a mechanism that was first discovered in the 1980s [19]. EMT is the transition of cells from an epithelial to a mesenchymal state [20, 21]. This process modifies cell-expressed adhesion molecules, including E-cadherin, which is responsible for tight junctions, and the miRNA200 family, which helps maintain the epithelial phenotype. As cells acquire mesenchymal markers, such as N-cadherin, wave proteins and fibronectin, as well as the fibroblast proliferation transcription factors Snail, Slug and Twist, cells migrate towards a more mesenchymal phenotype [22]. EMT can be divided into three distinct types: type 1 EMT is an important physiological event during embryonic development and organogenesis; type 2 EMT is associated with adult tissue regeneration and occurs during wound healing, inducing cell migration, growth and organ fibrosis; and type 3 occurs during cancer progression [23, 24]. The miRNA-200 family and miR-205 together regulate the E-cadherin transcriptional repressors ZEB1 and SIP1, and decreased expression of these miRNAs upregulates ZEB1 and SIP1 [25], inhibits E-cadherin expression, and induces EMT [26]. The EMT process is regulated by multiple signaling pathways and transcriptional mechanisms, including LncRNAs [27]. Hu et al. found more than 99 LncRNAs involved in the EMT process [28]. Wang et al. found that MIR99AHG represses EMT in pulmonary fibrosis via the miR-136-5p/USP4/ACE2 axis [29]. Li et al. validated that LncRNA PCBP1-AS1 inhibited EMT progression suppressing LUAD metastasis [30]. In addition, a number of studies have found that LncRNAs can also regulate the EMT process in tumors through their role in related signaling pathways. We found corresponding changes in the expression of EMT-related proteins in A549 cells overexpressing and knocking down LINC01117. Overexpression of LINC01117 promoted the EMT process; while knockdown of LINC01117 inhibited the EMT process, suggesting that LINC01117 in lung adenocarcinoma cells may promote cell migration and invasion through the EMT process. The Hippo pathway and the EMT process are inextricably linked [31, 32], and in particular, YAP1, a key effector of the Hippo pathway, can regulate EMT transcription factors through direct or indirect interactions to influence tumors cell invasion and metastasis [33]. In the case of Hippo pathway inhibition, YAP1 enters the nucleus and binds to transcription factors to promote transcriptional expression of downstream genes and influence tumors progression [34]. To investigate the effect of LINC01117 on the Hippo pathway, we extracted total, cytoplasmic and nuclear proteins from A549 cells with overexpression and knockdown of LINC01117, and examined YAP1 expression. The results suggest that LINC01117 may affect the migration and invasion of lung adenocarcinoma cells by influencing the expression of EMT transcription factors through the entry of YAP1 into the nucleus, providing a potential target for the treatment of LUAD. Supporting information S1 Raw images (PDF) Click here for additional data file. 10.1371/journal.pone.0287926.r001 Decision Letter 0 Li Zhiming Academic Editor © 2023 Zhiming Li 2023 Zhiming Li https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version0 Transfer Alert This paper was transferred from another journal. As a result, its full editorial history (including decision letters, peer reviews and author responses) may not be present. 11 Apr 2023 PONE-D-23-05797LINC01117 inhibits invasion and migration of lung adenocarcinoma through influencing EMT processPLOS ONE Dear Dr. Liu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by May 26 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Zhiming Li, Ph.D. Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and  https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.     In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions Additional Editor Comments (if provided): Dear Authors, Your manuscript entitled 'LINC01117 inhibits invasion and migration of lung adenocarcinoma through influencing EMT process' has been evaluated by two referees and their comments are attached below. While the role of LINC01117 in lung cancer is an interesting subject, both reviewers have raised some critical concerns about the manuscript. Specifically, the data quality of figures 4-6 has hampered the interpretation of some of the results. Therefore, we're inviting a major revision so that you can address these concerns before moving forward. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: No Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: No Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: No Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: 1. Insufficient innovation in research, and no further research on the downstream regulatory mechanism of linc01117. 2. Is the position of the ruler in Figure 4c inconsistent? Was the image scaled? 3. The protein band in Figure 6 does not match the quantification results. It is recommended to re-quantify using Image J. 4. The band of N-cadherin protein in Figure 6 seems to be a partial cut of a complete band. Please provide the image of original band. 5. The text and reference format does not meet the requirements of this journal. Reviewer #2: The overall idea of the article is clear, the language is fluent, and the results are clear.Inhibition of LINC01117 expression can significantly inhibit the migration and invasion of lung adenocarcinoma cells. LINC01117 is associated with poor clinical features (stage and N classification) and poor prognosis, suggesting that LINC01117 may play a key role in the occurrence and development of lung adenocarcinoma. The existing deficiencies are as follows: 1. General cell staining was performed for clone formation experiments, and entire Wells of 6-well plates were photographed. In this paper, the entire hole of the 6-well plate is not shown, and no scale is marked on the picture. The experimental images in FIG. 4 are of low quality and are not scaled. 2. As for FIG5, it is too vague to see clearly when enlarged. The cell morphology is not clear and the background is a little messy. It is recommended to optimize the image processing method. In addition, there are too many cells in FIG5A and FIG5E, how to count them accurately? It is recommended to change to a graph with a moderate number of cells. 3. The number of bands in Western blot was too small, so it is suggested to increase the knockdown experiments before trend explanation. 4.The language of this article needs further modification. Final review: Minor revision ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10.1371/journal.pone.0287926.r002 Author response to Decision Letter 0 Submission Version1 25 May 2023 Response to Reviewer 1 Comments Comment 1: Insufficient innovation in research, and no further research on the downstream regulatory mechanism of linc01117. Response 1: Thank you for your comment. In our newly submitted article, we complement the downstream regulatory mechanism of LINC01117 in lung adenocarcinoma, which may regulate Hippo pathway activity by altering the distribution of YAP1 in the nucleus and cytoplasm. (Please see lines 329 to 347) Comment 2: Is the position of the ruler in Figure 4c inconsistent? Was the image scaled? Response 2: Thank you very much for your careful identification of the problem with the scale in Figure 4. We have modified the image scales in Figure 4 and scaled the graphics consistently for better layout. We have also reconfirmed the scale of all the images. (Please see Fig 4) Comment 3: The protein band in Figure 6 does not match the quantification results. It is recommended to re-quantify using Image J. Response 3: Thank you for your comment. We have performed replicate experiments for Figure 6, in addition to validating the expression of the EMT-related proteins ZEB1, snail and slug proteins, and quantified them using Image J.(Please see Fig 6) Comment 4: The band of N-cadherin protein in Figure 6 seems to be a partial cut of a complete band. Please provide the image of original band. Response 4: Thank you for your comment. We have performed a repeat experiment for Figure 6 and uploaded the original uncropped and unadjusted images of all blot or gel result reports as required by the PLOS ONE journal. (Please see Fig 6 and S1_raw_images) Comment 5: The text and reference format does not meet the requirements of this journal. Response 4: Thank you for your comment. We deeply apologize for the issue of non-standard formatting in the manuscript. We have reread the manuscript upload requirements for the PLOS ONE journal and made modifications to the parts of the text and reference formats that do not comply with the requirements of this journal. (See highlighted sections in the text)  Response to Reviewer 2 Comments The overall idea of the article is clear, the language is fluent, and the results are clear. Inhibition of LINC01117 expression can significantly inhibit the migration and invasion of lung adenocarcinoma cells. LINC01117 is associated with poor clinical features (stage and N classification) and poor prognosis, suggesting that LINC01117 may play a key role in the occurrence and development of lung adenocarcinoma. The existing deficiencies are as follows: Comment 1: General cell staining was performed for clone formation experiments, and entire Wells of 6-well plates were photographed. In this paper, the entire hole of the 6-well plate is not shown, and no scale is marked on the picture. The experimental images in FIG. 4 are of low quality and are not scaled. Response 1: Thank you for your comment. The clone formation experiment is not involved in this manuscript, and the staining images you see may be the experimental results of cell invasion and migration. We apologize for our carelessness regarding the lack of scale in the images. We have re standardized the scale and size of the images and adjusted their clarity. (Please see Fig 4) Comment 2: As for FIG5, it is too vague to see clearly when enlarged. The cell morphology is not clear and the background is a little messy. It is recommended to optimize the image processing method. In addition, there are too many cells in FIG5A and FIG5E, how to count them accurately? It is recommended to change to a graph with a moderate number of cells. Response 2: Thank you for your comment. Based on your suggestion, we have redone the experiment in Figure 5 to address issues such as unclear images and excessive cell density, and adjusted the clarity of the experimental results. As you mentioned, in the new experimental results graph, a moderate cell density is indeed more conducive to accurate counting. (Please see Fig 5) Comment 3: The number of bands in Western blot was too small, so it is suggested to increase the knockdown experiments before trend explanation. Response 3: Thank you for your comment. Based on your suggestion, we conducted knockdown experiments on LINC01117 and validated the levels of key proteins related to the EMT process through Western blot experiments. The results met our expectations and demonstrated that LINC01117 activated the EMT pathway. In addition, we validated the protein expression of other EMT related molecules ZEB1, Snail and Slug, and supplemented the above experimental results in the manuscript, increasing the credibility of our conclusion. (Please see Fig 6) Comment 4: The language of this article needs further modification. Response 4: Thank you for your comment. We deeply apologize for the language used in the manuscript. We spent a long time revising the manuscript and have highlighted it in yellow in the text. We have now conducted research on language and readability, and we really hope to have a substantial improvement in the language proficiency of the article. Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0287926.r003 Decision Letter 1 Li Zhiming Academic Editor © 2023 Zhiming Li 2023 Zhiming Li https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 15 Jun 2023 LINC01117 inhibits invasion and migration of lung adenocarcinoma through influencing EMT process PONE-D-23-05797R1 Dear Dr. Liu, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Zhiming Li, Ph.D. Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation. Reviewer #2: All comments have been addressed ********** 2. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #2: Yes ********** 3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #2: Yes ********** 4. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #2: Yes ********** 5. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #2: Yes ********** 6. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #2: In this study, authors LINC01117 expression was upregulated in LUAD tissues and correlated with aggressive clinical features. This study is relatively clear, the English language is standardized, the research purpose is clear, and the problems found in the past have been corrected accordingly. ********** 7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #2: Yes: Chuanxin Wang ********** 10.1371/journal.pone.0287926.r004 Acceptance letter Li Zhiming Academic Editor © 2023 Zhiming Li 2023 Zhiming Li https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 21 Jun 2023 PONE-D-23-05797R1 LINC01117 inhibits invasion and migration of lung adenocarcinoma through influencing EMT process Dear Dr. Liu: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Zhiming Li Academic Editor PLOS ONE ==== Refs References 1 Siegel RL , Miller KD , Fuchs HE , Jemal A . Cancer Statistics, 2021. CA: A Cancer Journal for Clinicians. 2021;71 (1 ):7–33. doi: 10.3322/caac.21654 33433946 2 Sung H , Ferlay J , Siegel RL , Laversanne M , Soerjomataram I , Jemal A , et al . Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: A Cancer Journal for Clinicians. 2021;71 (3 ):209–49. doi: 10.3322/caac.21660 33538338 3 Schabath MB , Cote ML . Cancer Progress and Priorities: Lung Cancer. Cancer Epidemiology, Biomarkers & Prevention. 2019 2019-10-1;28 (10 ):1563–79. doi: 10.1158/1055-9965.EPI-19-0221 31575553 4 Andrew G Nicholson MSTM. The 2021 WHO Classification of Lung Tumors: Impact of Advances Since 2015. J THORAC ONCOL. 2022;17 (3 ):362–87. doi: 10.1016/j.jtho.2021.11.003 34808341 5 Stinchcombe TE , Bogart J , Veeramachaneni NK , Kratzke R , Govindan R . Annual Review of Advances in Non-small Cell Lung Cancer Research: A Report for the Year 2010. J THORAC ONCOL. 2011 2011-1-1;6 (8 ):1443–50. doi: 10.1097/JTO.0b013e3182246413 21709589 6 Herbst RS , Morgensztern D , Boshoff C . The biology and management of non-small cell lung cancer. NATURE. 2018;553 (7689 ):446–54. doi: 10.1038/nature25183 29364287 7 Kim CFB , Jackson EL , Woolfenden AE , Lawrence S , Babar I , Vogel S , et al . Identification of Bronchioalveolar Stem Cells in Normal Lung and Lung Cancer. CELL. 2005;121 (6 ):823–35. doi: 10.1016/j.cell.2005.03.032 15960971 8 Fedorova AASA Topolnitskyc TSGE , Durovaf NASO Marina V. Zavyalovae FVMP . Prognosis of Different Types of Non-Small Cell Lung Cancer Progression: Current State and Perspectives. Cellular Physiology and Biochemistry. 2021 2021-3-10;55 (S2 ):29–48. doi: 10.33594/000000340 33687819 9 Park HJ , Lee SH , Chang YS . Recent advances in diagnostic technologies in lung cancer. The Korean Journal of Internal Medicine. 2020 2020-3-1;35 (2 ):257–68. doi: 10.3904/kjim.2020.030 32131569 10 Cheng B , Xiong S , Li C , Liang H , Zhao Y , Li J , et al . An annual review of the remarkable advances in lung cancer clinical research in 2019. J THORAC DIS. 2020;12 (3 ):1056–69. doi: 10.21037/jtd.2020.03.11 32274174 11 Ge X , Li G , Jiang L , Jia L , Zhang Z , Li X , et al . Long noncoding RNA CAR10 promotes lung adenocarcinoma metastasis via miR-203/30/SNAI axis. ONCOGENE. 2019;38 (16 ):3061–76. doi: 10.1038/s41388-018-0645-x 30617305 12 Garbo S , Maione R , Tripodi M , Battistelli C . Next RNA Therapeutics: The Mine of Non-Coding. International Journal of Molecular Sciences. 2022 2022-7-5;23 (13 ):7471. doi: 10.3390/ijms23137471 35806476 13 Derrien T , Johnson R , Bussotti G , Tanzer A , Djebali S , Tilgner H , et al . The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression. GENOME RES. 2012;22 (9 ):1775–89. doi: 10.1101/gr.132159.111 22955988 14 Flynn RA , Chang HY . Long Noncoding RNAs in Cell-Fate Programming and Reprogramming. CELL STEM CELL. 2014;14 (6 ):752–61. doi: 10.1016/j.stem.2014.05.014 24905165 15 Morlando M , Fatica A . Alteration of Epigenetic Regulation by Long Noncoding RNAs in Cancer. International Journal of Molecular Sciences. 2018 2018-2-14;19 (2 ):570. doi: 10.3390/ijms19020570 29443889 16 Wang H , Shu L , Niu N , Zhao C , Lu S , Li Y , et al . Novel lncRNAs with diagnostic or prognostic value screened out from breast cancer via bioinformatics analyses. PEERJ. 2022 2022-7-14;10 :e13641. doi: 10.7717/peerj.13641 35855425 17 Xiaobin Guo ZCLZ . Long non-coding RNA-HAGLR suppressed tumor growth of lung adenocarcinoma through epigenetically silencing E2F1. EXP CELL RES. 2019;382 (1 ). 18 Lizhong Zeng XLJY . Long non-coding RNA LINC01116 is overexpressed in lung adenocarcinoma and promotes tumor proliferation and metastasis. AM J TRANSL RES. 2020;12 (8 ):4302–13. 32913506 19 G Greenburg EDH . Cytodifferentiation and tissue phenotype change during transformation of embryonic lens epithelium to mesenchyme-like cells in vitro. DEV BIOL. 1986;115 (2 ):363–79. doi: 10.1016/0012-1606(86)90256-3 3519318 20 Cui Y , Wang X , Zhang L , Liu W , Ning J , Gu R , et al . A novel epithelial-mesenchymal transition (EMT)-related gene signature of predictive value for the survival outcomes in lung adenocarcinoma. FRONT ONCOL. 2022 2022-9-15;12. doi: 10.3389/fonc.2022.974614 36185284 21 Bakir B , Chiarella AM , Pitarresi JR , Rustgi AK . EMT, MET, Plasticity, and Tumor Metastasis. TRENDS CELL BIOL. 2020;30 (10 ):764–76. doi: 10.1016/j.tcb.2020.07.003 32800658 22 Zeisberg M , Neilson EG . Biomarkers for epithelial-mesenchymal transitions. J CLIN INVEST. 2009 2009-6-1;119 (6 ):1429–37. doi: 10.1172/JCI36183 19487819 23 Raghu Kalluri RAW . The basics of epithelial-mesenchymal transition. J CLIN INVEST. 2009;119 (6 ):1420–8. doi: 10.1172/JCI39104 19487818 24 Børretzen A , Gravdal K , Haukaas SA , Mannelqvist M , Beisland C , Akslen LA , et al . The epithelial–mesenchymal transition regulators Twist, Slug, and Snail are associated with aggressive tumour features and poor outcome in prostate cancer patients. The Journal of Pathology: Clinical Research. 2021;7 (3 ):253–70. doi: 10.1002/cjp2.202 33605548 25 Kim NH , Song SH , Choi YH , Hwang KH , Yun JS , Song H , et al . Competing Endogenous RNA of Snail and Zeb1 UTR in Therapeutic Resistance of Colorectal Cancer. International Journal of Molecular Sciences. 2021 2021-9-3;22 (17 ):9589. doi: 10.3390/ijms22179589 34502497 26 Senfter D , Madlener S , Krupitza G , Mader RM . The microRNA-200 family: still much to discover. Biomolecular Concepts. 2016;7 (5–6 ):311–9. doi: 10.1515/bmc-2016-0020 27837593 27 Liu T , Yang C , Wang W , Liu C . LncRNA SGMS1‐AS1 regulates lung adenocarcinoma cell proliferation, migration, invasion, and EMT progression viamiR‐106a‐5p/MYLI9 axis. THORAC CANCER. 2021;12 (14 ):2104–12. doi: 10.1111/1759-7714.14043 34061466 28 Hu P , Yang J , Hou Y , Zhang H , Zeng Z , Zhao L , et al . LncRNA expression signatures of twist-induced epithelial-to-mesenchymal transition in MCF10A cells. CELL SIGNAL. 2014;26 (1 ):83–93. doi: 10.1016/j.cellsig.2013.10.001 24113349 29 Wang J , Xiang Y , Yang S , Zhang H , Li H , Zong Q , et al . MIR99AHG inhibits EMT in pulmonary fibrosis via the miR-136-5p/USP4/ACE2 axis. J TRANSL MED. 2022 2022-9-23;20 (1 ). doi: 10.1186/s12967-022-03633-y 36138468 30 Li Z , Pan C , Wang Z , Deng X , Zhu Q , Wu W , et al . LncRNA PCBP1-AS1 correlated with the functional states of cancer cells and inhibited lung adenocarcinoma metastasis by suppressing the EMT progression. CARCINOGENESIS. 2021 2021-7-16;42 (7 ):931–9. doi: 10.1093/carcin/bgab047 34107009 31 Yu S , Zhang Y , Li Q , Zhang Z , Zhao G , Xu J . CLDN6 promotes tumor progression through the YAP1-snail1 axis in gastric cancer. CELL DEATH DIS. 2019 2019-1-1;10 (12 ):949. doi: 10.1038/s41419-019-2168-y 31827075 32 Lehmann W , Mossmann D , Kleemann J , Mock K , Meisinger C , Brummer T , et al . ZEB1 turns into a transcriptional activator by interacting with YAP1 in aggressive cancer types. NAT COMMUN. 2016 2016-1-1;7 (1 ):10498. doi: 10.1038/ncomms10498 26876920 33 Li H , Li Q , Jin M , Lu C , Mu Z , Xu W , et al . A review: hippo signaling pathway promotes tumor invasion and metastasis by regulating target gene expression. J CANCER RES CLIN. 2021 2021-1-1;147 (6 ):1569–85. doi: 10.1007/s00432-021-03604-8 33864521 34 Yang S , Wang S , Chen L , Wang Z , Chen J , Ni Q , et al . Neutrophil Extracellular Traps Delay Diabetic Wound Healing by Inducing Endothelial-to-Mesenchymal Transition via the Hippo pathway. INT J BIOL SCI. 2023 2023-1-1;19 (1 ):347–61. doi: 10.7150/ijbs.78046 36594092