==== Front PLoS One PLoS One plos PLOS ONE 1932-6203 Public Library of Science San Francisco, CA USA 10.1371/journal.pone.0287788 PONE-D-22-35612 Research Article Biology and life sciences Cell biology Signal transduction Cell signaling Signaling cascades MAPK signaling cascades Biology and Life Sciences Biochemistry Antioxidants Biology and Life Sciences Genetics Gene Expression Biology and life sciences Genetics Gene expression Gene regulation Small interfering RNA Biology and life sciences Biochemistry Nucleic acids RNA Non-coding RNA Small interfering RNA Biology and Life Sciences Toxicology Cytotoxicity Medicine and Health Sciences Pathology and Laboratory Medicine Toxicology Cytotoxicity Medicine and Health Sciences Pharmaceutics Drug Therapy Antioxidant Therapy Biology and Life Sciences Molecular Biology Molecular Biology Techniques Transfection Research and Analysis Methods Molecular Biology Techniques Transfection Biology and Life Sciences Molecular Biology Molecular Biology Techniques Molecular Probe Techniques Immunoblotting Research and Analysis Methods Molecular Biology Techniques Molecular Probe Techniques Immunoblotting Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathway Lansoprazole protects cells via p38/Nrf2 pathway https://orcid.org/0000-0001-5338-1917 Yamagishi Naoko Conceptualization Data curation Formal analysis Funding acquisition Investigation Methodology Project administration Resources Software Supervision Validation Visualization Writing – original draft Writing – review & editing * Yamamoto Yuta Conceptualization Methodology Writing – review & editing Nishi Toshio Data curation Methodology Writing – review & editing Ito Takao Data curation Writing – review & editing Kanai Yoshimitsu Data curation Investigation Supervision Writing – review & editing Department of Anatomy and Cell Biology, Graduate School of Medicine, Wakayama Medical University, Wakayama, Japan Yap Wei Hsum Editor Taylor’s University, MALAYSIA Competing Interests: The authors have declared that no competing interests exist. * E-mail: ymg-n@wakayama-med.ac.jp 29 6 2023 2023 18 6 e02877884 1 2023 13 6 2023 © 2023 Yamagishi et al 2023 Yamagishi et al https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Lansoprazole, a proton pump inhibitor, can exert antioxidant effects through the induction of the nuclear factor erythroid 2-related factor 2 (Nrf2) pathway, independently of the inhibition of acid secretion in the gastrointestinal tract. Lansoprazole has been reported to provide hepatoprotection in a drug-induced hepatitis animal model through the Nrf2/heme oxygenase-1 (HO1) pathway. We sought to investigate the molecular mechanism of cytoprotection by lansoprazole. An in vitro experimental model was conducted using cultured rat hepatic cells treated with lansoprazole to analyze the expression levels of Nrf2 and its downstream genes, the activity of Nrf2 using luciferase reporter assays, cisplatin-induced cytotoxicity, and signaling pathways involved in Nrf2 activation. Lansoprazole treatment of rat liver epithelial RL34 cells induced transactivation of Nrf2 and the expression of the Nrf2-dependent antioxidant genes encoding HO1, NAD(P)H quinone oxidoreductase-1, and glutathione S-transferase A2. Furthermore, cycloheximide chase experiments revealed that lansoprazole prolongs the half-life of the Nrf2 protein. Notably, cell viability was significantly increased by lansoprazole treatment in a cisplatin-induced cytotoxicity model. Moreover, the siRNA knockdown of Nrf2 fully abolished the cytoprotective effect of lansoprazole, whereas the inhibition of HO1 by tin-mesoporphyrin only partially abolished this. Finally, lansoprazole promoted the phosphorylation of p38 mitogen-activated protein kinase (MAPK) but not that of the extracellular signal-regulated kinase or the c-Jun N-terminal kinase. Using SB203580, a specific inhibitor for p38 MAPK, the lansoprazole-induced Nrf2/antioxidant response elements pathway activation and cytoprotective effects were shown to be exclusively p38 MAPK dependent. Lansoprazole was shown by these results to exert a cytoprotective effect on liver epithelial cells against the cisplatin-induced cytotoxicity through the p38 MAPK signaling pathway. This could have potential applications for the prevention and treatment of oxidative injury in the liver. http://dx.doi.org/10.13039/501100000646 Japan Society for the Promotion of Science London 17K15963 https://orcid.org/0000-0001-5338-1917 Yamagishi Naoko This work was supported in part by a Japan Society for the Promotion of Science (JSPS) KAKENHI grant (grant no. 17K15963) to Naoko Yamagishi. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are within the manuscript and its Supporting information files. Data Availability All relevant data are within the manuscript and its Supporting information files. ==== Body pmcIntroduction Nuclear factor-erythroid 2-related factor 2 (Nrf2) plays a crucial role in the transcriptional regulation of antioxidant and detoxifying genes in various cell types, including hepatocytes [1, 2]. The activation of the Nrf2 pathway prevents liver injury caused by many hepatotoxicants [3, 4]. Consequently, Nrf2 has recently been implicated as a new therapeutic target for the treatment of liver diseases. Under normal conditions, Nrf2 binds to a repressor Kelch-like ECH-associated protein 1 (Keap1) in the cytoplasm as an inactive complex. Keap1 functions as a substrate adaptor protein for a Cullin3-dependent E3 ubiquitin ligase complex and induces a rapid proteasomal degradation of Nrf2 [5]. Keap1 contains several reactive cysteine residues that function as sensors for cellular oxidative stress [6–8]. Modification of these critical cysteine residues of Keap1 by reactive oxygen species (ROS) inactivates the E3 ubiquitin ligase and stabilizes Nrf2, which subsequently accumulates and translocates into the nucleus. Nuclear Nrf2 binds to antioxidant response elements (AREs) that are located in the promoter region of genes and encode various antioxidant and phase 2 detoxifying enzymes such as heme oxygenase-1 (HO1), NAD(P)H quinone oxidoreductase-1 (NQO1), and glutathione S-transferase A2 (GSTA2) [9–11]. The ARE-mediated upregulation of these enzymes facilitates the removal of toxic agents and ROS, thereby providing a protection against liver injury. Exposure of cells to Nrf2 inducers, like oxidative stress stimuli, activates Nrf2/ARE-mediated response through different intracellular signaling pathways. Mitogen-activated protein kinase (MAPK) pathways are known to regulate Nrf2/ARE-driven gene expression [12–14]. MAPKs are serine/threonine protein kinase that play a central role in the signaling cascade regulating cellular processes, such as cell proliferation, differentiation, and apoptosis. Three major MAPK subfamilies have been extensively studied: extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38 MAPK. Each kinase establishes, in principle, parallel and independent signaling pathways. Depending on the cellular and stimulatory context, there is often significant cross-talk between each of the kinases because they can respond to common upstream activators and phosphorylate common downstream targets. Alam et al. reported that cadmium-induced HO1 gene expression requires the sequential activation of the p38 MAPK pathway and Nrf2 in human breast cancer MCF-7 cells [12]. In contrast, in human hepatoblastoma HepG2 cells, JNK activated the induction of Nrf2/ARE-mediated gene expression by the overexpression of common upstream kinases, whereas p38 MAPK showed the opposite effects [13]. Additionally, exposure of HepG2 cells to the chemical pyrrolidine dithiocarbamate, the activation of both ERK1/2 and p38 MAPK are required for induction of the ARE-mediated γ-glutamylcysteine synthetase subunit genes [14]. Based on these observations, the capability of lansoprazole to upregulate expression of antioxidant genes via the MAPK/ARE/Nrf2 pathway was investigated using rat hepatic cells. Cisplatin is a chemotherapeutic agent commonly used to treat various solid tumors. Cisplatin-induced cytotoxicity has been described as a function of DNA crosslinking, followed by formation of DNA lesions. Cisplatin has been recently shown to significantly increase the generation of ROS that can cause organ toxicity, including hepatotoxicity [15–18]. Oxidative stress is the one of the most important mechanisms involved in cisplatin toxicity. Lansoprazole is a potent proton pump inhibitor that is often used to treat acid-related disorders, including gastric and duodenal ulcers, gastro-esophageal reflux disease, and nonulcer dyspepsia. It strongly reduces the secretion of gastric acid by blocking H+/K+-ATPase in gastric parietal cells. In addition, it exerts anti-inflammatory and antioxidant effects against necrotizing agent-induced gastric lesions through a mechanism that acts independently of inhibition of acid secretion [19–22]. Several studies have demonstrated a lansoprazole-induced expression of the antioxidant protein HO1 in gastric epithelial cells [23, 24], endothelial cells [25], and neutrophils [26] as well as in the small intestines of rats [27–29], thereby protecting these cells from oxidative stress. HO1 is a stress-inducible protein, and its reaction products from heme degradation have been linked to cytoprotection. Takagi et al. proposed that the induction of HO1 by lansoprazole can occur by Nrf2 activation in rat gastric mucosal cells [23]. The induction of HO1 both in the gastrointestinal mucosa and in the liver can have antioxidant and anti-inflammatory properties [30, 31]. We previously reported that lansoprazole attenuates the drug-induced oxidative liver injury in rats through the Nrf2/HO1 pathway [32]. Furthermore, lansoprazole treatment can suppress the expression of proinflammatory cytokines and the progression of hepatic fibrogenesis induced by a choline-deficient L-amino acid-defined diet [33]. However, how lansoprazole activates the Nrf2 pathway in hepatic cells remains unclear. Here, we focus on the role of the Nrf2 pathway to provide further insight into our previous findings on the molecular mechanisms of lansoprazole-mediated hepatoprotection. The present study comprises an in vitro experimental model that simulates the cisplatin-induced oxidative stress in rat hepatic cells. Materials and methods Chemicals and reagents Lansoprazole was purchased from the Tokyo Chemical Industry Co. (Tokyo, Japan). p38 MAPK inhibitor SB203580 and protein biosynthesis inhibitor cycloheximide (CHX) were purchased from the FUJIFILM Wako Pure Chemical Co. (Osaka, Japan). Cisplatin was purchased from Nichi-Iko Pharmaceutical Co. (Toyama, Japan). The specific HO1 inhibitor tin-mesoporphyrin IX (SnMP) was purchased from BIOMOL Research Inc. (Plymouth Meeting, PA, USA). Cell culturing, transfection, and treatment The untransformed rat hepatic cell line RL34 was obtained from the Japanese Collection of Research Bioresources Bank (JCRB0247). Cells were maintained in Dulbecco’s modified Eagle medium (DMEM) without phenol red (FUJIFILM Wako Pure Chemical Co., Osaka, Japan) and supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Sigma-Aldrich, St. Louis, MO, USA), at 37°C with 5% CO2. Plasmid transfection was performed using jetPRIME transfection regent (Polyplus-transfection S.A., Illkirch, France). Lansoprazole was dissolved in dimethyl sulfoxide (DMSO) (FUJIFILM Wako Pure Chemical Co.). Cells were treated with 100 μM of lansoprazole; as a vehicle control, an identical amount of DMSO was added to the media. Cell viability assay The cell viability assay was performed by using the Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega Corp., Madison, WI, USA). Cells were plated in a 96-well flat-bottom plate and cultured in 100 μL of DMEM containing 10% FBS. Cells were pretreated with 100 μM of lansoprazole for 3 h and were then treated with 20 μM of cisplatin. After 24 h, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt (MTS) reagent (20 μL/well) (Promega Corp.) was added to each well, and cells were incubated for a further 1 h at 37°C. The absorbance was recorded at 490 nm in a 96-well plate reader (Corona Electric Co., Ltd., Ibaraki, Japan). Data for cell viability represent the results of at least three independent experiments, each of which was performed in triplicate. Subcellular fractionation and immunoblots Nuclear and cytoplasmic fractions were prepared by using a nuclear/cytosol fractionation kit (BioVision Inc., Mountain View, CA, USA). Briefly, cells were harvested with cold phosphate-buffered saline (PBS). Cells were then lysed in 400 μL of the extraction buffer containing dithiothreitol and a protease inhibitor cocktail (Roche, Mannheim, Germany), on ice, for 30 min. After 10 min of centrifugation (700 × g), the supernatant (cytosolic fraction) was collected, and the pellet was resuspended in a nuclear extraction buffer to obtain the nuclear fraction. Whole cell extracts were prepared with a RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM of NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS) (Nacalai Tesque, Inc., Kyoto, Japan) with a protease inhibitor cocktail (Roche). The protein concentration was determined using a BCA protein assay kit (Takara Bio, Inc., Shiga, Japan). Cell lysates (30 μg protein/lane) were resolved using 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and separated proteins were transferred to a polyvinylidene difluoride membrane (Merck Millipore, Bedford, MA, USA). After blocking with 5% nonfat dry milk for 1 h at room temperature, the membrane was incubated overnight at 4°C with a primary antibody. The following primary antibodies were used: anti-Nrf2 antibody (1:5,000, 16396-1-AP; Proteintech Group, Inc., Rosemont, IL, USA), anti-Histone H3 antibody (1:1,000, ab1791; Abcam, Cambridge UK), anti-α-tubulin antibody (1:1000, sc-23948; Santa Cruz Biotechnology), anti-β-actin antibody (1∶500, A5060; Sigma-Aldrich), anti-HO1 antibody (1∶3,000, SPA-895; Enzo Life Sciences, Inc., Farmingdale, New York, USA), anti-p38α/β (A-12) antibody (1:1,000, sc-7972; Santa Cruz Biotechnology), anti-phospho-p38 antibody (1:1,000, no. 9211; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-ERK1/2 antibody (1:1,000, no. 4695; Cell Signaling Technology, Inc.), anti-phospho-ERK1/2 antibody (1:1,000, no. 9101; Cell Signaling Technology, Inc.), anti-JNK antibody (1:1,000, no. 9252; Cell Signaling Technology, Inc.), and anti-phospho-JNK antibody (1:1,000, no. 9251; Cell Signaling Technology, Inc.). Following incubation with an appropriate secondary antibody for 1 h at room temperature, the bound antibodies were detected using a Western BLoT Hyper HRP Substrate (Takara Bio, Inc.). Three independent experiments were performed, and representative immunoblot analysis of the experiment is presented below. Cycloheximide chase assay Cells were treated with 100 μM of lansoprazole for 3 h followed by incubation with 10 μM of CHX. Cell lysates were prepared 0, 15, 30, 45, 60, and 75 min after the CHX treatment. Whole cell extracts (10 μg) were resolved using SDS-PAGE and were analyzed by immunoblotting with an anti-Nrf2 antibody (Proteintech Group, Inc.); an anti-β-actin antibody (Sigma-Aldrich) was used as a loading control. The degradation rate of the Nrf2 protein was quantified by a densitometric measurement of the immunoblot intensity with ImageJ ver. 1.53v 21 (U.S. National Institutes of Health, Bethesda, Maryland, USA). Data represent the results of three independent experiments, each of which was performed in triplicate. λ protein phosphatase (λPPase) assay For dephosphorylation reactions, the nuclear extracts obtained from lansoprazole-treated cells were prepared as described above. Extracts were incubated with λPPase (New England BioLabs Japan Inc., Tokyo, Japan) at 8 units of enzyme/μg of protein extract diluted in 1×NEBuffer (50 mM of HEPES, 100 mM of NaCl, 2 mM of DTT, and 0.01% Brij 35 at pH 7.5) and 1 mM of MnCl2 at 30°C, for 30 min. Following incubation, samples were analyzed by immunoblotting. Three independent experiments were performed, and representative immunoblot analysis of the experiment is presented below. RNA extraction and quantitative RT-PCR Total RNA was isolated from cultured cells using Sepasol reagent (Nacalai Tesque, Inc.). For all samples, 200 ng total RNA was used to make cDNA. First strand cDNA was synthesized with the use of the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer’s instructions in a final volume of 20 μl. The obtained cDNA fragments were diluted 10-fold with water to 1 ng/μl. Quantitative RT-PCR analyses were performed using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies Inc., Tokyo, Japan) and the AriaMX Real-time PCR system (Agilent Technologies Inc.). Each reaction contained 2.5 μL diluted cDNA (2.5 ng/reaction), 200 nM of each primer, and 1 × SYBR Green Master Mix, in a final volume of 10 μL. All reactions were performed in duplicate per cDNA sample. As a control for genomic DNA contamination, total RNA without reverse transcription was tested for each sample per gene. A no-template control was included in each run per gene. The thermal profile of the reaction was 95°C for 5 min activation and denaturation, followed by 40 cycles of 95°C for 10 sec, and 60°C for 10 sec. Finally, a melting curve was generated by increasing the temperature starting from 65°C to 95°C to determine the specificity of the reactions. The quantification cycle number (Cq) was determined per reaction with Agilent AriaMx version 2.0. The primers used are listed in Table 1. The relative standard curve method was used to calculate the relative mRNA expression. mRNA expression levels were normalized to those of β-actin and glyceraldehyde-triphosphate dehydrogenase (GAPDH) mRNA. Data represent the results of three independent experiments, each of which was performed in triplicate. 10.1371/journal.pone.0287788.t001 Table 1 The primer sequences used for quantitative RT-PCR. Gene Primer Sequence (5ʹ–3ʹ) HO1 (rat) Forward ACAGGGTGACAGAAGAGGCTAA Reverse CTGTGAGGGACTCTGGTCTTTG NQO1 (rat) Forward CAGCGGCTCCATGTACT Reverse GACCTGGAAGCCACAGAAG GSTA2 (rat) Forward CTTCTCCTCTATGTTGAAGAGTTTG Reverse TTTTGCATCCACGGGAA β-actin (rat) Forward GGAGATTACTGCCCTGGCTCCTA Reverse GACTCATCGTACTCCTGCTTGCTG GAPDH (rat) Forward AGGTTGTCTCCTGTGACTTC Reverse CTGTTGCTGTAGCCATATTC siRNA transfection Two stealth siRNA duplexes targeting the rat Nrf2 mRNA (#1: 5'-UGG AGC AAG ACU UGG GCC ACU UAA A-3'; #2: 5'-GGA AAC CUU ACU CUC CCA GUG AGU A-3') and the stealth RNAi-negative control siRNA (medium GC content) were purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Cells were transfected with siRNA (5 nM) using Lipofectamine RNAiMax and Opti-MEM media (Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s instructions. Data represent the results of three independent experiments, each of which was performed in triplicate. Generation of a stable ARE-driven reporter system The ARE-driven reporter gene construct pGL4.37 [luc2P/ARE/Hygro] was purchased from Promega Corp (Madison, WI, USA). RL34 cells were transfected with the pGL4.37 plasmid using jetPRIME transfection reagent. After incubation with growth media for 48 h, cells were cultured with media containing 400 μg/mL of hygromycin B (Sigma-Aldrich, St. Louis, MO, USA) for 3 weeks in order to establish a stable cell line. Hygromycin B-resistant colonies were pooled and used for the reporter gene analysis. Stable transfectants were maintained in DMEM supplemented with 10% FBS and 80 μg/mL hygromycin B at 37°C, with 5% CO2. Measurement of ARE-dependent transcriptional activity Cells stably transfected with an ARE-reporter were replated in 12-well plates and exposed to 100 μM of lansoprazole for 3 h. Luciferase activities in cell lysates were measured using the luciferase assay system (Promega Corp.). Data represent the results of at least three independent experiments, each of which was performed in triplicate. Immunocytochemistry Cells were grown on glass bottom dishes (MatTek Corporation, Ashland, MA, USA) and exposed to 100 μM of lansoprazole for 3 h. Cells were then washed with PBS and fixed in 4% (w/v) paraformaldehyde (PFA) in phosphate buffer, at room temperature. Fixed cells were then permeabilized in 0.1% Triton X-100. After blocking with 1% bovine serum albumin for 30 min at room temperature, cells were incubated with an anti-Nrf2 (H-300) antibody (1:50, sc-13032; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) overnight, at 4°C. Following three washes in PBS, an Alexa Fluor 488 goat anti-rabbit IgG antibody (1:250; Thermo Fisher Scientific, Inc., Waltham, MA, USA) was added for 2 h, at room temperature. Finally, cells were stained with Hoechst 33342 dye (Dojindo Laboratories, Kumamoto, Japan). Images were obtained using a confocal microscope (Carl Zeiss Japan, LSM 700 ZEN, Tokyo, Japan). Three independent experiments were performed, and representative immunocytochemical analysis of the experiment is shown. Statistical analysis All statistical analyses were performed using JMP version 14.3 statistical software (SAS Institute Inc., Cary, NC, USA). Results are expressed as mean ± standard deviation (SD). Statistical analyses were performed using an unpaired Student’s t-test. For multiple comparisons, we performed one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison post hoc test. Values of p that were found to be <0.05 were considered to be statistically significant. Results Lansoprazole activates the Nrf2/ARE pathway in RL34 cells A series of experiments using RL34 cells, a rat hepatic cell line was designed to investigate the molecular mechanism underlying the activation of the Nrf2 pathway. We first examined whether lansoprazole could activate the Nrf2/ARE pathway in this cell line. Immunoblotting studies confirmed the significant increases in Nrf2 levels in both the nuclear (41-fold) and the cytoplasmic (3-fold) fractions of the lansoprazole-treated cells (Fig 1A). Subsequently, to confirm the nuclear localization of the Nrf2 protein following treatment with lansoprazole, immunocytochemistry with an anti-Nrf2 antibody was performed. Nrf2 exhibited weak cytoplasmic staining in the control (DMSO-treated) cells, whereas the lansoprazole-treated cells exhibited strong nuclear Nrf2 staining (Fig 1B). Furthermore, the mRNA levels of the Nrf2 target genes encoding HO1, NQO1, and GSTA2 were increased by 17-, 12- and 33-times, respectively, when compared with those of the DMSO-treated cells in the results using β-actin as a reference (Fig 1C). Similar results were obtained when using GAPDH as a reference gene (Fig 1D). Two clonal RL34 cell lines stably expressing an ARE-driven luciferase reporter (clones #1 and #2) were then established to analyze the transcriptional activity of the ARE promoter. These cells exhibited 20- and 30-fold induction of their luciferase activity following treatment with lansoprazole for 3 h (Fig 1E). Lansoprazole is suggested by these results to induce the Nrf2 nuclear accumulation, and subsequently enhance the expression of antioxidant genes in RL34 cells. Nrf2 activators are recognized to increase the stability of the Nrf2 protein by inhibiting the proteasomal degradation of Keap1 [34, 35]. The effect of lansoprazole on the degradation rate of the Nrf2 protein was therefore determined using a CHX chase assay. Treatment with lansoprazole extended the half-life of the Nrf2 protein from 33.0 to 61.5 min (Fig 1F). Lansoprazole is indicated to inhibit the degradation of the Nrf2 protein, and increases its stability. 10.1371/journal.pone.0287788.g001 Fig 1 Lansoprazole activates the Nrf2/ARE pathway in RL34 cells. A: Representative immunoblot for Nrf2 expression levels in the nuclear and cytoplasmic protein lysates obtained from cells treated with 100 μM of lansoprazole for 3 h; α-tubulin and histone H1 were loading controls for the cytoplasmic and nuclear lysates, respectively (left). Densitometric quantification of the representative immunoblots was performed using ImageJ, and values were normalized to each of the loading control protein level (right). B: Representative immunocytochemical images of the subcellular localization of Nrf2. RL34 cells were treated with 100 μM of lansoprazole for 3 h. Cells were fixed in 4% PFA for 15 min, followed by staining with an anti-Nrf2 antibody and an Alexa Fluor 488-conjugated goat anti-rabbit IgG antibody. Counterstaining of the nuclei was performed with Hoechst 33342. The scale bar represents 50 μm. C and D: Relative mRNA expression levels of Nrf2-induced genes HO1, NQO1, and GSTA2 in cells treated with 100 μM lansoprazole for 3 h. RNA levels were normalized to those of β-actin (C) or GAPDH (D). E: Induction of the ARE-dependent luciferase reporter activity by lansoprazole. RL34 cells stably expressing an ARE-reporter gene were treated with 100 μM of lansoprazole for 3 h, and the luciferase activity in the cell lysates was measured. F: Degradation rate of the Nrf2 protein after CHX chase. Cells were treated with 100 μM of lansoprazole for 3 h and were then treated with 10 μM of CHX for the indicated periods. Cell lysates were used for immunoblotting analysis with an anti-Nrf2 and anti-β-actin antibody. Intensities of the Nrf2 bands were quantified and plotted on a semilog graph to obtain half-life values. Abbreviations used in the figure: LPZ, lansoprazole; CHX, cycloheximide. Data represent the mean ± SD of the three independent experiments performed in triplicate. Statistical analysis was performed by using Student’s t-test. *: p < 0.05 vs. DMSO-treated cells. Lansoprazole suppresses the cisplatin-induced cytotoxicity; activity is partially dependent upon HO1 An in vitro cisplatin-induced cytotoxicity model was conducted to assess the effect of lansoprazole on oxidative stress-induced cell death. Cisplatin cytotoxicity was determined using an MTS assay. Cell viability was decreased to 25% by cisplatin treatment when compared with that of untreated cells, whereas cells pretreated with lansoprazole exhibited an increase in their cell viability of approximately 80% (Fig 2). The effect of lansoprazole was partially eliminated by co-treatment with the specific HO1 inhibitor tin-mesoporphyrin IX (SnMP). Lansoprazole is suggested by these results to have a protective effect against the cisplatin-induced cytotoxicity and this effect is partially mediated by the upregulation of HO1. 10.1371/journal.pone.0287788.g002 Fig 2 Lansoprazole suppresses the cisplatin-induced cytotoxicity. Cell viability of cisplatin-treated cells exposed to a lansoprazole pretreatment. RL34 cells were pretreated with 100 μM of lansoprazole for 3 h and then exposed to 20 μM of cisplatin for an additional 24 h. HO1 inhibitor SnMP was administered simultaneously with lansoprazole. Cell viability was quantified using an MTS assay. Data are expressed as a percentage of viability when compared with the viability of the DMSO-treated cells. Data represent the mean ± SD of three independent experiments performed in triplicate. Statistical analysis was performed by using ANOVA followed by Tukey’s test for multiple comparisons. *: p < 0.01. Abbreviations: LPZ, lansoprazole; SnMP, tin-mesoporphyrin IX; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium,inner salt. Nrf2 is necessary for the cytoprotective activity of lansoprazole To demonstrate whether the induction of expression of HO1 by lansoprazole is dependent upon that of Nrf2, an siRNA-mediated silencing of Nrf2 was performed. RL34 cells were transfected with one of two siRNAs targeting different sites in the rat Nrf2 mRNA (siNrf2#1 and siNrf2#2). After 24 h, the Nrf2 mRNA levels were examined by quantitative RT-PCR. The knockdown efficiencies of the individual siRNAs on the Nrf2 expression were 91% (siNrf2#1) and 91.4% (siNrf2#2) as compared with the expression levels of cells treated with the control siRNA in the results using β-actin as a reference (Fig 3A). Similar results were obtained when using GAPDH as a reference gene (Fig 3B). RL34 cells were transfected with pooled Nrf2 siRNAs, and the expression level of lansoprazole-induced HO1 were assessed. As expected, the Nrf2 knockdown completely blocked the lansoprazole-induced expression of both HO1 mRNA (Fig 3C and 3D) and protein (Fig 3E). Lansoprazole is suggested by these results to induce the expression of HO1 mRNA and protein in an Nrf2-dependent manner. Furthermore, the effect of Nrf2 depletion on lansoprazole-mediated cytoprotection against cisplatin-induced cytotoxicity was assessed. RL34 cells were transfected with siNrf2 pools, followed by treatment with lansoprazole for 3 h. The cisplatin-induced cytotoxicity was then measured using an MTS assay. The cytotoxicity of cisplatin was increased in the Nrf2-knockdown cells to the same level as that observed in cells receiving a single administration of cisplatin (Fig 3F). The cytoprotective effect of lansoprazole is suggested to be dependent upon the Nrf2 pathway. 10.1371/journal.pone.0287788.g003 Fig 3 Nrf2 is essential for the cytoprotective activity of lansoprazole. A and B: Knockdown efficiency of siRNAs targeting Nrf2. RL34 cells were transfected with one of the two siRNAs targeting different sites in the rat Nrf2 mRNA (5 nM) or with control siRNA (5 nM) for 24 h. Nrf2 mRNA levels were measured using quantitative RT-PCR and were normalized to those of β-actin (A) or GAPDH (B). Results are expressed as a percentage of the mRNA levels of the samples treated with control siRNA. C and D: Effects of Nrf2 knockdown on the expression of the lansoprazole-induced gene HO1 mRNA. Cells were transfected with 5 nM of control or pooled Nrf2 siRNA and, 24 h later, were treated with 100 μM of lansoprazole for 3 h. HO1 mRNA levels were measured using quantitative RT-PCR; RNA levels were normalized to the β-actin (C) or GAPDH (D) mRNA level. Data represent the mean ± SD of three independent experiments performed in triplicate. Statistical analysis was performed using Student’s t-test. *: p < 0.05 vs. DMSO-treated control siRNA-transfected cells. E: Effects of Nrf2 knockdown on the expression of lansoprazole-induced Nrf2 and HO1 protein. Cells were transfected with 5 nM of control or pooled Nrf2 siRNA and then 24 h later were treated with 100 μM of lansoprazole for 3 h. Nrf2 and HO1 protein levels were measured using immunoblotting. β-actin served as a loading control. F: Effect of siRNA depletion of Nrf2 on the lansoprazole-mediated cytoprotection. siRNA-transfected cells were treated with 100 μM of lansoprazole for 3 h and then exposed to 20 μM of cisplatin for an additional 24 h. Cell viability was quantified using an MTS assay. Data are expressed as a percentage of viability when compared with DMSO-treated control siRNA-transfected cells. Data represent the mean ± SD of three independent experiments performed in triplicate. Statistical analysis was performed by using ANOVA and Dunnett’s test. *: p < 0.01 vs. cisplatin treatment group. Abbreviations: LPZ, lansoprazole; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt. Lansoprazole activates the p38 MAPK signaling but not ERK1/2 or JNK signaling The Nrf2 band was found to be upshifted in the nuclear fraction of the lansoprazole-treated cells (Fig 1A), indicating that Nrf2 translocated to the nucleus underwent posttranscriptional modifications. Phosphorylation is known to induce an upward shift of protein bands, so we examined the phosphorylation state of the Nrf2 in the nucleus. Nuclear fractions of the lansoprazole-treated cells were incubated in the presence or absence of λPPase, at 4°C or 30°C (Fig 4A). The nuclear Nrf2 incubated with phosphatase at 30°C exhibited a downshift on SDS-PAGE, whereas those incubated without the phosphatase (at 4°C and at 30°C) did not, indicating that Nrf2 is phosphorylated in the nucleus. The effect of lansoprazole on the phosphorylation of three major MAPKs (namely, p38 MAPK, ERK1/2, and JNK) were examined using RL34 cells (Fig 4B). The phosphorylation of p38 MAPK was enhanced in the lansoprazole-treated cells, whereas that of ERK1/2 and JNK had no apparent changes. Lansoprazole therefore specifically activates p38 MAPK, which subsequently plays an important role in the nuclear translocation of Nrf2 in RL34 cells. 10.1371/journal.pone.0287788.g004 Fig 4 Lansoprazole activates p38 MAPK, but not ERK1/2 or JNK in RL34 cells. A: Detection of phosphorylated Nrf2 in the nucleus. RL34 cells were treated with lansoprazole for 3 h. Nuclear protein extracts from the cells were incubated with or without λPPase at 4°C or 30°C, for 30 min, and were analyzed using immunoblotting with an anti-Nrf2 antibody. B: Representative immunoblot for the phosphorylated and total p38 MAPK, ERK1/2, and JNK expression levels. RL34 cells were treated with 100 μM of lansoprazole for 3 h. Whole cell lysates from the cells were analyzed using immunoblotting with the indicated antibodies; β-actin served as a loading control (left). Densitometric quantification of representative immunoblots was performed using ImageJ. Values were normalized to β-actin protein levels. The ratio of the phosphorylated protein to total protein were also calculated (right). Data represent the mean ± SD of three independent experiments performed in triplicate. Statistical analysis was performed using Student’s t-test. *: p < 0.05 vs. DMSO-treated cells. Abbreviation: LPZ, lansoprazole. Activation of p38 MAPK is required for the lansoprazole-induced Nrf2/ARE pathway in RL34 cells A selective inhibitor of p38 MAPK (SB203580) was then used to investigate the role of p38 MAPK in the activation of the Nrf2/ARE pathway in RL34 cells [36]. First, the effect of p38 MAPK on the Nrf2 upregulation by lansoprazole was examined. Immunoblotting analysis revealed that the lansoprazole-induced Nrf2 upregulation was completely inhibited by the addition of SB203580 (Fig 5A). Then inhibition of p38 MAPK by SB203580 completely canceled the lansoprazole-induced ARE-associated luciferase activity (Fig 5B) and the expression of HO1 (Fig 5C and 5D). Consistent with these data, immunofluorescence analysis revealed that the lansoprazole-induced nuclear translocation of Nrf2 was impaired by SB203580 (Fig 5E). SB203580 was suggested by these findings to have blocked the Nrf2/ARE pathway upstream of the nuclear translocation of Nrf2. p38 MAPK is therefore likely the key MAPK whose activation is required for the lansoprazole-induced HO1 expression in RL34 cells. 10.1371/journal.pone.0287788.g005 Fig 5 Activation of p38 MAPK is required for the lansoprazole-induced ARE/Nrf2 pathway in RL34 cells. A: Effect of SB203580 on the induction of Nrf2 protein expression by lansoprazole. RL34 cells were treated with 10 μM of SB203580 (a specific p38 MAPK inhibitor) for 30 min, and then exposed to 100 μM of lansoprazole for an additional 3 h. Whole cell protein lysates were analyzed by immunoblotting with an anti-Nrf2 antibody; β-actin served as a loading control. B: Effect of SB203580 on the induction of the ARE-dependent reporter activity by lansoprazole. RL34 cells stably expressing the ARE-reporter gene were pretreated with 10 μM of SB203580 for 30 min, and then exposed to 100 μM of lansoprazole for an additional 3 h. Luciferase activity in the cell lysates was measured. C and D: Total RNA was isolated from the cells. Relative mRNA expression levels of HO1 were measured by quantitative RT-PCR. RNA levels were normalized to β-actin (C) and GAPDH (D) mRNA level. Data represent the mean ± SD of three independent experiments performed in triplicate. Student’s t-test was employed for statistical analysis. *: p < 0.05 vs. untreated cells. E: Representative immunocytochemical images of the subcellular localization of Nrf2. RL34 cells were treated with 10 μM of SB203580 for 30 min and then exposed to 100 μM of lansoprazole for an additional 3 h. Cells were fixed in 4% PFA for 15 min, followed by a staining with anti-Nrf2 antibody and an Alexa Fluor 488-conjugated goat anti-rabbit IgG antibody; counterstaining of the nuclei was performed with Hoechst 33342. The scale bar represents 50 μm. Abbreviation: LPZ, lansoprazole. Activation of p38 MAPK is required for the cytoprotective activity of lansoprazole against cisplatin-induced toxicity We subsequently investigated whether the p38 MAPK pathway is involved in the cytoprotective activity of lansoprazole. RL34 cells were treated with lansoprazole for 3 h in the presence or absence of an SB203580 pretreatment and the MTS assay was used to determine the cell viability after exposure to cisplatin for 24 h. The inhibition of the p38 MAPK pathway by SB203580 completely restored the sensitivity to cisplatin in RL34 cells treated with lansoprazole (Fig 6). Cytoprotective activity of lansoprazole is therefore suggested to be through the p38 MAPK pathway. 10.1371/journal.pone.0287788.g006 Fig 6 Activation of p38 MAPK is required for the cytoprotective activity of lansoprazole against cisplatin-induced toxicity. Effect of SB203580 on the cytoprotective activity of lansoprazole. RL34 cells were treated with 100 μM of lansoprazole for 3 h in the presence or absence of 10 μM of an SB203580 (a specific p38 MAPK inhibitor) pretreatment for 30 min and were then exposed to 20 μM of cisplatin for an additional 24 h. Cell viability was quantified using an MTS assay. Data are expressed as a percentage of viability of nontreated cells. Data represent the mean ± SD of three independent experiments performed in triplicate. Statistical analysis was performed using ANOVA followed by Tukey’s test for multiple comparisons. *: p < 0.01. Abbreviations: LPZ, lansoprazole; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt. Discussion The present study demonstrated that lansoprazole can activate the Nrf2/ARE-mediated antioxidant and phase 2 detoxifying gene expression, and can suppress cisplatin-induced cytotoxicity. These effects were completely canceled by knockdown of Nrf2 and inhibition of p38 MAPK, suggesting that the function of lansoprazole for inhibiting cisplatin-induced cell death is dependent on Nrf2 and p38 MAPK. In addition, the Nrf2 protein accumulated in the nucleus following lansoprazole treatment was phosphorylated, suggesting that this modification is involved in the anti-cell death function of lansoprazole. We previously reported that lansoprazole upregulates Nrf2 expression and attenuates the drug-induced oxidative liver injury in rats [32, 33]. Lansoprazole has been reported to exhibit Nrf2-mediated antioxidant and anti-inflammatory effects in gastric mucosal cells [23] and the small intestine [28] and in the rat kidneys [37]. Our data demonstrated that lansoprazole is a potent inducer of the Nrf2/ARE antioxidant pathway in hepatic cells, independently of its acid secretory-related actions (Fig 7). Lansoprazole is one of the most widely prescribed drugs worldwide, and is considered to have well-established safety and efficacy. Clinical application of lansoprazole is therefore expected to expand relatively quickly in the future as a treatment for liver diseases. 10.1371/journal.pone.0287788.g007 Fig 7 Lansoprazole activates the p38 MAPK/Nrf2/ARE pathway and suppresses cisplatin-induced cell death in RL34 cells. Schematic model of the Nrf2-dependent cytoprotective signaling pathway by lansoprazole in RL34 cells. Lansoprazole suppresses cisplatin-induced cytotoxicity through the activation of the Nrf2 pathway, accompanied by induction of antioxidant genes such as that encoding HO1. These effects are dependent on the p38 MAPK pathway. Cisplatin is a commonly utilized chemotherapeutic agent, and confers toxicity to various tissues, including the liver. Growing evidence indicates that the production of ROS induced by cisplatin can trigger oxidative stress, and even cause cell death [16–18, 38, 39]. Increased oxidative stress is one of the main mechanisms involved in cisplatin-induced hepatotoxicity, as indicated by both in vitro and in vivo studies [18]. The activation of the Nrf2 signaling pathway has been associated with an increase in the expression of antioxidant enzymes and a decrease in ROS levels [40–42]. An Nrf2 activator should therefore be expected to provide organ and cell protection against cisplatin-induced cytotoxicity. Consistent with previous reports, this study demonstrated that lansoprazole confers protective effects against cisplatin-induced cytotoxicity in RL34 cells. Marullo et al. showed that cisplatin induced direct damage to mitochondrial DNA, causing oxidative stress by increasing the intracellular ROS level [17]. Mitochondria are the main source of ROS, so it can be inferred that lansoprazole can scavenge exogenous or endogenous ROS other than that induced by cisplatin. Lansoprazole could have wider clinical applications. The cisplatin-induced cytotoxicity model using RL34 cells employed in this study has been a useful model for the establishment of the cytoprotective mechanism of lansoprazole. Nrf2 plays a crucial role in regulating cellular redox homeostasis, and protects cells from oxidative stress by inducing the transcriptional activation of antioxidant and phase II detoxifying enzymes through the ARE [43–45]. Nrf2 protection of the liver from several hepatotoxicants has been shown in many studies, and this is known to be accompanied by induction of antioxidant genes encoding proteins, such as HO1 [3]. Nrf2 activation was predicted to play a crucial role in the cytoprotective effect of lansoprazole. As expected, the siRNA-mediated knockdown of Nrf2 completely abolished the upregulation of HO1 as well as the cytoprotective effect of lansoprazole, whereas SnMP, an inhibitor of HO1, was able to partially block this effect. These results are inconsistent with those of previous studies [28], and the induction of the HO1 expression did not fully account for the protective effect of lansoprazole. Lansoprazole has been observed to significantly increase the expression levels of NQO1 and GSTA2 mRNA. Furthermore, these Nrf2-regulated antioxidant genes may contribute to the cytoprotection of lansoprazole. One limitation of this study, based on previous reports [32], is that sampling was conducted at 3 h after lansoprazole treatment, and stronger antioxidant activity could be observed if tested over a longer time course. In this study, we attempted to elucidate the intracellular signal transduction mechanism of the hepatic protection by lansoprazole, and we subsequently used a rat hepatic RL34 cell culture model. Using in vitro phosphatase assay with RL34 cells, we showed that Nrf2 translocated to the nucleus (as a result of the lansoprazole treatment) is phosphorylated. Phosphorylation of Nrf2 is indicated to be involved in Nrf2 nuclear translocation and the activation of the ARE-associated gene transcription [46, 47]. MAPK signaling (through p38 MAPK, ERK1/2, and JNK) may play an important role in the stress response, including the regulation of the Nrf2/ARE pathway [48–52]. However, the involvement of MAPKs in the lansoprazole-induced pathway remains unclear. Takagi et al. reported the role of ERK in lansoprazole-induced expression of HO1 in rat gastric mucosal cell lines [23], whereas Schulz-Geske et al. reported that lansoprazole-induced expression of HO1 without an activation of the MAPK pathways in NIH3T3 mouse embryonic fibroblasts [25]. Remarkably, in RL34 cells, lansoprazole could induce the phosphorylation of p38 MAPK, but not that of ERK1/2 or JNK. Further experiments using SB203580, a specific inhibitor for p38 MAPK, confirmed the exclusive role of p38 MAPK in the lansoprazole-induced Nrf2/HO1 activation and cytoprotective effects. However, as a second limitation, our study could not demonstrate whether the p38 MAPK directly phosphorylates the Nrf2 in lansoprazole-treated cells. Further studies are required to define the direct association between p38 MAPK and Nrf2. As a crosstalk between different MAPK signaling pathways does not seem to occur, the RL34 cell line is a useful in vitro model for the study of the intracellular molecular mechanism of the lansoprazole-mediated Nrf2 pathway induction in hepatocytes. A third limitation is that the experiments were performed in only one cell line. Although lansoprazole caused exclusive p38 MAPK activation in RL34 cells, it is possible that other MAPK signaling pathways are activated in other cell types (e.g., human). Lansoprazole has in fact been reported to induce HO1 in gastric mucosal cell lines via the ERK pathway [23] and in NIH3T3 mouse embryonic fibroblasts via the PI3K (the phosphatidylinositol 3-kinase) pathway, not the MAPK family [25]. In basal conditions, Nrf2 activity is suppressed by the cytoplasmic repressor Keap1, which promotes its proteasome-dependent degradation. Most Nrf2 inducers are known to react with the cysteine residues of Keap1, causing a conformational change of the Keap1-Nrf2 complex [6] and, thereby, obstructing the Nrf2 degradation. The newly generated Nrf2 accumulates and translocates into the nucleus. Takagi et al. showed that stimulation with lansoprazole can induce the oxidation of the Keap1 cysteine residues in gastric mucosal cells [23]. In the current study, we found that treatment with lansoprazole can stabilize the Nrf2 protein. Lansoprazole was suggested to activate the Nrf2/ARE pathway by modifying the interaction between Keap1 and Nrf2, similarly to other Nrf2 inducers. However, as a fourth limitation, this study did not detect a direct modification of the Keap1 protein by lansoprazole. Further studies are required to demonstrate whether the hepatoprotective effect of lansoprazole results from a direct inactivation of Keap1 or from the regulation of the Keap1 inactivation by other upstream factors. Lansoprazole is a prodrug that needs activation in an acidic environment such as the acidic secretory canaliculi for its anti-secretory effect [53]. Our previous study showed that proton pump H+/K+-adenosine triphosphatase was not expressed in rat liver, and the cytoprotective effect of lansoprazole is therefore assumed to be mediated by an inactive form [32]. Moreover, lansoprazole is metabolized mainly by CYP2C19 and CYP3A4 in the liver [54], with the major metabolites being 5’-hydroxy lansoprazole and the lansoprazole sulfone. As a fifth limitation, the present study could not determine whether the cytoprotective effect of lansoprazole was caused by acid-induced activation or metabolism by CYP enzymes, and this requires future investigation. The concentration of 100 μM lansoprazole employed in this study is much higher than the maximum serum concentration in healthy adults given a single oral administration of 30 mg lansoprazole, which can be considered as a sixth limitation. However, the plasma concentration of lansoprazole does not correlate with tissue concentrations of lansoprazole. Lansoprazole accumulates in acidic tissue environments, where local concentrations have been proposed to reach millimolar levels [54]. The regular clinical dosage of lansoprazole has been determined by the amount of acid suppression in the stomach. Data regarding optimal dosing is unavailable for in vivo studies of Nrf2-mediated hepatoprotective activity. Antioxidant effects on the liver in humans treated with lansoprazole have not been studied, and the optimal dosage requires investigation. As a seventh limitation, lansoprazole is reported to have anti-inflammatory effects [19, 20], but the expression levels of inflammatory cytokines were not investigated in this study. Subsequent studies should therefore focus on inflammatory cytokines and investigate gene expression levels, focusing on those downstream of Nrf2. Furthermore, several reports have shown that lansoprazole can directly scavenge ROS as a substantial scavenger using chemical antioxidant assay [55, 56]. Lansoprazole is suggested to have a direct antioxidant function in the liver, separate from its action via the p38 MAPK/Nrf2 signaling pathway. In conclusion, our results demonstrate that lansoprazole confers cytoprotection against cisplatin-induced cell death through the activation of the Nrf2/ARE pathway and through the upregulation of antioxidant enzymes downstream of Nrf2 (that takes place via the p38 MAPK signaling pathway). Oxidative stress is the cause of most liver diseases, and it is a plausible therapeutic target to prevent liver damage [57]. The induction of the antioxidant Nrf2 pathway may protect hepatic cells from oxidative stress and avoid the progression of disease. Various compounds have been postulated to increase Nrf2 activity, although an effective Nrf2 inducer is not currently available to counteract liver diseases. This study extended prior knowledge on the acid-independent effect of lansoprazole and provided novel insights into the mechanisms involved. Lansoprazole may therefore be a potential candidate for the treatment of liver diseases. Supporting information S1 Raw images Original uncropped images underlying all blots. This file contains all uncropped blot information. The asterisk indicates a nonspecific protein band. (PDF) Click here for additional data file. S1 Data (XLSX) Click here for additional data file. We acknowledge proofreading and editing by Benjamin Phillis at the Clinical Study Support Center at Wakayama Medical University. 10.1371/journal.pone.0287788.r001 Decision Letter 0 Yap Wei Hsum Academic Editor © 2023 Wei Hsum Yap 2023 Wei Hsum Yap https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version0 6 Mar 2023 PONE-D-22-35612Activation of p38 MAPK signaling is required for lansoprazole-mediated Nrf2 activation and cytoprotective effects against cisplatin toxicity in rat hepatic RL34 cells.PLOS ONE Dear Dr. Yamagishi, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Apr 20 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Wei Hsum Yap Academic Editor PLOS ONE Journal Requirements: When submitting your revision, we need you to address these additional requirements. 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf 2. Please note that PLOS ONE has specific guidelines on code sharing for submissions in which author-generated code underpins the findings in the manuscript. In these cases, all author-generated code must be made available without restrictions upon publication of the work. Please review our guidelines at https://journals.plos.org/plosone/s/materials-and-software-sharing#loc-sharing-code and ensure that your code is shared in a way that follows best practice and facilitates reproducibility and reuse. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This work was supported in part by a Japan Society for the Promotion of Science 478 (JSPS) KAKENHI grant (grant no. 17K15963) to N. Yamagishi.” We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows: “This work was supported in part by a Japan Society for the Promotion of Science (JSPS) KAKENHI grant (grant no. 17K15963) to Naoko Yamagishi. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.” Please include your amended statements within your cover letter; we will change the online submission form on your behalf. 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels. In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions. 5. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability. Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized. Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access. We will update your Data Availability statement to reflect the information you provide in your cover letter. 6. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical. Additional Editor Comments: Please revise the manuscript to enhance clarity of the submission. [Note: HTML markup is below. Please do not edit.] Reviewers' comments: Reviewer's Responses to Questions Comments to the Author 1. Is the manuscript technically sound, and do the data support the conclusions? The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1: Yes Reviewer #2: Partly ********** 2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1: I Don't Know Reviewer #2: Yes ********** 3. Have the authors made all data underlying the findings in their manuscript fully available? The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified. Reviewer #1: No Reviewer #2: Yes ********** 4. Is the manuscript presented in an intelligible fashion and written in standard English? PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here. Reviewer #1: Yes Reviewer #2: Yes ********** 5. Review Comments to the Author Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters) Reviewer #1: This manuscript is very interesting and poses lansoprazole as a potential therapeutic target for oxidative stress to the liver. However, the data could be presented in a more clear fashion, and the wording in some areas could be improved. Reviewer #2: Overview: Generally, the manuscript presented the novelty of the study in elucidating the potential molecular mechanisms of lansoprazole in cisplatin-induced hepatoxicity in rat hepatic RL34 cells. This manuscript provides an insightful scientific impact on the molecular mechanisms of lansoprazole. The study design and method used were reliable, yet the reporting in methods and results require improvements. Some recommendations have been suggested as below for revision. Strengths: 1. This paper presented novel insights on the mechanisms of lansoprazole. 2. The method used was robust and reliable. Limitations: 1. Poor reporting in methodology and result. 2. Gene expression study with 1 housekeeping gene is less convincing. Title: Title is too length with too many unnecessary words. Suggest to revise. Abstract: 1. Line 14; 28: Kindly avoid the use of first- and second-person pronouns (i.e. we) in the abstract. Please use active voice and third-person narrative throughout the manuscript. 2. Line 20: Typo for ‘NAD(P)H:1quinone oxidoreductase-1’? It should be written as ‘NAD(P)H quinone oxidoreductase-1’. 3. Method was not mentioned in the abstract. Introduction 1. Line 48: ‘The nuclear Nrf2…’ 2. Line 72 - 79: Kindly avoid the use of first- and second-person pronouns (i.e. we) in the abstract. Please use active voice and third-person narrative. 3. Suggest to include the relationship of nrf-2 with p38 and Erk1 in introduction to provide an better overview on the signaling pathway involved and further justified on the choice of antibodies used in Western blotting. Methods 1. Some chemicals or materials only provided with brand name without the city and country of manufacturing, including FBS, DMSO, DMEM, MTS reagent, lansoprazole, RIPA buffer, hygromycin, luciferase assay, anti-rabbit IgG antibody. 2. How many replicates run in cell viability assay (MTS)? How many sets of experiment samples per replicate? Please mention in the method. 3. Line 106: What 96-well plate reader was used? Please specify the brand of equipment along with the city and country. 4. Line 134: CHX abbreviation was used without providing the full term when it was first introduced in the text. 5. Line 140: Version, city and country of ImageJ? 6. Line 151: The amount of total RNA used to reverse-transcribed into cDNA was not mentioned. 7. The experiment setting for gene expression in PCR assay was unclear: volume of reaction mix of PCR, thermal cycling condition, number of replicates, negative control, the validation or optimization of primers, etc. 8. Line 157: Only one housekeeping gene was used (beta actin), which is insufficient and at least two housekeeping genes are require for in vitro experiments. Based on MIQE guideline for qPCR, normalization of samples obtained from in vitro experiments can be carried out against a panel (probably two or three) of housekeeping genes whose expression has been shown to be unaffected by experimental conditions. This information must be included in any publication. Refer to MIQE guideline 5th edition published in January 2022. http://www.econferences.de/miqe-talks/ 9. Line 194: What software was used to run the statistical analyses? Please report the software, version, company, city and country that developed. 10. Number of replicates was unclear in all assays used. Under the figure, it was mentioned three independent experiments were conducted. But the number of replicates in each experiment was unclear. Results 1. Figure 2: What is the indicator for ‘A’? Abbreviations were not provided: SnMP, MTS. 2. Line 252 – 254; line 356 - 359 should be in the discussion rather than results. 3. Figure 3D: The * is missing. What is the indication of the black colour bars vs white and grey bars? From the previous figure (Fig. 2), black bars indicate treatment with LPZ. 4. Line 288: ‘Fig. 4D…’ There is no section D in Figure 4. 5. Figure 4 is not cited in the text. 6. Line 331: ‘Nuclear fractions of the lansoprazole-treated cells were incubated in the presence or absence of λPPase…. (Fig. 5A)’. The figure is incorrectly cited in the text. It should be Fig. 4A. Same for Fig. 5B (line 361), it should be Figure 4B. 7. Legend of Figure 5. The description for (B) and (C) has been wrongly presented. Please revise accordingly. Discussion: 1. To include more limitations of the study. 2. To include the future applications or research direction of this study. ********** 6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files. If you choose “no”, your identity will remain anonymous but your review may still be made public. Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy. Reviewer #1: No Reviewer #2: Yes: Yow Hui Yin ********** [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. Attachment Submitted filename: PONE-D-22-35612_reviewer report.docx Click here for additional data file. 10.1371/journal.pone.0287788.r002 Author response to Decision Letter 0 Submission Version1 11 May 2023 Answer: We have revised our manuscript according to all of the editors’ and reviewers’ comments. The changes are highlighted in red in the revised manuscript. Response to editors 1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. Answer: Thank you for your comments. We have followed the style requirements in the revised version and made some changes. The Keywords and Author Contribution statements were deleted from the manuscript file. Furthermore, Supporting Information text has been added. 2. Please note that PLOS ONE has specific guidelines on code sharing for submissions in which author-generated code underpins the findings in the manuscript. In these cases, all author-generated code must be made available without restrictions upon publication of the work. Answer: We have confirmed that all data underlying the findings described in our manuscript are fully available without restriction and this information has been added to the cover letter. 3. Thank you for stating the following in the Acknowledgments Section of your manuscript: “This work was supported in part by a Japan Society for the Promotion of Science 478 (JSPS) KAKENHI grant (grant no. 17K15963) to N. Yamagishi.” We note that you have provided additional information within the Acknowledgements Section that is not currently declared in your Funding Statement. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Answer: We have removed the funding information from the Acknowledgements section of the manuscript and this information has been added to the cover letter. 4. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. Answer: We have newly included all the original uncropped western blotting images as Supporting Information. This is also described in in the cover letter. 5. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. Answer: The following sentence was added to the Data Availability Statement section. “All data are contained within the manuscript and/or Supporting Information files.” 6. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical. Answer: Thank you. The title is now uniform across all documents and on the online submission form: “Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathway.” Response to reviewer #1 This manuscript is very interesting and poses lansoprazole as a potential therapeutic target for oxidative stress to the liver. However, the data could be presented in a more clear fashion, and the wording in some areas could be improved. Answer: We appreciate your comments and the opportunity to clarify the important points. In the revised manuscript, the following points have been corrected: 1. The original title was long and contained a lot of superfluous information; we have revised it to be shorter and more concise. 2. We misquoted the figures in the original manuscript, which were confusing and difficult to understand. In the revised manuscript, we carefully checked and correctly cited the figures. 3. We have revised the wording of sentences throughout the manuscript with the help of a native speaker of English. Moreover, the Methods and Results have been described more precisely. Furthermore, all data referenced in the manuscript and the original uncropped and unadjusted images underlying all blot or gel results have been added to the Supporting Information section. 4. To strengthen the study, in addition to β-actin, normalization by GAPDH gene expression has been performed in all quantitative RT-PCR experiments. We added the results of quantitative RT-PCR normalized by GAPDH to Figure 1D, Figure 3B, Figure 3D, and Figure 5D. The conclusions of the experiments did not differ with either normalization, suggesting more strongly that lansoprazole induces Nrf2 downstream genes. 5. We revised the limitations of our study. In addition to the two points (ⅱ and ⅳ shown below) listed in the original manuscript, we have added the five limitations to the Discussion section for a total of seven limitations. i. The assay was only performed at the third h after lansoprazole administration, so it is possible that there may be peaks in expression or function at other time points. (Lines 465 - 467) ii. Our study could not demonstrate whether the p38 MAPK directly phosphorylates the Nrf2 in lansoprazole-treated cells. Further studies are required to define the direct association between p38 MAPK and Nrf2. (Lines 483 - 484) iii. The series of experiments were performed in only one cell line. Lansoprazole exclusively activated p38 MAPK in RL34 cells, other MAPK signaling pathways may be activated in other cell types (e.g., human). (Lines 488 - 489) iv. This study did not detect a direct modification of the Keap1 protein by lansoprazole. Further studies are required to demonstrate whether the hepatoprotective effect of lansoprazole results from a direct inactivation of Keap1 or from the regulation of the Keap1 inactivation by other upstream factors. (Lines 502 - 506) v. One point that was not examined is whether the metabolites of lansoprazole are involved in the antioxidant effect. Lansoprazole is metabolized mainly in the liver to 5'-hydroxylansoprazole and lansoprazole sulfone. If these CYP molecular species are expressed in the RL34 hepatocyte cell line used in this study, the metabolites of lansoprazole may contribute to the antioxidant effect. (Lines 512 - 515) vi. The lansoprazole concentrations used in our study were higher than those the serum concentrations clinically used. The usual dose of lansoprazole is determined by the level of gastric acid suppression; data on the optimal dose in in vivo studies of Nrf2-mediated hepatoprotective activity is currently insufficient. (Lines 516 - 518) vii. Importantly, this study only analyzed the expression levels of HO1, NQO1, and GSTA2, which are downstream genes of Nrf2. Lansoprazole has been reported to have anti-inflammatory effects, but the expression levels of inflammatory cytokines were not investigated in this study. (Lines 525 - 528) 6. We have added the following information about future applications and research directions. Lines 427 - 429: “Lansoprazole is one of the most prescribed drugs worldwide, and consequently has well-established safety and efficacy. Therefore, lansoprazole is expected to expand its clinical application relatively quickly in the future as a treatment for liver diseases.” 　 Lines 536 - 542: “Oxidative stress is the cause of most liver diseases, and it is a plausible therapeutic target to prevent liver damage [58]. The induction of the antioxidant Nrf2 pathway may protect hepatic cells from oxidative stress and avoid the progression of disease. Various compounds have been postulated to increase Nrf2 activity, although an effective Nrf2 inducer is not currently available to counteract liver diseases. This study extended prior knowledge on the acid-independent effect of lansoprazole and provided novel insights into the mechanisms involved. Thus, lansoprazole may be a potential candidate for the treatment of liver diseases. ” Response to reviewer #2: Overview: Generally, the manuscript presented the novelty of the study in elucidating the potential molecular mechanisms of lansoprazole in cisplatin-induced hepatoxicity in rat hepatic RL34 cells. This manuscript provides an insightful scientific impact on the molecular mechanisms of lansoprazole. The study design and method used were reliable, yet the reporting in methods and results require improvements. Strengths: 1. This paper presented novel insights on the mechanisms of lansoprazole. 2. The method used was robust and reliable. Limitations: 1. Poor reporting in methodology and result. 2. Gene expression study with 1 housekeeping gene is less convincing. Answer: We appreciate your comments and the opportunity to clarify this important point. We have changed as detailed below. Title: Title is too length with too many unnecessary words. Suggest to revise. Answer: Thank you for your suggestions. We have shortened the title to the minimum number of characters required as follows: “Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathway.” Abstract: 1. Lines 14; 28: Kindly avoid the use of first- and second-person pronouns (i.e. we) in the abstract. Please use active voice and third-person narrative throughout the manuscript. Answer: The first- and second-person pronouns have been revised in the abstract as appropriate, and we have striven to use active voice and third-person narrative in the main part of the revised manuscript. 2. Line 20: Typo for ‘NAD(P)H:1quinone oxidoreductase-1’? It should be written as ‘NAD(P)H quinone oxidoreductase-1’. Answer: As you indicated, this was incorrect and has been corrected. 3. Method was not mentioned in the abstract. Answer: We added the following information regarding the methodology to lines 17 - 21 of the revised manuscript abstract: “Herein, we sought to investigate the molecular mechanism of cytoprotection by lansoprazole. An in vitro experimental model was conducted using cultured rat hepatic cells treated with lansoprazole to analyze the expression levels of Nrf2 and its downstream genes, the activity of Nrf2 using luciferase reporter assays, cisplatin-induced cytotoxicity, and signaling pathways involved in Nrf2 activation.” Introduction 1. Line 48: ‘The nuclear Nrf2…’ Answer: Please provide further details on what requires correction. We are unsure what you mean here. 2. Lines 72 - 79: Kindly avoid the use of first- and second-person pronouns (i.e. we) in the abstract. Please use active voice and third-person narrative. Answer: The first- and second-person pronouns have been corrected into third-person in the abstract as specified. 3. Suggest to include the relationship of nrf-2 with p38 and Erk1 in introduction to provide an better overview on the signaling pathway involved and further justified on the choice of antibodies used in Western blotting. Answer: The relationship between Nrf-2, p38, and Erk1 is described, and the signaling pathway is outlined in lines 54 - 57 of the Introduction section of the revised manuscript as follows: “Mitogen-activated protein kinase (MAPK) signaling pathways play important roles in the modulation of ARE-driven gene expression via Nrf2 activation [12-14]. Herein, the capability of lansoprazole to upregulate expression of antioxidant genes via the MAPK/ARE/Nrf2 pathway was investigated using rat hepatic cells.” Methods 1. Some chemicals or materials only provided with brand name without the city and country of manufacturing, including FBS, DMSO, DMEM, MTS reagent, lansoprazole, RIPA buffer, hygromycin, luciferase assay, anti-rabbit IgG antibody. Answer: We have added the name of the city and the country of manufacture throughout the Chemicals and Reagents section as specified. 2. How many replicates run in cell viability assay (MTS)? How many sets of experiment samples per replicate? Please mention in the method. Answer: Thank you for pointing that out. The cell viability assay (MTS) was performed in three independent experiments, each performed in triplicate. This information has been added to lines 110 - 111 of the method in the revised manuscript as follows: “Data for cell viability represent the results of at least three independent experiments, each experiment was performed in triplicate.” 3. Line 106: What 96-well plate reader was used? Please specify the brand of equipment along with the city and country. Answer: We used a 96-well plate reader manufactured by Corona Electric Co., Ltd. (Ibaraki, Japan). This detail has been added to line 109 of the Methods section in the revised manuscript. 4. Line 134: CHX abbreviation was used without providing the full term when it was first introduced in the text. Answer: The full term for CHX (Cycloheximide) is now shown on line 87 of the Methods section in the revised manuscript. 5. Line 140: Version, city and country of ImageJ? Answer: The version of Imagej and the names of the city and country have been added to line 146-147 of the revised manuscript as follows: “ImageJ ver. 1.53v 21 (U.S. National Institutes of Health, Bethesda, Maryland, USA).” 6. Line 151: The amount of total RNA used to reverse-transcribed into cDNA was not mentioned. Answer: We used 200 ng of total RNA to create cDNA for all quantitative RT-PCRs. This information has been added to line 159 of the revised manuscript. 7. The experiment setting for gene expression in PCR assay was unclear: volume of reaction mix of PCR, thermal cycling condition, number of replicates, negative control, the validation or optimization of primers, etc. Answer: Detailed information on PCR assay conditions has been added to lines 159 - 176 of the revised manuscript as follows: “First strand cDNA was synthesized with the use of the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer's instructions in a final volume of 20 μl. The final cDNA fragments were diluted 10-fold before use in RT-PCR. Quantitative RT-PCR analyses were performed using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies Inc., Tokyo, Japan) and the AriaMX Real-time PCR system (Agilent Technologies Inc.). Each reaction contained 2.5 μL 10-fold diluted cDNA, 200 nM of each primer, and 1 × SYBR Green Master Mix, in a final volume of 10 μL. All reactions were performed in duplicate per cDNA sample. As a control for genomic DNA contamination, total RNA without reverse transcription was tested for each sample per gene. A no-template control was included in each run per gene. The thermal profile of the reaction was 95°C for 5 min activation and denaturation, followed by 40 cycles of 95°C for 10 sec, and 60°C for 10 sec. Finally, a melting curve was generated by increasing temperature starting from 65°C to 95°C to determine the specificity of the reactions. The quantification cycle number (Cq) was determined per reaction with Agilent AriaMx version 2.0. The primers used are listed in Table 1. The relative standard curve method was used to calculate the relative mRNA expression. mRNA expression levels were normalized to those of β-actin and glyceraldehyde-triphosphate dehydrogenase (GAPDH) mRNA. Data represent the results of three independent experiments, and each experiment was performed in triplicate.” 8. Line 157: Only one housekeeping gene was used (beta actin), which is insufficient and at least two housekeeping genes are require for in vitro experiments. Based on MIQE guideline for qPCR, normalization of samples obtained from in vitro experiments can be carried out against a panel (probably two or three) of housekeeping genes whose expression has been shown to be unaffected by experimental conditions. This information must be included in any publication. Refer to MIQE guideline 5th edition published in January 2022. http://www.econferences.de/miqe-talks/ Answer: As a suggestion, in addition to β-actin, normalization by GAPDH gene expression was performed. We have added content to line 175 of the Methods section in the revised manuscript, and the results of quantitative RT-PCR normalized by GAPDH were added to Fig.1D, Fig.3B, Fig.3D, and Fig.5D. There was no difference to the conclusions of the experiment with either normalization. 9. Line 194: What software was used to run the statistical analyses? Please report the software, version, company, city and country that developed. Answer: All statistical analyses were performed using JMP version 14.3 statistical software (SAS Institute Inc., Cary, NC, USA). This information has been added to line 214 of the revised manuscript. 10. Number of replicates was unclear in all assays used. Under the figure, it was mentioned three independent experiments were conducted. But the number of replicates in each experiment was unclear. Answer: All experiments were performed in triplicate, and this detail has been added to each figure legend. Results 1. Figure 2: What is the indicator for ‘A’? Abbreviations were not provided: SnMP, MTS. Answer: Figure 2 is composed of a single figure, so "A" has been removed, and the full terms SnMP and MTS have been added to the legend of Figure 2 (lines 286 - 288 of the revised manuscript). 2. Lines 252 – 254; lines 356 - 359 should be in the discussion rather than results. Answer: As the reviewer pointed out, we have moved lines 252-254 to lines 437 - 441 in the Discussion section of the revised manuscript as follows. “Cisplatin is a commonly utilized chemotherapeutic agent, and confers toxicity to various tissues, including the liver. Growing evidence indicates that the production of ROS induced by cisplatin can trigger oxidative stress, and even cause cell death [16-18, 38, 39]. Increased oxidative stress is one of the main mechanisms involved in cisplatin-induced hepatotoxicity, as indicated by both in vitro and in vivo studies [18].” Furthermore, we have removed lines 356 – 359 because the same description appears in lines 488- 492 of the Discussion section. 3. Figure 3D: The * is missing. What is the indication of the black colour bars vs white and grey bars? From the previous figure (Fig. 2), black bars indicate treatment with LPZ. Answer: Thank you for the careful review. We have added the * to the revised Figure 3F (Figure 3D in the original manuscript). There was confusing representation of the color of the bar in Figure 3. In the revised version, we have unified the bars for untreated samples to white and the bars for treated samples to black through the entire figure. 4. Line 288: ‘Fig. 4D…’ There is no section D in Figure 4. Answer: Apologies. We made a big mistake about Figure 4. Fig. 4D in the original manuscript has been corrected to Fig. 3F in the revised version. 5. Figure 4 is not cited in the text. Answer: Thank you for pointing this out. In the revised manuscript, Figure 4A is now cited on line 340 and Figure 4B is cited on line 344. Figure 5 is cited in the correct position on lines 367 - 371. 6. Line 331: ‘Nuclear fractions of the lansoprazole-treated cells were incubated in the presence or absence of λPPase…. (Fig. 5A)’. The figure is incorrectly cited in the text. It should be Fig. 4A. Same for Fig. 5B (line 361), it should be Figure 4B. Answer: Thank you for pointing this out. As indicated in the comment #5 above, we have corrected the mistakes. 7. Legend of Figure 5. The description for (B) and (C) has been wrongly presented. Please revise accordingly. Answer: We have corrected the legend of Figure 5. Discussion: 1. To include more limitations of the study. Answer: Thank you for your suggestions. In addition to the two points (second and fourth shown below) in the original version of the manuscript, we have added five limitations of this study to the Discussion section, for a total seven limitation, which are listed below. Lines 465- 467: “One limitation of this study, based on previous reports [32], is that sampling was conducted at 3 h after lansoprazole treatment, and stronger antioxidant activity could be observed if tested with a longer time course.” Lines 483- 485: “However, as a second limitation, our study could not demonstrate whether the p38 MAPK directly phosphorylates the Nrf2 in lansoprazole-treated cells. Further studies are required to define the direct association between p38 MAPK and Nrf2.” Lines 488- 491: “A third limitation is that the experiments were performed in only one cell line. Although lansoprazole caused exclusive p38 MAPK activation in RL34 cells, it is possible that other MAPK signaling pathways are activated in other cell types (e.g., human).” Lines 502- 506: “However, as a fourth limitation, this study did not detect a direct modification of the Keap1 protein by lansoprazole. Further studies are required to demonstrate whether the hepatoprotective effect of lansoprazole results from a direct inactivation of Keap1 or from the regulation of the Keap1 inactivation by other upstream factors.”　 Lines 512- 515: “As a fifth limitation, the present study could not determine whether the cytoprotective effect of lansoprazole was caused by acid-induced activation or metabolism by CYP emzymes, and this requires future investigation.” Lines 516 - 518: “The concentration of 100 μM lansorazole employed in this study is much higher than the maximum serum concentration in healthy adults given a single oral administration of 30 mg lansoprazole, which corresponds a sixth limitation.” Lines 525 - 528: “As a seventh limitation, lansoprazole is reported to have anti-inflammatory effects [19, 20], but the expression levels of inflammatory cytokines were not investigated in this study. Therefore, subsequent studies should focus on inflammatory cytokines and investigate gene expression levels, focusing on those downstream of Nrf2.” 2. To include the future applications or research direction of this study. Answer: Thank you for your suggestion. Based on this study, we have added the following to the Discussion section for future applications and research directions for lansoprazole. Lines 427- 429: “Lansoprazole is one of the most prescribed drugs worldwide, and consequently has well-established safety and efficacy. Therefore, lansoprazole is expected to expand its clinical application relatively quickly in the future as a treatment for liver diseases.”　 Lines 536- 542: “Oxidative stress is the cause of most liver diseases, and it is a plausible therapeutic target to prevent liver damage [58]. The induction of the antioxidant Nrf2 pathway may protect hepatic cells from oxidative stress and avoid the progression of disease. Various compounds have been postulated to increase Nrf2 activity, although an effective Nrf2 inducer is not currently available to counteract liver diseases. This study extended prior knowledge on the acid-independent effect of lansoprazole and provided novel insights into the mechanisms involved. Thus, lansoprazole may be a potential candidate for the treatment of liver diseases.” Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0287788.r003 Decision Letter 1 Yap Wei Hsum Academic Editor © 2023 Wei Hsum Yap 2023 Wei Hsum Yap https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version1 17 May 2023 PONE-D-22-35612R1Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathwayPLOS ONE Dear Dr. Yamagishi, Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process. Please submit your revised manuscript by Jul 01 2023 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file. Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'. A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'. An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'. If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter. If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols. We look forward to receiving your revised manuscript. Kind regards, Wei Hsum Yap Academic Editor PLOS ONE Journal Requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Additional Editor Comments: Dear authors, please include the following revisions: 1. There is no explanation for relationship between Nrf2, p38 and ERK1 in Introduction section Line 53-57. Please include justification on why these kinases are included in the current study. 2. Please include the final concentration or quantity of cDNA that was used in the reaction (Line 161-162) 3. Please include CHX abbreviations in Fig 1 caption - each diagram is independent, and should include info for abbreviated text within the image 4. Please change "single administration of" (Line 330) to cisplatin treatment group 5. Line 336-337 the sentence is ambiguous because Fig 1A is showing Western blot analysis instead of SDS-PAGE. Suggest rephrasing or removing the sentence to provide a better flow of explanation. [Note: HTML markup is below. Please do not edit.] [NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.] While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step. 10.1371/journal.pone.0287788.r004 Author response to Decision Letter 1 Submission Version2 8 Jun 2023 Journal requirements: Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice. Answer: We have carefully reviewed the references list and properly revised it, and we have ensured its correctness and completeness. Additional Editor Comments: Dear authors, please include the following revisions: 1. There is no explanation for relationship between Nrf2, p38 and ERK1 in Introduction section Line 53-57. Please include justification on why these kinases are included in the current study. Answer: We appreciate your comments and the opportunity to clarify these important points. The relationship between Nrf2 and MAPKs is described in lines 56 - 74 of the revised manuscript as follows: “Exposure of cells to Nrf2 inducers, like oxidative stress stimuli, activates Nrf2/ARE-mediated response through different intracellular signaling pathways. Mitogen-activated protein kinase (MAPK) pathways are known to regulate Nrf2/ARE-driven gene expression [12-14]. MAPKs are serine/threonine protein kinase that play a central role in the signaling cascade regulating cellular processes, such as cell proliferation, differentiation, and apoptosis. Three major MAPK subfamilies have been extensively studied: extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38 MAPK. Each kinase establishes, in principle, parallel and independent signaling pathways. Depending on the cellular and stimulatory context, there is often significant cross-talk between each of the kinases because they can respond to common upstream activators and phosphorylate common downstream targets. Alam et al. reported that cadmium-induced HO1 gene expression requires the sequential activation of the p38 MAPK pathway and Nrf2 in human breast cancer MCF-7 cells [12]. In contrast, in human hepatoblastoma HepG2 cells, JNK activated the induction of Nrf2/ARE-mediated gene expression by the overexpression of common upstream kinases, whereas p38 MAPK showed the opposite effects [13]. Additionally, exposure of HepG2 cells to the chemical pyrrolidine dithiocarbamate, the activation of both ERK1/2 and p38 MAPK are required for induction of the ARE-mediated γ-glutamylcysteine synthetase subunit genes [14]. Based on these observations, the capability of lansoprazole to upregulate expression of antioxidant genes via the MAPK/ARE/Nrf2 pathway was investigated using rat hepatic cells.” 2. Please include the final concentration or quantity of cDNA that was used in the reaction (Line 161-162) Answer: We used 2.5 μl per well (2.5 ng/reaction) of 10-fold diluted cDNA solution for all quantitative RT-PCR. This information has been added to lines 180 and 183 of the revised manuscript. 3. Please include CHX abbreviations in Fig 1 caption - each diagram is independent, and should include info for abbreviated text within the image Answer: We have added the abbreviation for CHX to Fig. 1 caption (Lines 283 - 284 of the revised manuscript). 4. Please change "single administration of" (Line 330) to cisplatin treatment group Answer: We have changed this to “cisplatin treatment group” (Line 352 of the revised manuscript). 5. Line 336-337 the sentence is ambiguous because Fig 1A is showing Western blot analysis instead of SDS-PAGE. Suggest rephrasing or removing the sentence to provide a better flow of explanation. Answer: Thank you for pointing this out. In the revised manuscript, lines 357 - 359 have been changed as follows: “The Nrf2 band was found to be upshifted in the nuclear fraction of the lansoprazole-treated cells (Fig. 1A) indicating that Nrf2 translocated to the nucleus underwent posttranscriptional modifications.” Attachment Submitted filename: Response to Reviewers.docx Click here for additional data file. 10.1371/journal.pone.0287788.r005 Decision Letter 2 Yap Wei Hsum Academic Editor © 2023 Wei Hsum Yap 2023 Wei Hsum Yap https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Submission Version2 13 Jun 2023 Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathway PONE-D-22-35612R2 Dear Dr. Yamagishi, We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements. Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication. An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org. If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org. Kind regards, Wei Hsum Yap Academic Editor PLOS ONE Additional Editor Comments (optional): Reviewers' comments: 10.1371/journal.pone.0287788.r006 Acceptance letter Yap Wei Hsum Academic Editor © 2023 Wei Hsum Yap 2023 Wei Hsum Yap https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 22 Jun 2023 PONE-D-22-35612R2 Lansoprazole protects hepatic cells against cisplatin-induced oxidative stress through the p38 MAPK/ARE/Nrf2 pathway Dear Dr. Yamagishi: I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org. If we can help with anything else, please email us at plosone@plos.org. Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staff on behalf of Dr. Wei Hsum Yap Academic Editor PLOS ONE ==== Refs References 1 Al-Sawaf O , Clarner T , Fragoulis A , Kan YW , Pufe T , Streetz K , et al . Nrf2 in health and disease: current and future clinical implications. Clin Sci (Lond). 2015;129 (12 ):989–99. doi: 10.1042/CS20150436 .26386022 2 Zhang HQ , Davies KJA , Forman HJ . Oxidative stress response and Nrf2 signaling in aging. Free Radic Biol Med. 2015;88 :314–36. doi: 10.1016/j.freeradbiomed.2015.05.036 .26066302 3 Liu J , Wu KC , Lu YF , Ekuase E , Klaassen CD . NRF2 protection against liver injury produced by various hepatotoxicants. Oxid Med Cell Longev. 2013;2013 :305861. doi: 10.1155/2013/305861 .23766851 4 Bataille AM , Manautou JE . Nrf2: a potential target for new therapeutics in liver disease. Clin Pharmacol Ther. 2012;92 (3 ):340–8. doi: 10.1038/clpt.2012.110 .22871994 5 Dinkova-Kostova AT , Holtzclaw WD , Cole RN , Itoh K , Wakabayashi N , Katoh Y , et al . Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc Natl Acad Sci U S A. 2002;99 (18 ):11908–13. doi: 10.1073/pnas.172398899 .12193649 6 Suzuki T , Yamamoto M . Molecular basis of the Keap1-Nrf2 system. Free Radic Biol Med. 2015;88 :93–100. doi: 10.1016/j.freeradbiomed.2015.06.006 .26117331 7 Wakabayashi N , Dinkova-Kostova AT , Holtzclaw WD , Kang M-I , Kobayashi A , Yamamoto M , et al . Protection against electrophile and oxidant stress by induction of the phase 2 response: fate of cysteines of the Keap1 sensor modified by inducers. Proc Acad Sci U S A. 2004;101 (7 ):2040–5. doi: 10.1073/pnas.0307301101 .14764894 8 Furukawa M , Xiong Y . BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol. 2005;25 (1 ):162–71. doi: 10.1128/MCB.25.1.162-171.2005 .15601839 9 Gong P , Stewart D , Hu B , Li N , Cook J , Nel A , et al . Activation of the mouse heme oxygenase-1 gene by 15-deoxy-Delta(12,14)-prostaglandin J(2) is mediated by the stress response elements and transcription factor Nrf2. Antioxid Redox Signal. 2002;4 (2 ):249–57. doi: 10.1089/152308602753666307 .12006176 10 Lee JM , Calkins MJ , Chan K , Kan YW , Johnson JA . Identification of the NF-E2-related factor-2-dependent genes conferring protection against oxidative stress in primary cortical astrocytes using oligonucleotide microarray analysis. J Biol Chem. 2003;278 (14 ):12029–38. doi: 10.1074/jbc.M211558200 .12556532 11 Satoh T , Okamoto SI , Cui J , Watanabe Y , Furuta K , Suzuki M , et al . Activation of the Keap1/Nrf2 pathway for neuroprotection by electrophilic [correction of electrophillic] phase II inducers. Proc Natl Acad Sci U S A. 2006;103 (3 ):768–73. doi: 10.1073/pnas.0505723102 .16407140 12 Alam J , Wicks C , Stewart D , Gong P , Touchard C , Otterbein S , et al . Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J Biol Chem. 2000;275 (36 ):27694–702. doi: 10.1074/jbc.M004729200 .10874044 13 Yu R , Chen C , Mo YY , Hebbar V , Owuor ED , Tan TH , et al . Activation of mitogen-activated protein kinase pathways induces antioxidant response element-mediated gene expression via a Nrf2-dependent mechanism. J Biol Chem. 2000;275 (51 ):39907–13. doi: 10.1074/jbc.M004037200 .10986282 14 Zipper LM , Mulcahy RT . Inhibition of ERK and p38 MAP kinases inhibits binding of Nrf2 and induction of GCS genes. Biochem Biophys Res Commun. 2000;278 (2 ):484–92. doi: 10.1006/bbrc.2000.3830 .11097862 15 Iseri S , Ercan F , Gedik N , Yuksel M , Alican I . Simvastatin attenuates cisplatin-induced kidney and liver damage in rats. Toxicology. 2007;230 (2–3 ):256–64. doi: 10.1016/j.tox.2006.11.073 .17196726 16 Liao Y , Lu X , Lu C , Li G , Jin Y , Tang H . Selection of agents for prevention of cisplatin-induced hepatotoxicity. Pharmacol Res. 2008;57 (2 ):125–31. doi: 10.1016/j.phrs.2008.01.001 .18282716 17 Marullo R , Werner E , Degtyareva N , Moore B , Altavilla G , Ramalingam SS , et al . Cisplatin induces a mitochondrial-ROS response that contributes to cytotoxicity depending on mitochondrial redox status and bioenergetic functions. Plos One. 2013;8 (11 ). doi: 10.1371/journal.pone.0081162 .24260552 18 Yu W , Chen Y , Dubrulle J , Stossi F , Putluri V , Sreekumar A , et al . Cisplatin generates oxidative stress which is accompanied by rapid shifts in central carbon metabolism. Sci Rep. 2018;8 (1 ):4306. doi: 10.1038/s41598-018-22640-y .29523854 19 Natale G , Lazzeri G , Lubrano V , Colucci R , Vassalle C , Fornai M , et al . Mechanisms of gastroprotection by lansoprazole pretreatment against experimentally induced injury in rats: role of mucosal oxidative damage and sulfhydryl compounds. Toxicol Appl Pharmacol. 2004;195 (1 ):62–72. doi: 10.1016/j.taap.2003.10.006 .14962506 20 Blandizzi C , Fornai M , Colucci R , Natale G , Lubrano V , Vassalle C , et al . Lansoprazole prevents experimental gastric injury induced by non-steroidal anti-inflammatory drugs through a reduction of mucosal oxidative damage. World J Gastroenterol. 2005;11 (26 ):4052–60. doi: 10.3748/wjg.v11.i26.4052 .15996031 21 Agnihotri N , Kaur H , Kaur N , Sarotra P . Role of oxidative stress in lansoprazole-mediated gastric and hepatic protection in Wistar rats. Indian J Gastroenterol. 2007;26 (3 ):118–21. .17704577 22 Tsuji S , Sun WH , Tsujii M , Kawai N , Kimura A , Kakiuchi Y , et al . Lansoprazole induces mucosal protection through gastrin receptor-dependent up-regulation of cyclooxygenase-2 in rats. J Pharmacol Exp Ther. 2002;303 (3 ):1301–8. doi: 10.1124/jpet.102.035204 .12438555 23 Takagi T , Naito Y , Okada H , Ishii T , Mizushima K , Akagiri S , et al . Lansoprazole, a proton pump inhibitor, mediates anti-inflammatory effect in gastric mucosal cells through the induction of heme oxygenase-1 via activation of NF-E2-related factor 2 and oxidation of kelch-like ECH-associating protein 1. J Pharmacol Exp Ther. 2009;331 (1 ):255–64. doi: 10.1124/jpet.109.152702 .19628634 24 Becker JC , Grosser N , Waltke C , Schulz S , Erdmann K , Domschke W , et al . Beyond gastric acid reduction: proton pump inhibitors induce heme oxygenase-1 in gastric and endothelial cells. BiBiochem Biophys. 2006;345 (3 ):1014–21. doi: 10.1016/j.bbrc.2006.04.170 .16712795 25 Schulz-Geske S , Erdmann K , Wong RJ , Stevenson DK , Schroder H , Grosser N . Molecular mechanism and functional consequences of lansoprazole-mediated heme oxygenase-1 induction. World J Gastroentel. 2009;15 (35 ):4392–401. doi: 10.3748/wjg.15.4392 .19764090 26 Suzuki M , Nakamura M , Mori M , Miura S , Tsuchiya M , Ishii H . Lansoprazole inhibits oxygen-derived free radical production from neutrophils activated by Helicobacter pylori. J Clin Gastroenterol. 1995;20 Suppl 2 :S93–6. doi: 10.1097/00004836-199506002-00025 .7594353 27 Higuchi K , Yoda Y , Amagase K , Kato S , Tokioka S , Murano M , et al . Prevention of NSAID-Induced Small Intestinal Mucosal Injury: Prophylactic Potential of Lansoprazole. J Clin Biochem Nutr. 2009;45 (2 ):125–30. doi: 10.3164/jcbn.SR09-58 .19794918 28 Yoda Y , Amagase K , Kato S , Tokioka S , Murano M , Kakimoto K , et al . Prevention by lansoprazole, a proton pump inhibitor, of indomethacin-induced small intestinal ulceration in rats through induction of heme oxygenase-1. J Physiol Pharmacol: an official journal of the Polish Physiological Society. 2010;61 (3 ):287–94. .20610858 29 Kuroda M , Yoshida N , Ichikawa H , Takagi T , Okuda T , Naito Y , et al . Lansoprazole, a proton pump inhibitor, reduces the severity of indomethacin-induced rat enteritis. Int J Mol Med. 2006;17 (1 ):89–93. .16328016 30 Bauer M , Bauer I . Heme oxygenase-1: redox regulation and role in the hepatic response to oxidative stress. Antioxid Redox Signal. 2002;4 (5 ):749–58. doi: 10.1089/152308602760598891 .12470502 31 Zhu X , Fan WG , Li DP , Kung H , Lin MC . Heme oxygenase-1 system and gastrointestinal inflammation: a short review. World J Gastroenterol. 2011;17 (38 ):4283–8. doi: 10.3748/wjg.v17.i38.4283 .22090784 32 Yamashita Y , Ueyama T , Nishi T , Yamamoto Y , Kawakoshi A , Sunami S , et al . Nrf2-Inducing Anti-Oxidation Stress Response in the Rat Liver—New Beneficial Effect of Lansoprazole. Plos One. 2014;9 (5 ). doi: 10.1371/journal.pone.0097419 .24846271 33 Nishi T , Yamamoto Y , Yamagishi N , Iguchi M , Tamai H , Ito T , et al . Lansoprazole prevents the progression of liver fibrosis in non-alcoholic steatohepatitis model rats. Journal of Pharmacy and Pharmacology. 2018;70 (3 ):383–92. doi: 10.1111/jphp.12870 .29355950 34 Zhang DD , Hannink M . Distinct cysteine residues in Keap1 are required for Keap1-dependent ubiquitination of Nrf2 and for stabilization of Nrf2 by chemopreventive agents and oxidative stress. Mol Cell Biol. 2003;23 (22 ):8137–51. doi: 10.1128/MCB.23.22.8137-8151.2003 .14585973 35 McMahon M , Itoh K , Yamamoto M , Hayes JD . Keap1-dependent proteasomal degradation of transcription factor Nrf2 contributes to the negative regulation of antioxidant response element-driven gene expression. J Biol Chem. 2003;278 (24 ):21592–600. doi: 10.1074/jbc.M300931200 .12682069 36 English JM , Cobb MH . Pharmacological inhibitors of MAPK pathways. Trends Pharmacol Sci. 2002;23 (1 ):40–5. doi: 10.1016/s0165-6147(00)01865-4 .11804650 37 Khaleel SA , Alzokaky AA , Raslan NA , Alwakeel AI , Abd El-Aziz HG , Abd-Allah AR . Lansoprazole halts contrast induced nephropathy through activation of Nrf2 pathway in rats. Chem Biol Interact. 2017;270 :33–40. doi: 10.1016/j.cbi.2017.04.010 .28412091 38 Koc A , Duru M , Ciralik H , Akcan R , Sogut S . Protective agent, erdosteine, against cisplatin-induced hepatic oxidant injury in rats. Mol Cell Biochem. 2005;278 (1–2 ):79–84. doi: 10.1007/s11010-005-6630-z .16180092 39 Naziroglu M , Karaoglu A , Aksoy AO . Selenium and high dose vitamin E administration protects cisplatin-induced oxidative damage to renal, liver and lens tissues in rats. Toxicology. 2004;195 (2–3 ):221–30. doi: 10.1016/j.tox.2003.10.012 .14751677 40 Taguchi K , Kensler TW . Nrf2 in liver toxicology. Arch Pharm Res. 2020;43 (3 ):337–49. doi: 10.1007/s12272-019-01192-3 .31782059 41 Tian Y , Song W , Xu D , Chen X , Li X , Zhao Y . Autophagy induced by ROS aggravates testis oxidative damage in diabetes via breaking the feedforward loop linking p62 and Nrf2. Oxid Med Cell Longev. 2020;2020 :7156579. doi: 10.1155/2020/7156579 .32509151 42 Qu Z , Sun J , Zhang W , Yu J , Zhuang C . Transcription factor NRF2 as a promising therapeutic target for Alzheimer’s disease. Free Radic Biol Med. 2020;159 :87–102. doi: 10.1016/j.freeradbiomed.2020.06.028 .32730855 43 Hayes JD , McMahon M , Chowdhry S , Dinkova-Kostova AT . Cancer chemoprevention mechanisms mediated through the Keap1-Nrf2 pathway. Antioxid Redox Signal. 2010;13 (11 ):1713–48. doi: 10.1089/ars.2010.3221 .20446772 44 Jaiswal AK . Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radic Biol Med. 2004;36 (10 ):1199–207. doi: 10.1016/j.freeradbiomed.2004.02.074 .15110384 45 Kaspar JW , Niture SK , Jaiswal AK . Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic Biol Med. 2009;47 (9 ):1304–9. doi: 10.1016/j.freeradbiomed.2009.07.035 .19666107 46 Zipper LM , Mulcahy RT . Erk activation is required for Nrf2 nuclear localization during pyrrolidine dithiocarbamate induction of glutamate cysteine ligase modulatory gene expression in HepG2 cells. Toxicol Sci. 2003;73 (1 ):124–34. doi: 10.1093/toxsci/kfg083 .12657749 47 Chen HH , Wang TC , Lee YC , Shen PT , Chang JY , Yeh TK , et al . Novel Nrf2/ARE activator, trans-Coniferylaldehyde, induces a HO-1-mediated defense mechanism through a dual p38α/MAPKAPK-2 and PK-N3 signaling pathway. Chem Res Toxicol. 2015;28 (9 ):1681–92. doi: 10.1021/acs.chemrestox.5b00085 .26275128 48 Bryan HK , Olayanju A , Goldring CE , Park BK . The Nrf2 cell defence pathway: Keap1-dependent and -independent mechanisms of regulation. Biochem Pharmacol. 2013;85 (6 ):705–17. doi: 10.1016/j.bcp.2012.11.016 .23219527 49 Keum YS , Yu S , Chang PP , Yuan X , Kim JH , Xu C , et al . Mechanism of action of sulforaphane: inhibition of p38 mitogen-activated protein kinase isoforms contributing to the induction of antioxidant response element-mediated heme oxygenase-1 in human hepatoma HepG2 cells. Cancer Res. 2006;66 (17 ):8804–13. doi: 10.1158/0008-5472.CAN-05-3513 .16951197 50 Yuan X , Xu C , Pan Z , Keum YS , Kim JH , Shen G , et al . Butylated hydroxyanisole regulates ARE-mediated gene expression via Nrf2 coupled with ERK and JNK signaling pathway in HepG2 cells. Mol Carcinog. 2006;45 (11 ):841–50. doi: 10.1002/mc.20234 .16739127 51 Nguyen T , Sherratt PJ , Huang HC , Yang CS , Pickett CB . Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J Biol Chem. 2003;278 (7 ):4536–41. doi: 10.1074/jbc.M207293200 .12446695 52 Yu R , Lei W , Mandlekar S , Weber MJ , Der CJ , Wu J , et al . Role of a mitogen-activated protein kinase pathway in the induction of phase II detoxifying enzymes by chemicals. J Biol Chem. 1999;274 (39 ):27545–52. doi: 10.1074/jbc.274.39.27545 .10488090 53 Landes BD , Petite JP , Flouvat B . Clinical pharmacokinetics of lansoprazole. Clin Pharmacokinet. 1995;28 (6 ):458–70. doi: 10.2165/00003088-199528060-00004 .7656504 54 Shin JM , Kim N . Pharmacokinetics and pharmacodynamics of the proton pump inhibitors. J Neurogastroenterol Motil. 2013;19 (1 ):25–35. doi: 10.5056/jnm.2013.19.1.25 .23350044 55 Simon WA , Sturm E , Hartmann HJ , Weser U . Hydroxyl radical scavenging reactivity of proton pump inhibitors. Biochem Pharmacol. 2006;71 (9 ):1337–41. doi: 10.1016/j.bcp.2006.01.009 .16494850 56 Biswas K , Bandyopadhyay U , Chattopadhyay I , Varadaraj A , Ali E , Banerjee RK . A novel antioxidant and antiapoptotic role of omeprazole to block gastric ulcer through scavenging of hydroxyl radical. J Biol Chem. 2003;278 (13 ):10993–1001. doi: 10.1074/jbc.M210328200 .12529378 57 Ramos-Tovar E , Muriel P . Free radicals, antioxidants, nuclear factor-E2-related factor-2 and liver damage. J Appl Toxicol. 2020;40 (1 ):151–68. doi: 10.1002/jat.3880 .31389060