==== Front PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0287347 PONE-D-23-02043 Research Article Research and Analysis Methods Biological Cultures Cell Cultures Cultured Tumor Cells Melanoma Cells Medicine and Health Sciences Oncology Cancers and Neoplasms Melanoma Biology and Life Sciences Cell Biology Cellular Structures and Organelles Vesicles Exosomes Biology and Life Sciences Molecular Biology Molecular Biology Techniques Transfection Research and Analysis Methods Molecular Biology Techniques Transfection Biology and life sciences Biochemistry Nucleic acids RNA Non-coding RNA Natural antisense transcripts MicroRNAs Biology and life sciences Genetics Gene expression Gene regulation MicroRNAs Medicine and Health Sciences Oncology Cancers and Neoplasms Colorectal Cancer Medicine and Health Sciences Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Medicine and Health Sciences Oncology Cancers and Neoplasms Skin Neoplasms Skin Tumors Medicine and Health Sciences Dermatology Skin Neoplasms Skin Tumors Exosome-delivered circRPS5 inhibits the progression of melanoma via regulating the miR-151a/NPTX1 axis Exosomal circRPS5/miR-151a/NPTX1 axis in melanoma https://orcid.org/0000-0003-2283-1588 Zhu Haijun Conceptualization Data curation Formal analysis Writing – original draft Writing – review & editing * Zhang Pan Data curation Formal analysis Investigation Methodology Resources Validation Shi Jia Methodology Software Supervision Validation Visualization Kou Deqiang Investigation Methodology Resources Software Validation Visualization Writing – review & editing Bai Xinping Conceptualization Funding acquisition Investigation Project administration Resources Supervision Writing – review & editing Department of Plastic Surgery, The Central Hospital of Wuhan, Tong ji Medical College, Huazhong University of Science and Technology, Wuhan, China Decock Julie Editor Qatar Biomedical Research Institute, QATAR Competing Interests: The authors have declared that no competing interests exist. * E-mail: zhuhaijun9988@163.com 29 6 2023 2023 18 6 e028734723 1 2023 4 6 2023 © 2023 Zhu et al 2023 Zhu et al https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Background Circular RNAs (circRNAs) have been reported to exert critical functions in tumorigenesis and development. However, the underlying mechanism by which circRNAs regulate melanoma progression remain to be elucidated. Methods The differentially expressed circRNAs were first identified by circRNA-seq, and circRNAs were validated via qRT-PCR and Sanger sequencing. Then, the impact of circRPS5, miR-151a and NPTX1 expression on the progression of melanoma cell were determined by gain- and loss-of-function assays. The relationship between circRPS5, miR-151a, and NPTX1 was predicted by StarBase website and authenticated by luciferase reporter assay. The melanoma cells-derived exosomes were characterized using nanoparticle tracking analysis (NTA) and western blot. Results CircRPS5 was significantly downregulated in melanoma tissues and cell lines. Functionally, circRPS5 suppressed the proliferation, migration, and invasion of melanoma cells, and induced cell cycle arrest and apoptosis in vitro. Mechanistically, circRPS5 harbor miR-151a, acting as miRNA sponge, and then miR-151a targeted the 3’-UTR of NPTX1. Finally, circRPS5 was mainly incorporated into exosomes to inhibit the progression of melanoma cells. Conclusions This finding reveal circRPS5 suppressed the progression of melanoma through miR-151a/NPTX1 pathway, and may provide a promising therapeutic strategies for melanoma. The author(s) received no specific funding for this work. Data AvailabilityAll relevant data are within the manuscript and its Supporting information files. Data Availability All relevant data are within the manuscript and its Supporting information files. ==== Body pmcIntroduction Melanoma is one of the most common malignant skin tumor originating from melanocytes with a highly aggressive and mortality [1]. Globally, the incidence of melanoma is rapidly increasing and is associated with ultraviolet (UV) irradiation, especially in fair-skinned populations receive excessive sun exposure [2]. The prognosis of melanoma remains dismal due to the insensitivity of melanoma cells to anticancer drugs [3–5]. Therefore, further research is urgently needed to explore the molecular pathogenesis of melanoma and identify more effective therapeutic targets for patients with melanoma. Circular RNAs (circRNAs) are a type of endogenous noncoding RNAs (ncRNAs) with single-stranded closed-loop RNA molecules lacking terminal 5’ caps and 3’ poly-adenylated tails [6]. Owing to this extraordinary construction, circRNAs are resistant to exonuclease degradation and more stable than linear RNAs [7]. Moreover, circRNAs can function as competing endogenous RNAs (ceRNAs) and regulate gene expression at the transcriptional or post-transcriptional level by sponging microRNAs (miRNAs) [8, 9]. Thus, circRNAs play crucial roles in many cellular processes, and their dysregulation is involved in the occurrence and development of various disease, most prominently in cancer [10, 11]. For example, a novel circRNA named hsa_circ_0001666 was found to suppress the progression of colorectal cancer through the miR-576-5p/PCDH10 axis [12]. Huang et al. found that hsa_circRNA_104348 could act as a tumor promotor in hepatocellular carcinoma by sponging oncogenic miR-187-3p to promote RTKN2 expression [13]. However, the role and underlying mechanisms of circRNAs in melanoma remains to be unmasked. Exosomes are a type of extracellular vesicles (30–150 nm in diameters) secreted from almost all living cells [14]. They contain endogenous proteins and nucleic acids that play essential roles in intercellular communications [15]. Mounting evidence suggests that exosomes play an essential role in tumor occurrence and progression through the crosstalk between cancer and non-cancer cells within the tumor microenvironment [16]. Recently, exosome-mediated transfer of circRNAs has been reported to play a crucial role in regulating tumor growth, metastasis, and angiogenesis in the process of cancer development [17, 18]. For instance, exosomal circRNAs derived from adipocytes promotes the tumorigenesis of hepatocellular carcinoma by regulating the miR-34a/USP7 pathway [19]. However, the relationship between exosomal circRNA and melanoma remains unclear. In this study, we demonstrate that a novel circRNA named circRPS5 significantly downregulated in melanoma tissues and cell lines. Subsequently, we found that circRPS5 was negatively associated with melanoma progression by sponging miR-151a to influence the expression of neuronal pentraxin 1 (NPTX1). Moreover, we also found circRPS5 is mainly exist in exosomes and then plays a regulatory role in melanoma cells. Collectively, our findings suggest that circRPS5 might act as a promising therapeutic target for melanoma therapy. Methods Bioinformatics analysis We first downloaded the raw transcriptome data (GSE31909, GSE35388 and TCGA-SKCM) and the corresponding clinical information from Gene Expression Omnibus (GEO) and TCGA database. the expression matrix is standardized according to the RMA and LIMMA algorithm [20]. Then, the differentially expressed genes (DEGs) between experiment and control group were identified using DESeq2 package with thresholds of logFC > 1.3 and P < 0.05 [21]. The candidate molecules were identified by overlapping DEGs with predicted targets and visualized using the VennDiagram package. Cell culture and transfection The normal human melanocytes (HeMa-Lp) and human melanoma cells (A375 and A2058) were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences China (Shanghai, China). All the cells were cultured in high-glucose Dulbecco’s Modified Eagle Medium (DMEM, GibcoBRL, Invitrogen, Carlsbad, CA, USA) and supplemented with a 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Waltham, MA, USA), 100 U/ml penicillin and 100 μg/ml streptomycin. During the culture period, the cells were incubated at 37°C in a humidified atmosphere of 5% CO2 and 95% air. The A375 and A2058 cells were seeded in 6-well plates at a density of 2 × 104 cells per well. The cells were then transfected with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). Briefly, pcDNA, miRNA inhibitor or mimic was diluted in Opti-MEM (Invitrogen, Carlsbad, CA, USA), stand for 5 min, and mixed with Lipofectamine 3000. Transfection solution was stand for 20 min and applied in each well. 72 h after the transfection, cells were harvested for the later study. Quantitative reverse transcription polymerase reaction (qRT-PCR) Total cellular RNA was extracted from the cultured melanoma cells using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Reverse transcription was performed using 1.0 μg total RNA and a MicroRNA Reverse Transcription Kit (Takara Biotechnology, Japan) or Prime Script™ RT kit (Takara, Dalian, China), which were used to investigate the expression of miRNA and mRNA, respectively. Amplification reactions was carried out on an ABI 7500 Sequencing Detection System (Applied Biosystems, CA, USA) with a SYBR green PCR Master Mix (Takara, Japan). All reactions were run in triplicate and were normalized to the miRNA house-keeping gene U6 or the mRNA house-keeping gene GAPDH. All primers are listed in Table 1. 10.1371/journal.pone.0287347.t001 Table 1 The sequence of PCR primers and oligonucleotide sets used for short hairpin RNAs, or probe. Primer Sequence CircRPS5 Forward: 5’- CTGAGTGCCTGGCAGATGA -3’ (convergent) Reverse: 5′- AGGGCAGACAGGTTTATTGG-3 CircRPS5 Forward: 5’- GCCCAATAAACCTGTCTGCC -3’ (divergent) Reverse: 5′- GCAATGGTCTTAATGTTCCGGA -3’ CircRPLP1 Forward: 5’- GGGAGCCTCATCTGCAATG-3’ (convergent) Reverse: 5′- CTCGGATTCTTCTTTCTTTGC-3’ CircRPLP1 Forward: 5’- TGAGGAGAAGAAAGTGGAAGCA -3’ (divergent) Reverse: 5′- AGGCTCCCAATGTTGACGTT -3’ miR-151a Forward: 5’- GGATGCTAGACTGAAGCTCCT-3’ Reverse: 5′- CAGTGCGTGTCGTGGAGT -3’ miR-324 Forward: 5’- TGTGGTTACGGGATCCCCTACGC-3’ Reverse: 5′- GCGTAGGGGATCCCGTAACCACA-3’ hsa_circ_0054602 Forward: 5’- AGACTGATCTTTGCTGGCAA -3’ Reverse: 5’- GGTGATGGTCTTCCCCGTAA -3’ hsa_circ_0020708 Forward: 5’- TGAGAAGAAGGAGGAGTCTGA -3’ Reverse: 5′- AGGTACACTGGCAAGCTTG -3’ hsa_circ_0064917 Forward: 5’- TCGATGGACCTTGCACTCAA -3’ Reverse: 5′- AAAGGAGACATAGGCCACCC-3’ hsa_circ_0007999 Forward: 5’- TTTTGACCTGCTCCGTTTCC-3’ Reverse: 5′- TGTTCAAAAGAGACGGGGTC-3’ hsa_circ_0076141 Forward: 5’- GACATCGAGGCGCTGAAAA-3’ Reverse: 5′- GGGAGTGGACTTAAGCCTGA-3’ hsa_circ_0011392 Forward: 5’- TCAACTCAGCTGCCCTCTC-3’ Reverse: 5′- GCGGTCACAAACATGGTCAT-3’ hsa_circ_0050747 Forward: 5’- GACACGACACCCTGATCTGA-3’ Reverse: 5′- ACCTCCATGTCATCTCCAGC-3’ hsa_circ_0078180 Forward: 5’- ATCGCTGCAAATCTCCAACC-3’ Reverse: 5′- AAGCCCCAATTACCTCCGTT-3’ NPTX1 Forward: 5’- ACAGCCGCCTCAATTCCTC-3’ Reverse: 5′- GCTCTTCTTCACCTTGGCATACA-3’ AURS2 Forward: 5’- CACCTCCTCATCACAGCAACT-3’ Reverse: 5′- TCTTCTCGACGCTTTCCCT-3’ RPS6KA2 Forward: 5’- ATCCACTTCACCGATGGCTAC-3’ Reverse: 5′- CGCATCAGCTCCATTACCAG-3’ KAT2B Forward: 5’- TGTTCCTAAACCGCATCAA-3’ Reverse: 5′- CGAGGTAGACTGTCGCAGA-3’ MYO5A Forward: 5’- ATGTGGTCCGCAGGAGGTA-3’ Reverse: 5′- AAGCAGCACTGAAGGTAGATG-3’ HMG20B Forward: 5’- CGTGGTGACTGTCAAGCAAGAG-3’ Reverse: 5′- AGATGGGAACATCGAAGGTGG-3’ RNA fluorescent in situ hybridization (FISH) The FISH assay, Cy3-labeled circRPS5 probes and 488-labeled miR-151a probes were designed and synthesized by RiboBio (Guangzhou, China). Briefly, the cells were fixed and then hybridized with the probe by incubation at 37°C overnight. After washing with phosphate-buffered saline (PBS) for three times, the cell nuclear were stained with DAPI. Finally, the images were taken using a Nikon A1 confocal microscope (Nikon, Japan). RNase R linear RNA digestion experiment The total RNA was incubated with or without 40 U RNase R at 37°C for 15 min. After treatment with Rnase R, the expression levels of RPS5 and circRPS5 were analyzed using qRT-PCR. Cell counting kit-8 (CCK-8) assay Cell viability in different groups was measured using CCK-8 assays (Dojindo, Japan). Briefly, 5 × 103 cells were seeded into 96-well plates, and then incubated with 10 μL of CCK-8 regent at indicated time point. After incubation, the absorbance value of each well was recorded at 450 nm using a microplate reader (Thermo, USA). Colony formation assay The transfected melanoma cells in different groups were seeded into the 6-well plates at a density of 5 × 102 cells per well. After 2 weeks incubation, these plates were fixed by 10% formaldehyde and stained with 0.5% crystal violet solution. The colonies were defined as > 50 cells/colony and photographed using an inverted microscope (Olympus IX71, Japan). 5-ethynyl-20-deoxyuridine (EdU) analysis Cell proliferation ability was detected using the EdU assay kit (Ribobio, Guangzhou, China). Briefly, melanoma cells were seeded into 96-well plates at a density of 1 × 104 cells/well, and then treated with culture medium containing 50 μM EdU reagent at 37°C for 2 h, fixed with 4% formaldehyde for 30 min. The nuclei were stained with Hoechst 33342. Finally, the results were photographed by a fluorescence microscope (Nikon, Tokyo, Japan), and the number of EdU-positive cells were quantified and analyzed. Transwell cell migration and invasion assay The migration and invasion abilities of melanoma cells were assayed using Transwell inserts and Matrigel-coated Transwell (Corning, MA, USA). Briefly, 2 × 104 melanoma cells were suspended in 200 μL of medium free of serum, and added into the top chamber. 500 mL culture medium containing 10% FBS was added into the lower chamber. 24 h after incubation, a cotton swab was used to remove cells on the upper surface of the membrane gently and the cells were fixed in 4% paraformaldehyde, then 0.5% crystal violet was used to stain these cells for 20 min. The migrating or invading cells were photographed and counted under a microscope. Wound healing assay For the migration assay, the transfected melanoma cells were seeded in 6-well plates at a high density and grew until ~80% confluence. The cell monolayer was scratched with a 200 μL sterile plastic tip, and then the cells were cultured in reduced serum culture medium at 37°C for 48 h. The movement of cells was photographed with a phase-contrast microscope. Western blotting The total protein from cells was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, Shanghai, China) on ice for 30 min. The protein concentration was quantified by using a bicinchoninic acid (BCA) kit (Beyotime). Equal amounts of protein (20ug/well) were separated by SDS-PAGE gel and transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). After blocked in 5% non-fat milk for 1 h at room temperature, the membrane was then incubated with specific primary antibodies, including anti-NPTX1 (Proteintech, 20656-1-AP, 1:1000), anti-E-cadherin (Proteintech, 20874-1-AP, 1:1000), anti-N-cadherin (Abcam, ab76011, 1:1000), anti-TSG101 (Abcam, ab125011, 1:1000), anti-HSP70 (Abcam, ab2787, 1:1000), and anti-GAPDH (Proteintech, 60004-1-Ig, 1:5000) antibodies, followed by incubation with secondary horseradish peroxidase (HRP)-conjugated antibodies. After washes, signals were detected using ECL chemiluminescence reagent (Millipore, USA) and a chemiluminescence system (Bio-Rad, USA) and analyzed using Image Lab Software. Flow cytometry analysis The melanoma cells in different groups were collected using trypsin (Thermo Fisher Scientific) and fixed for 8 h, Then, the cells were incubated with RNase (50 μg/ml) and propidium iodide (PI; 50 μg/ml) for 30 min. Finally, the cell cycle was determined by fow cytometry (BD Accuri C6) and analyzed using FlowJo software (TreeStar, OR, USA). RNA sequencing assay Total RNA was extracted using TRIzol reagent (Invitrogen, MA, USA). Ribosomal RNA was removed from samples. The RNA-seq library was deep sequenced to identify the differentially expressed circRNAs at Novogene Bioinformatics Technology Co., Ltd. Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP biotin nick end labeling (TUNEL) staining Cell apoptosis was measured by using TUNEL assay kit (Beyotime, Nanjing, China). Briefly, the melanoma cells in 24-well plates were washed with PBS and fixed by 4% paraformaldehyde for 30 min at room temperature. Subsequently, the cells were incubated with TUNEL reaction mixture at 37°C for 60 min in a dark, and the nuclear were stained with DAPI. Finally, TUNEL-positive cells were imaged under a light microscope (Olympus, Tokyo, Japan). Dual-luciferase reporter gene assay The melanoma cells were seeded into 96-well plates and cultured to 50%–70% confluence before transfection. The wild-type (WT) or mutant type (MUT) circRPS5 and NPTX1 were inserted into pGL3-firefly luciferase vector, and then transfected into melanoma cells combination with miR-151a mimics or NC using Lipofectamine 3000 (Invitrogen, USA). After 48 h of transfection, the relative luciferase activity was conducted using Dual Luciferase Reporter Assay System (Promega, WI, USA). Exosome isolation and identification Exosomes from cells were collected from culture media, and isolated by differential centrifugation and ultracentrifugation. Briefly, the media were first centrifuged at 800×g for 15 min at 4°C, and then centrifuged at 10,000×g for 30 min at 4°C to remove the redundant cells and the cellular debris. Finally, the exosomes were separated and pelleted by centrifugation at 100,000×g for 2 h at 4°C. The exosome was resuspended in 100 μl of sterile 1× PBS. The nanoparticle tracking analysis (NTA) was used to detect the size and total amount of exosomes. The western blot assay was used to identify protein markers of exosome. Statistical analysis All data are presented as the mean ± standard deviation (SD), and statistical analyses were conducted using GraphPad Prism 7.0 (GraphPad, USA) software. Non-paired t test was used to estimate the statistical differences between two groups. One-way analysis of variance (ANOVA) was used to determine the differences between three or more groups. All experiments were repeated at least three times, and P < 0.05 was statistically significant. Results CircRPS5 was aberrantly downregulated in melanoma tissues and cells First, we applied next sequencing technology to identify 1342 differentially expressed circRNAs (DECs) between melanoma and para-tumor tissues (Fig 1A). Next, we verified the expression level of top 10 DECs in melanoma cells. The results showed that only 4 circRNAs (hsa_circ_0052351, hsa_circ_0036090, hsa_circ_0054602, and hsa_circ_0020708) showed four clearly visible strips, which suggested the possible existence of these four circRNAs in melanoma cells (Fig 1B). Schematic diagram illustrated the formation of hsa_circ_0036090 originated from RPLP1 pre-mRNA (exon 2, 3), and the formation of hsa_circ_0052351 originated from RPS5 pre-mRNA (exon 5, 6). Moreover, their head-to-tail splicing structure was confirmed by Sanger sequencing (Fig 1C). The circular properties of hsa_circ_0052351 (named circRPS5) and hsa_circ_0036090 (named circRPLP1) were identified with divergent primers and convergent primers, respectively (Fig 1D). qRT-PCR revealed that only circRPS5 expression was significantly downregulated in the two BC melanoma cell lines (Fig 1E). In A375 and A2058 cells, the linear form of RPS5 was significantly reduced under RNase R treatment compared with mock, while circRPS5 was significantly resistant to RNase R (Fig 1F and 1G). Taken together, these findings indicated that circRPS5 was downregulated in melanoma tissue and cells, and was a stable and circular transcript. 10.1371/journal.pone.0287347.g001 Fig 1 Screening circRNA candidates in melanoma and characteristics of circRPS5. (A) Volcano plot showed the differentially expressed circRNAs (DECs) in melanoma tissues using bioinformatics analysis based on circRNA-seq data. (B) Results of DNA electrophoresis with the PCR products of the top 10 DECs in melanoma cell lines in A375 cells. (C) Schematic diagram illustrated the formation of hsa_circ_0036090 and hsa_circ_0052351 originated from RPLP1 and RPS5 pre-mRNA, respectively. Sanger sequencing illustrated the joint site of circRPLP1 and circRPS5. (D) RT-PCR products using divergent primers indicating circularization of hsa_circ_0036090 and hsa_circ_0052351. cDNA represents complementary DNA. gDNA represents genomic DNA. (E) qRT-PCR revealed the expression of circRPLP1 and circRPS5 in the melanoma cell lines. (F & G) qRT-PCR showed the expression of circRPS5 and RPS5 mRNA in A375 cells and A2058 cells administered with RNase R or Mock control. CircRPS5 functions as a tumor suppressive molecule in melanoma In order to investigate the biological functions of circRPS5 in melanoma, we first constructed the circRPS5 overexpression system in A375 cell line by using Lv-circRNA and the circRPS5 knockdown system by using sh-circRNA in A2058 cell line. The efficiency of transfection was confirmed by qRT-PCR (Fig 2A). The CCK-8 assay showed that circRPS5 overexpression inhibited the viability of melanoma cells, however, circRPS5 knockdown significantly enhanced cell viability (Fig 2B). Consistently, the colony formation assay showed that circRPS5 overexpression significantly decreased colony forming numbers, and circRPS5 knockdown promoted it (Fig 2C). Moreover, the EdU incorporation assay also demonstrated that overexpression of circRPS5 could attenuate proliferation of melanoma cells, and circRPS5 knockdown showed the opposite result (Fig 2D). The transwell invasion and migration assay demonstrated that circRPS5 overexpression significantly reduced migration ability and invasion capacity of melanoma cells, while circRPS5 knockdown enhanced it (Fig 2E). In addition, the results of wound healing assay confirmed the effect of circRPS5 on the migration ability of melanoma cells (Fig 2F). In addition, the bio-makers of cell invasion (E-cadherin and N-cadherin) were regulated by circRPS5. As shown in Fig 3C, circRPS5 overexpression significantly increased E-cadherin expression and inhibited N-cadherin expression in melanoma cells. However, N-cadherin expression was promoted and E-cadherin expression was attenuated after circRPS5 knockdown. Therefore, these findings suggest that circRPS5 could suppress migration and invasion of melanoma cells. 10.1371/journal.pone.0287347.g002 Fig 2 CircRPS5 was a candidate melanoma suppressor in vitro. (A) Stable oligonucleotides transfections were constructed, including circRPS5 overexpression (lv-circRPS5) in A375 cells and circRPS5 knockdown (sh-circRPS5) in A2058 cells. (B-D) The melanoma cell proliferation with the transfection of lv-circRPS5 and sh-circRPS5 was determined by CCK-8 (B), colony formation (C), and EdU incorporation assay (D). (E, F) The melanoma cell invasion and migration with the transfection of overexpression and circRPS5 knockdown was determined by transwell assay (E) and wound healing assay (F). 10.1371/journal.pone.0287347.g003 Fig 3 CircRPS5 overexpression blocks cell cycle and induces cell apoptosis in melanoma. (A) Cell cycle was measured by flow cytometry analyses with circRPS5 overexpression or circRPS5 knockdown in A375 and A2058 cells. (B) The TUNEL staining assay indicated the apoptotic rate of A375 and A2058 cells. (C) The expression of E-cadherin, N-cadherin, caspase3 and caspase9 was tested by western blot. Subsequently, the effects of circRPS5 overexpression or knockdown on melanoma cell cycle and apoptosis were detected by flow cytometry and TUNEL staining, respectively. The results showed that circRPS5 overexpression reduced the proportion of S-phase cells in melanoma cells. Comparatively, circRPS5 knockdown produced the reverse effect (Fig 3A). In TUNEL staining, the percentage of TUNEL positive cells was increased by overexpression of circRPS5, while it was reduced by knockdown of circRPS5 (Fig 3B), which was consistent with the effect of circRPS5 on caspase3/9 expression (Fig 3C). Overall, these results demonstrated that circRPS5 halted cell cycle in G1/S transition, and promoted apoptosis of melanoma cells. CircRPS5 directly targets miR-151a in melanoma cells To further understand the underlying molecular mechanism of circRPS5, we examined the subcellular localization of circRPS5 by cellular RNA fractionation and FISH assays. We found that circRPS5 was primarily distributed in the cytoplasm of melanoma cells (Fig 4A and 4B). We then used RIP assay to verify the possibility of circRPS5 binding to miRNA in melanoma cells. As shown in Fig 4C, the enrichment of circRPS5 in Ago2 group was significantly higher than that in IgG group. In order to predict the possible miRNA target of circRPS5, we overlapped the potential target miRNAs based on StarBase database with OS-related miRNAs. As a result, two potential miRNAs, hsa-miR-151a and hsa-miR-324, were identified (Fig 4D). Next, we examined the expression levels of these two miRNAs after circRPS5 overexpression and knockdown in melanoma cells. The qRT-PCR results showed the circRPS5 overexpression reduced the expression of miR-151a, and circRPS5 knockdown increased the expression of miR-151a (Fig 4E). While, there was no change in expression of miR-324 (Fig 4F). Thus, these data suggested that miR-151a might be the target of circRPS5, and the potential binding site between circRPS5 and miR-151a was shown in Fig 4G. In addition, the colocalization of circRPS5 and miR-151a in the cytoplasm of melanoma cells (Fig 4H). Of note, in dual-luciferase reporter assay, the relative luciferase activity of circRPS5 wild type (WT) and miR-151a mimic group was significantly lower than that of other groups (Fig 4I and 4J). The higher level of miR-151a expression had a lower survival rate in melanoma patients (Fig 4K). We subsequently investigated whether circRPS5 plays a tumor suppressor role in melanoma by sponging miR-151a, A375 and A2058 cells were co-transfected with circRPS5 overexpression vectors and miR-151a mimics (Fig 4L). Importantly, miR-151a upregulation blocked the inhibition of cell proliferation, migration and invasion ability caused by circRPS5 overexpression in melanoma cells (Fig 4M–4P). Together, these results suggested that circRPS5 can function as a sponge for miR-151a in melanoma. 10.1371/journal.pone.0287347.g004 Fig 4 CircRPS5 acts as the sponge of miR-151a. (A) The subcellular location analysis indicated the distribution of circRPS5. (B) The localization of circRPS5 in melanoma cells was detected by RNA FISH. (C) RIP assay was used to test the combination of circRPS5 and miRNAs. (D) Overlap region showed the predicted miRNAs from Starbase and OS-related. (E) qRT-PCR analysis of miR-151a expression levels with circRPS5 overexpression and circRPS5 knockdown in A375 and A2058 cells. (F) qRT-PCR analysis of miR-324 expression levels with circRPS5 overexpression and circRPS5 knockdown in A375 and A2058 cells. (G) The potential binding site of circRPS5 and miR-151a. (H) RNA FISH assay was used to detect the localization of circRPS5 and miR-151a in melanoma cells. (I, J) Dual-luciferase reporter assay was performed to confirm the binding site of circRPS5 and miR-151a in melanoma cells. (K) Melanoma patients with high miR-151a expression had lower overall survival rates than patients with low miR-151a expression did. (L) qRT-PCR analysis of miR-151a expression in A375 and A2058 cell lines with circRPS5 overexpression or circRPS5 overexpression+ miR-151a mimics. (M-P) A375 and A2058 cells transfected with lv-circRPS5+miR-control, or lv-circRPS5 + miR-151a. Then the ability of cell proliferation, invasion and migration was, respectively, assessed by CCK-8 assay (M, N), transwell matrigel invasion and migration assay (O, P). NPTX1 is a direct target of miR-151a To better understand the underlying mechanisms of miR-151a, the bioinformatics databases (StarBase, GSE31909, and GSE35388) were used to predict potential target genes of miR-151a. As demonstrated in the Venn diagram, a total number of 8 genes were identified as the underlying target of miR-151a (Fig 5A). Among them, 6 genes (NPTX1, AUTS2, RPS6KA2, KAT2B, MYO5A and HMG20B) were simultaneously downregulated in the melanoma samples compared with the noncancerous samples in GSE31909 and GSE35388 microarray data (Fig 5B and 5C). Then, the expression levels of these genes in melanoma cells were analysis by qRT-PCR assay. Compared with the HeMa-Lp cells, only NPTX1 expression was down-regulated in the both melanoma cells (Fig 5D). Moreover, the expression of NPTX1 was detected after circRPS5 overexpression and knockdown in melanoma cells, respectively. The results revealed that the circRPS5 overexpression enhance the NPTX1 mRNA and protein level, and circRPS5 knockdown could reduce the NPTX1 mRNA and protein level (Fig 5E and 5F). Besides, the NPTX1 mRNA has potential binding sites for miR-151a (Fig 5G). Dual-luciferase reporter assay showed that the relative luciferase activity of NPTX1 mRNA WT and miR-151a mimic groups was significantly lower than that of other groups (Fig 5H). qRT-PCR and western blotting results indicated that miR-151a mimics significantly decreased NPTX1 expression, whereas miR-151a inhibitors markedly enhanced NPTX1 expression in melanoma cells (Fig 5I and 5J). Rescue experiments revealed that miR-151a inhibitor partially reversed the inhibitory effect of circRPS5 knockdown on NPTX1 and E-cadherin expression, and reversed the promotion effect of circRPS5 knockdown on N-cadherin expression (Fig 5K). Taken together, these results suggested that NPTX1 was a target of miR-151a, and the expression of NPTX1 was also regulated by circRPS5. 10.1371/journal.pone.0287347.g005 Fig 5 NPTX1 is a direct target of miR-151a in melanoma. (A) Overlapping analysis of differentially expressed genes (DEGs) in melanoma tissues using bioinformatics analysis based on StartBase, GSE31909 and GSE35388 microarray database. (B, C) Volcano plot of the selected 8 DEGs in the GSE31909 and GSE35388 dataset. (D) qRT-PCR analysis for 6 screened mRNAs in A375 and A2058 and HeMa-Lp cells. (E) qRT-PCR analysis showed the NPTX1 mRNA level with the transfection of circRPS5 overexpression and circRPS5 knockdown in A375 and A2058 cells. (F) Western blot analysis showed the NPTX1 expression level with the transfection of circRPS5 overexpression and circRPS5 knockdown in A375 and A2058 cells. (G) Schematic diagram indicated the targeting of miR-151a towards 3’-UTR of NPTX1 mRNA. (H) Dual-luciferase reporter assay was performed to confirm the binding site of miR-151a and NPTX1 mRNA in melanoma cells. (I) qRT-PCR analysis showed the NPTX1 mRNA level with the transfection of miR-151a mimics and miR-151a inhibitors in A375 and A2058 cells. (J) Western blot analysis showed the NPTX1 expression level with the transfection of miR-151a mimics and miR-151a inhibitors in A375 and A2058 cells. (K) Western blot analysis showed the NPTX1, E-cadherin and N-cadherin protein with transfection of sh-circRPS5 and miR-151a inhibitors. CircRPS5 inhibits cell proliferation and migration of melanoma via upregulation of NPTX1 To further confirm whether circRPS5 plays an inhibitory role in OS by up-regulating NPTX1 expression, we transfected NC, pc-NPTX1, sh- NPTX1, pc-NPTX1 + sh-circRPS5, and sh-NPTX1 + lv-circRPS5 into melanoma cells. Importantly, the expression of NPTX1 is negatively regulated by circRPS5 in melanoma cells (Fig 6A and 6B). CCK-8 and colony formation assays in melanoma cells showed that overexpression of NPTX1 led to inhibition of the proliferation capabilities, but this effect could be partly attenuated by circRPS5 knockdown. In contrast, knockdown of NPTX1 promoted cell proliferation capacity, and this effect was reversed by circRPS5 overexpression (Fig 6C and 6D). Similarly, EdU positive cells were decreased by overexpression of NPTX1, while once circRPS5 was knocked down, above impacts could be hindered. Conversely, the increased EdU positive cells after NPTX1 knockdown in melanoma cells were largely reversed by circRPS5 overexpression (Fig 6E). Furthermore, transwell assay revealed that NPTX1 overexpression obviously impeded melanoma cells invasion and migration, and this effect could be partly attenuated by circRPS5 knockdown. The invasion and migration of melanoma cells were also promoted by NPTX1 knockdown; however, circRPS5 overexpression hindered these influences (Fig 6F). Additionally, NPTX1 was found to induce cell apoptosis in melanoma cells, which was restored after circRPS5 knockdown. Whereas, knockdown of NPTX1 inhibited cell apoptosis in melanoma cells, these effects were largely abolished by circRPS5 overexpression (Fig 6G). Altogether, these data suggested that circRPS5 suppressed the progression of melanoma cells by upregulating the expression of NPTX1. 10.1371/journal.pone.0287347.g006 Fig 6 CircRPS5 inhibits cell proliferation and migration of melanoma via upregulation of NPTX1. (A, B) The melanoma cells were co-transfected with pc-NPTX1 + sh-circRPS5 or sh-NPTX1 + lv-circRPS5, the expression of NPTX1 was determined using qRT-PCR (A) and western blotting (B). (C-E) Cell proliferation abilities were determined by CCK-8 assay (C), colony formation assay (D), and EdU incorporation assay (E). (F) Cell migration and invasion abilities were checked by transwell assay. (G) The TUNEL staining assay indicated the apoptotic rate of melanoma cells. CircRPS5 reverses melanoma cell progression via incorporating into exosomes It has been widely demonstrated that exosomes, as carriers of genetic information including circRNAs, which play a crucial role in the process of cancer development [22, 23]. Next, we explored whether extracellular circRPS5 regulated melanoma progression by incorporating into exosomes. The expression level of circRPS5 in the medium collected from the melanoma cells did not change in response to RNase A treatment, but it was significantly decreased in response to both RNase A and Triton-100 treatment, indicating that circRPS5 was encapsulated by the membrane rather than released directly (Fig 7A). Moreover, we further examined the size of these exosomes by the nanoparticle tracking analysis (NTA). The results show that the size of these exosomes comes from a similar distribution, mostly between 30 nm and 200 nm (Fig 7B). Also, the exosomal markers TSG101and HPS70 were positively expressed in A375-EXO and A2058-EXO, but not in the cell extracts (Fig 7C). In addition, the expression level of circRPS5 in exosomes was almost equal to that of extracellular circRPS5, indicating that extracellular circRPS5 was mainly incorporated into exosomes (Fig 7D). The circRPS5 levels in HeMa-Lp exosomes were significantly higher than those of A375 and A2058 exosomes (Fig 7E). We next examined whether melanoma cells could take up exosomes. As shown in Fig 7F, the results showed that HeMa-Lp-derived exosomes (PKH26-labeled) were all localized in the cytoplasm of melanoma cells, and the labeled exosomes gathered around the nucleus in the form of dots or clots, indicating that the exosomes secreted by HeMa-Lp had been successfully absorbed by melanoma recipient cells. Subsequently, the expression of circRPS5 in HeMa-Lp cell-derived exosomes was significantly decreased after circRPS5 knockdown (Fig 7G). After co-culturing with the EXO-circRPS5, the cell viability and/or invasion of melanoma cells were significantly decreased in a dose-dependent maner (Fig 7H–7J). Finally, we explored whether exosomal circRPS5 played a deterministic role, and then used GW4869 to block the production of exosomes in HeMa-Lp cells (Fig 7K and 7L). However, when HeMa-Lp cells were treated with GW4869, the HeMa-Lp-derived exosomes could hardly play the role of promoting proliferation and invasion (Fig 7M and 7N). Collectively, these results suggested that the extracellular circRPS5 inhibited melanoma cell progression through exosomes (Fig 8). 10.1371/journal.pone.0287347.g007 Fig 7 CircRPS5 reverses melanoma cell progression via incorporating into exosomes. (A) qRT-PCR showed the expression of circRPS5 in melanoma cells administered with PBS control, RNase A alone, or RNase A + Triton X-100. (B) Exosomes were isolated from the supernatant of the culture medium of A375 and A2058 cells, and the size range of exosomes checked by NAT analysis. (C) Melanoma cell-derived exosomes (A375-EXO and A2058-EXO) were analyzed by western blotting using anti-TSG101 and anti-HSP70 antibodies. Cellular lysates (A375 and A2058) were used as positive loading controls. (D) qRT-PCR showed the expression of circRPS5 in the supernatant of the culture medium of melanoma cells and melanoma cell-derived exosomes. (E) qRT-PCR showed the expression of circRPS5 in melanoma cell-derived exosomes (A375-EXO and A2058-EXO) and HeMa-Lp cell-derived exosomes (HeMa-Lp-EXO). (F) Confocal microscopy image of the internalization of fluorescently labelled exosomes in A375 and A2058 cells. (G) The HeMa-Lp cells were transfected with sh-Scb or sh-circRPS5, and the expression of circRPS5 in HeMa-Lp cell-derived exosomes and PBS were determined using qRT-PCR. (H) Cell proliferation was determined by CCK8 assay. A375 and A2058 cells were treated with or without exosomes containing circRPS5 (EXO-circRPS5). (I) Cell invasion abilities were checked by transwell assay. (J) Cell viability was checked by CCK8 assay with different dose of EXO-circRPS5. (K) NAT analysis showed the concentration of exosomes derived from HeMa-Lp cells after treating with DMSO control or GW-4869. (L) The density of exosomes derived from HeMa-Lp cells administered with DMSO control or GW-4869. (M) Cell proliferation was determined by CCK8 assay. The A375 and A2058 cells were treated with exosomes derived from HeMa-Lp cells pretreated with DMSO control or GW-4869. (N) Cell invasion abilities were determined by transwell assay. 10.1371/journal.pone.0287347.g008 Fig 8 The mechanisms underlying circRPS5–inhibited cancer progression. Discussion Mounting evidences indicate that circRNAs have a crucial role in the occurrence and progression of multiple cancers [24]. However, their function roles in melanoma remains largely unclear. In present study, we identified a novel circRNAs named circRPS5 that was significantly downregulated in melanoma tissue and cell lines. Functionally, overexpression of circRPS5 had a strong inhibitory effect on the proliferation, migration and invasion of melanoma cells, and knockdown of circRPS5 had a significant promotion effect. Mechanistically, circRPS5 could rescue the expression of NPTX1 by sponging miR-151a, thereby inhibiting melanoma progression. Moreover, circRPS5 was mainly packaged into exosomes and exerted the biological functions role in melanoma. Thus, our study demonstrated that circRPS5 may serve as a promising treatment target for patients with melanoma. An increasing evidence has underscored that the role of circRNAs acting as competing endogenous RNAs (ceRNAs) in the development and progression of human cancers [25]. CircRNAs play as ceRNAs to regulate the protein-coding gene expression by competitive binding with miRNAs [26]. For instance, circCCDC9 was recently found to function as a ceRNA to inhibit tumor growth and metastasis in gastric cancer [27]. CircESRP1 served as an oncogenic circRNA promotes the proliferation and metastasis of endometrial cancer cells through the miR-874-3p/CPEB4 axis [28]. In this study, gain- and loss-of-function studies showed that circRPS5 regulates melanoma cells proliferation, migration and invasion in vitro. Moreover, we demonstrated that circRPS5 was predominantly localized in the cytoplasm and able to bind to miR-151a. We also found that the expression levels of miR-151a were negatively correlated with the level of circRPS5. Importantly, miR-151a could reverse the effect of circRPS5 on melanoma cells progression. Therefore, our results indicated that circRPS5 exerts its tumor suppressor effect by sponging miR-151a. Previous studies have reported that miR-151a is significantly upregulated in several types of cancers and plays a role in tumor carcinogenesis [29, 30]. For instances, miR-151a is significantly increased in non-small cell lung cancer (NSCLC) tissues and blocking miR-151a expression significantly reduced the proliferation and migration ability of NCSLC cells [29]. Guo et al. found that miR-151a-5p is highly expressed in lung cancer tissues, and miR-151a-5p inhibitor could restrain the proliferative and motility potential of lung cancer cells [30]. The results of this study showed that the expression level of miR-151a in melanoma tissues was significantly increased, and the high level of miR-151a had a poor prognosis. Moreover, miR-151a mimics could reverse the inhibitory effect of circRPS5 overexpression on the proliferation, migration and invasion of melanoma cells. Therefore, miR-151a plays a promoting role in melanoma progression. Additionally, we revealed that NPTX1 was the target of miR-151a. NPTX1 gene encodes the neuronal pentraxin 1, a member of the pentraxins family [31]. Recently, NPTX1 has been found to have decreased expression in diverse cancers [32, 33], but its expression and impact in melanoma has not been defined yet. In this study, we discovered that circRPS5 knockdown could reduce NPTX1 expression. In addition, NPTX1 knockdown significantly reversed the circRPS5 overexpression induced promotion of proliferation, invasion and migration of melanoma cells. Taken together, these data support that circRPS5 as a ceRNA to promote NPTX1-mediated proliferation and metastasis in melanoma by sponging miR-151a. Exosome derived from cancer cells can modulate crosstalk with surrounding cells to remodel the tumor microenvironment, thereby enhancing cancer development and propagation [34]. Accumulating studies have reported that exosome-encapsulated circRNAs play crucial regulatory roles in the development and progression of cancers [10, 35]. For example, colorectal cancer (CRC)-derived exosomal circPACRGL promote CRC cell proliferation, migration and invasion via miR-142-3p/miR-506-3p-TGF-β1 axis [22]. In our study, we found that circRPS5 was enriched in HeMa-Lp-derived exosomes. The biological functions of circRPS5 in melanoma are mainly incorporated into exosomes. In conclusion, the present study demonstrated that circRPS5 is significantly downregulated in melanoma tissues and cells. Overexpression of CircRPS5 can inhibit the proliferation, migration and invasion of melanoma cells via the miR-151a/NPTX1 pathway. Finally, circRPS5 could be packaged into exosomes, thereby promoting the occurrence and malignant progression of melanoma. Our findings suggest that circRPS5 could be a promising therapeutic target to prevent melanoma development and metastasis. Supporting information S1 Raw images (PDF) Click here for additional data file. 10.1371/journal.pone.0287347.r001 Decision Letter 0 Decock Julie Academic Editor © 2023 Julie Decock 2023 Julie Decock https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version0 11 Apr 2023 PONE-D-23-02043Exosome-Delivered circRPS5 Inhibits the Progression of melanoma via Regulating the miR-151a/NPTX1 AxisPLOS ONE Dear Dr. Zhu, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by May 26 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Julie Decock, PhD Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at  https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and  https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.     In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.  4. Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Yes ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: Yes Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: Yes Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: In this paper entitled “Exosome-delivered circRPS5 inhibits the progression of melanoma via regulating the miR-151a/NPTX1 axis” the authors have investigated the role of a novel exosome-delivered circular RNA named circRPS5 that plays a regulatory role in melanoma progression as well as proliferation, migration and invasion through the miR151a/NPTX1 pathway. The study is well performed and the results are very interesting to be potentially useful for clinical application suggesting that circRPS5 could be a novel therapeutic target for melanoma therapy. However the authors should respond to minor points. Particularly: 1) the authors through qRT-PCR demonstrate that circRPS5 is downregulated in two melanoma cell lines, A375 and A2058. In order to investigate the biological functions of circRPS5 in melanoma, the authors apply the circRPS5 overexpressing system in A375 cell lines and the circRPS5 knockdown system in A2058 cell line. Why the authors decide to proceed differently in the two cell lines of melanoma although in Fig.1E they show that the level of downregulation of the circRPS5 is equal in the two cell lines? 2) In the section Materials and Methods, in particular in the paragraph referring to the western blotting method, the authors write: "Equal amounts of protein were separated by SDS-PAGE gel...". Authors should specify the amount of protein loaded. In conclusion the manuscript could be accepted for publication on PLOS ONE after minor revision. Reviewer #2: The study demonstrates that circRPS5 acts as a sponge for miR-151a, which is involved in regulating the expression of the NPTX1 gene, and that circRPS5-miR-151a-NPTX1 pathway plays a crucial role in melanoma progression. The study also illustrates that circRPS5 is mainly incorporated into exosomes, which are small membrane-bound vesicles that can be secreted by cells and play a crucial role in cell-to-cell communication, and can inhibit melanoma cell progression. Overall, the study provides new insights into the role of circRNAs in melanoma progression and identifies a potential therapeutic target for the treatment of melanoma. The findings in this study are of potential interest, but there are several issues that need to be addressed: 1. To increase the accuracy of this research, it would be beneficial for the authors to incorporate clinical samples. 2. CircRPS5 has been reported to have both tumor-suppressive and oncogenic roles in different types of cancer. Please explain the different expression of circRPS5 in tumors. 3. Is the antitumor effect of EXO-circRPS5 dose-dependent? It is suggested that the author supplement experimental proof. 4. Have the authors examined the expression of total Caspase-3/9, as they assert that circRPS5 can enhance apoptosis of melanoma cells? 5. In this study, the authors are required to ascertain whether miR-151a-3p or miR-151a-5p should be considered a direct target of circRPS5. This is because a previous study detected a downregulation in the expression level of miR-151a-3p in plasma samples of metastatic melanoma patients, indicating its role as a tumor suppressor (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5345922/#). 6. Please add a molecular pathway diagram as a graphical abstract describing circRPS5-miR-151a-NPTX1 pathway as a key regulator of melanoma. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: No ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Attachment Submitted filename: Minor Revision.docx Click here for additional data file. 10.1371/journal.pone.0287347.r002 Author response to Decision Letter 0 Submission Version1 15 May 2023 Reviewer #1: In this paper entitled “Exosome-delivered circRPS5 inhibits the progression of melanoma via regulating the miR-151a/NPTX1 axis” the authors have investigated the role of a novel exosome-delivered circular RNA named circRPS5 that plays a regulatory role in melanoma progression as well as proliferation, migration and invasion through the miR151a/NPTX1 pathway. The study is well performed and the results are very interesting to be potentially useful for clinical application suggesting that circRPS5 could be a novel therapeutic target for melanoma therapy. However the authors should respond to minor points. Particularly: 1) the authors through qRT-PCR demonstrate that circRPS5 is downregulated in two melanoma cell lines, A375 and A2058. In order to investigate the biological functions of circRPS5 in melanoma, the authors apply the circRPS5 overexpressing system in A375 cell lines and the circRPS5 knockdown system in A2058 cell line. Why the authors decide to proceed differently in the two cell lines of melanoma although in Fig.1E they show that the level of downregulation of the circRPS5 is equal in the two cell lines? Response: Thank you for raising this concern. We only want to observe the biological effects of circRPS5 from the two dimensions of overexpression and knockdown, so that the results can be more reliable. One cell line in those two cell lines must overexpress circRPS5, and another cell line knockdown circRPS5, so we select the cells with high expression for knockdown, and the cells with low expression for overexpression. Although there was no significant difference in the expression of circRPS5 between the two cells, the expression of circRPS5 was indeed higher in A2058 cells than in A375, and such experimental design was reasonable. 2) In the section Materials and Methods, in particular in the paragraph referring to the western blotting method, the authors write: "Equal amounts of protein were separated by SDS-PAGE gel...". Authors should specify the amount of protein loaded. Response: Thanks for your thoughtful question. Based on your suggestion, we have specified the amount of protein loaded and updated the revised manuscript. In conclusion the manuscript could be accepted for publication on PLOS ONE after minor revision. Reviewer #2: The study demonstrates that circRPS5 acts as a sponge for miR-151a, which is involved in regulating the expression of the NPTX1 gene, and that circRPS5-miR-151a-NPTX1 pathway plays a crucial role in melanoma progression. The study also illustrates that circRPS5 is mainly incorporated into exosomes, which are small membrane-bound vesicles that can be secreted by cells and play a crucial role in cell-to-cell communication, and can inhibit melanoma cell progression. Overall, the study provides new insights into the role of circRNAs in melanoma progression and identifies a potential therapeutic target for the treatment of melanoma. The findings in this study are of potential interest, but there are several issues that need to be addressed: 1. To increase the accuracy of this research, it would be beneficial for the authors to incorporate clinical samples. Response: Thanks for your thoughtful question. We have updated the verb form of research in this paper. We previously planned to collect clinical specimens to verify our molecular expression level, but the number of osteosarcoma patients is not large, and it will take a long time to collect enough samples. We will continue to collect samples in the following work to verify the expression level and prognosis of the main molecules in this paper. 2. CircRPS5 has been reported to have both tumor-suppressive and oncogenic roles in different types of cancer. Please explain the different expression of circRPS5 in tumors. Response: Thank you for raising this concern. There are few reports about CircRPS5. One study report that CircRPS5 is related to the polarization of M2 macrophages in brain injury process (PMID: 34896256). It is a well-known fact that different tumor cells activate different genes and activate them differently at different stages of tumorigenesis. A comprehensive and extensive explanation can be found in this article entitled “Tumor Suppressors Having Oncogenic Functions: The Double Agents” (PMID: 33396222). 3. Is the antitumor effect of EXO-circRPS5 dose-dependent? It is suggested that the author supplement experimental proof. Response: Thanks for your thoughtful question. In response to your questions, we added experiments to explore and found that the anti-tumor effect of EXO-circRPS5 is indeed dose-dependent, the experiment results have been added in the revised manuscript and figure 7J. 4. Have the authors examined the expression of total Caspase-3/9, as they assert that circRPS5 can enhance apoptosis of melanoma cells? Response: Thanks for your thoughtful question. We added experiments to observe the effect of circRPS5 on apoptosis and found that circRPS5 can enhance apoptosis of melanoma cells, the experiment results have been added in the revised manuscript and figure 3C. 5. In this study, the authors are required to ascertain whether miR-151a-3p or miR-151a-5p should be considered a direct target of circRPS5. This is because a previous study detected a downregulation in the expression level of miR-151a-3p in plasma samples of metastatic melanoma patients, indicating its role as a tumor suppressor (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5345922/#). Response: Thanks for your kind suggestions. We have reconfirmed in the Starbase database that the targeted molecule of circRPS5 is miR-151a-5p, not miR-151a-3p, and we have replaced the miR-151a in miR-151a-5p in the revised manuscript. 6. Please add a molecular pathway diagram as a graphical abstract describing circRPS5-miR-151a-NPTX1 pathway as a key regulator of melanoma. Response: Thanks for your thoughtful question. We have added a graphical abstract in Figure 8. Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0287347.r003 Decision Letter 1 Decock Julie Academic Editor © 2023 Julie Decock 2023 Julie Decock https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 5 Jun 2023 Exosome-Delivered circRPS5 Inhibits the Progression of melanoma via Regulating the miR-151a/NPTX1 Axis PONE-D-23-02043R1 Dear Dr. Zhu, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Julie Decock, PhD Academic Editor PLOS ONE 10.1371/journal.pone.0287347.r004 Acceptance letter Decock Julie Academic Editor © 2023 Julie Decock 2023 Julie Decock https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 22 Jun 2023 PONE-D-23-02043R1 Exosome-Delivered circRPS5 Inhibits the Progression of melanoma via Regulating the miR-151a/NPTX1 Axis Dear Dr. Zhu: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Julie Decock Academic Editor PLOS ONE ==== Refs References 1 Eddy K , Chen S . Overcoming Immune Evasion in Melanoma. Int J Mol Sci. 2020; 21 . doi: 10.3390/ijms21238984 33256089 2 Garbe C , Amaral T , Peris K , Hauschild A , Arenberger P , Bastholt L , et al . European consensus-based interdisciplinary guideline for melanoma. Part 1: Diagnostics—Update 2019. Eur J Cancer. 2020; 126 : 141–58. doi: 10.1016/j.ejca.2019.11.014 31928887 3 Wei CY , Zhu MX , Lu NH , Liu JQ , Yang YW , Zhang Y , et al . Circular RNA circ_0020710 drives tumor progression and immune evasion by regulating the miR-370-3p/CXCL12 axis in melanoma. Mol Cancer. 2020; 19 : 84. doi: 10.1186/s12943-020-01191-9 32381016 4 McKenna S , Garcia-Gutierrez L . Resistance to Targeted Therapy and RASSF1A Loss in Melanoma: What Are We Missing? Int J Mol Sci. 2021; 22 . doi: 10.3390/ijms22105115 34066022 5 Pastwinska J , Karas K , Karwaciak I , Ratajewski M . Targeting EGFR in melanoma—The sea of possibilities to overcome drug resistance. Biochim Biophys Acta Rev Cancer. 2022; 1877 : 188754. doi: 10.1016/j.bbcan.2022.188754 35772580 6 Zhou WY , Cai ZR , Liu J , Wang DS , Ju HQ , Xu RH . Circular RNA: metabolism, functions and interactions with proteins. Mol Cancer. 2020; 19 : 172. doi: 10.1186/s12943-020-01286-3 33317550 7 Chen LL , Yang L . Regulation of circRNA biogenesis. RNA Biol. 2015; 12 : 381–8. doi: 10.1080/15476286.2015.1020271 25746834 8 Zhong Y , Du Y , Yang X , Mo Y , Fan C , Xiong F , et al . Circular RNAs function as ceRNAs to regulate and control human cancer progression. Mol Cancer. 2018; 17 : 79. doi: 10.1186/s12943-018-0827-8 29626935 9 Cheng Z , Yu C , Cui S , Wang H , Jin H , Wang C , et al . circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1. Nat Commun. 2019; 10 : 3200. doi: 10.1038/s41467-019-11162-4 31324812 10 Yu T , Wang Y , Fan Y , Fang N , Wang T , Xu T , et al . CircRNAs in cancer metabolism: a review. J Hematol Oncol. 2019; 12 : 90. doi: 10.1186/s13045-019-0776-8 31484561 11 Zhang Q , Wang W , Zhou Q , Chen C , Yuan W , Liu J , et al . Roles of circRNAs in the tumour microenvironment. Mol Cancer. 2020; 19 : 14. doi: 10.1186/s12943-019-1125-9 31973726 12 Zhou J , Wang L , Sun Q , Chen R , Zhang C , Yang P , et al . Hsa_circ_0001666 suppresses the progression of colorectal cancer through the miR-576-5p/PCDH10 axis. Clin Transl Med. 2021; 11 : e565. doi: 10.1002/ctm2.565 34841662 13 Huang G , Liang M , Liu H , Huang J , Li P , Wang C , et al . CircRNA hsa_circRNA_104348 promotes hepatocellular carcinoma progression through modulating miR-187-3p/RTKN2 axis and activating Wnt/beta-catenin pathway. Cell Death Dis. 2020; 11 : 1065.33311442 14 Pegtel DM , Gould SJ . Exosomes. Annu Rev Biochem. 2019; 88 : 487–514. doi: 10.1146/annurev-biochem-013118-111902 31220978 15 Zhu C , Li L , Wang Z , Irfan M , Qu F . Recent advances of aptasensors for exosomes detection. Biosensors and Bioelectronics. 2020; 160 . doi: 10.1016/j.bios.2020.112213 32339150 16 Tian X , Shen H , Li Z , Wang T , Wang S . Tumor-derived exosomes, myeloid-derived suppressor cells, and tumor microenvironment. J Hematol Oncol. 2019; 12 : 84. doi: 10.1186/s13045-019-0772-z 31438991 17 Dai J , Su Y , Zhong S , Cong L , Liu B , Yang J , et al . Exosomes: key players in cancer and potential therapeutic strategy. Signal Transduct Target Ther. 2020; 5 : 145. doi: 10.1038/s41392-020-00261-0 32759948 18 Wang S , Dong Y , Gong A , Kong H , Gao J , Hao X , et al . Exosomal circRNAs as novel cancer biomarkers: Challenges and opportunities. Int J Biol Sci. 2021; 17 : 562–73. doi: 10.7150/ijbs.48782 33613113 19 Zhang H , Deng T , Ge S , Liu Y , Bai M , Zhu K , et al . Exosome circRNA secreted from adipocytes promotes the growth of hepatocellular carcinoma by targeting deubiquitination-related USP7. Oncogene. 2019; 38 : 2844–59. doi: 10.1038/s41388-018-0619-z 30546088 20 Diboun I , Wernisch L , Orengo CA , Koltzenburg M . Microarray analysis after RNA amplification can detect pronounced differences in gene expression using limma. BMC Genomics. 2006; 7 : 252. doi: 10.1186/1471-2164-7-252 17029630 21 Varet H , Brillet-Gueguen L , Coppee JY , Dillies MA . SARTools: A DESeq2- and EdgeR-Based R Pipeline for Comprehensive Differential Analysis of RNA-Seq Data. PLoS One. 2016; 11 : e0157022. doi: 10.1371/journal.pone.0157022 27280887 22 Shang A , Gu C , Wang W , Wang X , Sun J , Zeng B , et al . Exosomal circPACRGL promotes progression of colorectal cancer via the miR-142-3p/miR-506-3p- TGF-beta1 axis. Mol Cancer. 2020; 19 : 117.32713345 23 Wang X , Zhang H , Yang H , Bai M , Ning T , Deng T , et al . Exosome-delivered circRNA promotes glycolysis to induce chemoresistance through the miR-122-PKM2 axis in colorectal cancer. Mol Oncol. 2020; 14 : 539–55. doi: 10.1002/1878-0261.12629 31901148 24 Lei M , Zheng G , Ning Q , Zheng J , Dong D . Translation and functional roles of circular RNAs in human cancer. Mol Cancer. 2020; 19 : 30. doi: 10.1186/s12943-020-1135-7 32059672 25 Hong X , Liu N , Liang Y , He Q , Yang X , Lei Y , et al . Circular RNA CRIM1 functions as a ceRNA to promote nasopharyngeal carcinoma metastasis and docetaxel chemoresistance through upregulating FOXQ1. Mol Cancer. 2020; 19 : 33. doi: 10.1186/s12943-020-01149-x 32061262 26 Shen J , Liang C , Su X , Wang Q , Ke Y , Fang J , et al . Dysfunction and ceRNA network of the tumor suppressor miR-637 in cancer development and prognosis. Biomark Res. 2022; 10 : 72. doi: 10.1186/s40364-022-00419-8 36175921 27 Luo Z , Rong Z , Zhang J , Zhu Z , Yu Z , Li T , et al . Circular RNA circCCDC9 acts as a miR-6792-3p sponge to suppress the progression of gastric cancer through regulating CAV1 expression. Mol Cancer. 2020; 19 : 86.32386516 28 Park MN , Um ES , Rahman MA , Kim JW , Park SS , Cho Y , et al . Leonurus japonicus Houttuyn induces reactive oxygen species-mediated apoptosis via regulation of miR-19a-3p/PTEN/PI3K/AKT in U937 and THP-1 cells. J Ethnopharmacol. 2022; 291 : 115129. doi: 10.1016/j.jep.2022.115129 35217209 29 Daugaard I , Sanders KJ , Idica A , Vittayarukskul K , Hamdorf M , Krog JD , et al . miR-151a induces partial EMT by regulating E-cadherin in NSCLC cells. Oncogenesis. 2017; 6 : e366.28759022 30 S GJ , Zhang. YY , Zhao . et al . The expressions of miR-151a-5p and miR-23b in lung cancer tissues and their effects on the biological functions of lung cancer A549 cells. Eur Rev Med Pharmacol Sci. 2020; 24 (12 ): 6779–85. doi: 10.26355/eurrev_202006_21666 32633369 31 Coutelier M , Jacoupy M , Janer A , Renaud F , Auger N , Saripella GV , et al . NPTX1 mutations trigger endoplasmic reticulum stress and cause autosomal dominant cerebellar ataxia. Brain. 2022; 145 : 1519–34. doi: 10.1093/brain/awab407 34788392 32 Wu J , Liu G , An K , Shi L . NPTX1 inhibits pancreatic cancer cell proliferation and migration and enhances chemotherapy sensitivity by targeting RBM10. Oncol Lett. 2022; 23 : 154. doi: 10.3892/ol.2022.13275 35836482 33 Yan H , Zheng C , Li Z , Bao B , Yang B , Hou K , et al . NPTX1 promotes metastasis via integrin/FAK signaling in gastric cancer. Cancer Manag Res. 2019; 11 : 3237–51. doi: 10.2147/CMAR.S196509 31043800 34 Wang T , Chen Z , Chen H , Yu X , Wang L , Liu X . Brusatol inhibits the growth of renal cell carcinoma by regulating the PTEN/PI3K/AKT pathway. J Ethnopharmacol. 2022; 288 : 115020. doi: 10.1016/j.jep.2022.115020 35066068 35 Tuo B , Chen Z , Dang Q , Chen C , Zhang H , Hu S , et al . Roles of exosomal circRNAs in tumour immunity and cancer progression. Cell Death Dis. 2022; 13 : 539. doi: 10.1038/s41419-022-04949-9 35676257