==== Front Rev Bras Ginecol Obstet Rev Bras Ginecol Obstet 10.1055/s-00030576 RBGO Gynecology & Obstetrics 0100-7203 1806-9339 Thieme Revinter Publicações Ltda Rio de Janeiro, Brazil 32559790 10.1055/s-0040-1710299 200019 Original Article Obstetrics/High Risk Pregnancy Antibiotic Susceptibility Patterns and Prevalence of Streptococcus Agalactiae Rectovaginal Colonization Among Pregnant Women in Iran http://orcid.org/0000-0001-8252-4841 Dashtizade Mina 1 http://orcid.org/0000-0001-8261-0512 Zolfaghari Mohammad Reza 1 http://orcid.org/0000-0001-5588-5385 Yousefi Masoud 2 http://orcid.org/0000-0003-4770-5836 Nazari-Alam Ali 3 1 Department of Microbiology, Qom Branch, Islamic Azad University, Qom, Iran 2 Birjand Infectious Diseases Research Center, Department of Microbiology, Faculty of Medicine, Birjand University of Medical Sciences, Birjand, Iran 3 Department of Microbiology, Faculty of Medicine, Kashan University of Medical Sciences, Kashan, Iran Address for correspondence Ali Nazari-Alam, Assistant Professor Department of Microbiology, Faculty of Medicine, Kashan University of Medical SciencesKashanIrannazarialam-a@kaums.ac.ir 19 6 2020 8 2020 1 6 2020 42 8 454459 21 1 2020 10 3 2020 The Author(s). This is an open access article published by Thieme under the terms of the Creative Commons Attribution License, permitting unrestricted use, distribution, and reproduction so long as the original work is properly cited. ( https://creativecommons.org/licenses/by/4.0/ ). 2020 The Author(s). https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Objective   Streptococcus agalactiae is an important pathogen in neonates and pregnant women. Neonatal invasive infections due to S. agalactiae are life-threatening and preventive strategies for this challenge of human have become a concern. The aim of the present study was to determine the prevalence of rectovaginal colonization, related risk factors and antibiotic resistance pattern of S. agalactiae among pregnant women in Iran. Methods  The present study was performed on 240 pregnant women. Vaginal and rectal swabs were obtained from all of the women and then were transferred to the laboratory. The isolation and identification of S. agalactiae was performed by standard microbiological tests and polymerase chain reaction (PCR) assay. The antimicrobial susceptibility patterns of the isolates were determined by the Kirby-Bauer disk diffusion. Polymerase chain reaction was used to detect ermB and mefA genes in erythromycin-nonsusceptible isolates. Results  Out of 240 pregnant women, 16 cases (6.7%) were colonized by S. agalactiae . There is no significant association between demographic-obstetric factors and maternal S. agalactiae colonization in the pregnant women. Linezolid, vancomycin and ampicillin were the most effective antibiotics against S. agalactiae . The ermB gene was present in 6 (35.29%) S. agalactiae isolates. However, the mefA gene was not detected in any of the isolates. Conclusion  Given the relatively significant prevalence of S. agalactiae colonization in the pregnant women in the present study and the risk of serious neonatal infections, the screening of pregnant mothers for the bacteria seems necessary. Our findings highlight the importance of appropriate antibiotic prophylaxis during pregnancy for the prevention of early onset S. agalactiae -neonatal infection and comorbidity. Keywords Streptococcus agalactiae pregnant women antibiotic resistance risk factors polymerase chain reaction ==== Body pmcIntroduction Streptococcus agalactiae (Group B Streptococcus [GBS]) is considered as the dominant pathogen in causing septicemia and meningitis in infants < 3 months old. Neonatal invasive infections due to S. agalactiae are life-threatening and preventive strategies for this challenge of human have become a concern. 1 2 As an important opportunistic human pathogen, GBS can be colonized in the rectovaginal area of women and subsequently transmitted to the neonates in the womb or during labor. The rate of GBS colonization among pregnant women varies with ethnic group, marital status, number of deliveries, geographic area and age. 3 4 It is noteworthy that ∼ between 10 and 30% of women during pregnancy are colonized with S. agalactiae in the vagina and 60% of their infants acquire the bacteria through the birth canal. 5 6 Identification of maternal GBS colonization during pregnancy is important for taking preventive measures to control neonatal diseases. 1 2 The Centers for Disease Control and Prevention (CDC), in order to reduce the incidence of neonatal GBS diseases, recommends the use of intrapartum antibiotic prophylaxis in pregnant women with rectovaginal colonization of GBS. However, the widespread adoption of intrapartum antibiotic prophylaxis for prevention of invasive early-onset GBS disease has led to an increase in concerns regarding the emergence of antibiotic resistance among GBS strains. So, the antibacterial susceptibility data of maternal colonizing GBS strains are essential to selective intrapartum antibiotic prophylaxis and minimize the emergence of bacterial resistance, which is causing increasing numbers of treatment failures. 7 8 9 Given the importance of universal screening of mothers for rectovaginal GBS colonization and achieving appropriate intrapartum antibiotic prophylaxis for all screen-positive women to prevent early-onset GBS-related diseases, the aim of the present study was to investigate the prevalence and related risk factors of GBS rectovaginal colonization in pregnant women as well as the antimicrobial susceptibility pattern of the isolates. Methods Study Population and Sampling Procedure The present cross-sectional study was conducted among 240 pregnant women with gestational age of between 35–37 weeks referred to the Kashan Shahid Beheshti Hospital from January to September 2017. After receiving permission from the Ethics Committee of Kashan University of Medical Sciences (IR.KAUMS.PEC.1394.151), sociodemographic and clinical data were collected using a structured questionnaire. Samples were taken using two sterile cotton swabs from the vaginal and rectal area according to the CDC and American College of Obstetricians and Gynecologists (ACOG) guidelines, 9 10 and inoculated directly into Todd-Hewitt broth (THB) (Merck & Co., Kenilworth, NJ, USA) supplemented with gentamicin (8 μg/ml) and nalidixic acid (15 μg/ml) (Sigma Aldrich, St. Louis, Missouri, USA), then were immediately transported to the microbiology laboratory within 2 hours of collection. Phenotypic Identification of Group B Streptococci The broth media were incubated for between 18 and 24 hours at between 35–37°C and inoculated on 5% sheep blood agar (SBA) (Merck & Co., Kenilworth, NJ, USA) and incubated overnight in 5% CO2 atmosphere for between 18–24 hours. Finally, suspected GBS colonies (pink colonies, with narrow β-hemolysis) were identified by conventional microbiological and biochemical methods, including Gram stain, catalase test, bacitracin and sulfamethoxazole-trimethoprim (SXT) susceptibility tests, hippurate hydrolysis test (Mast Group Ltd, Bootle, UK), and Christie, Atkins, and Munch-Peterson (CAMP) test. 9 11 PCR Confirmation of GBS Isolates The PCR assays were used to confirm the diagnosis of GBS isolates by detecting the dltS target gene ( Table 1 ). Genomic DNA was extracted from pure cultures of the strains using High Pure PCR Template Preparation Kit (Roche, Basel, Switzerland) according to the instructions of the manufacturer. Polymerase chain reaction was conducted on the summation of all volumes consisting of 25 μL (12.5 μL of 2× Hot Star Taq Master Mix, 1 μL of the DNA template, 1 μL of each primer [50 pmol/μl] and 9.5 μL of ddH2O) using the Hot Star Taq Master Mix kit (SinaClon, Tehran, Iran). Settings for the reaction were as follows: initial denaturation step at 94°C for 5 minutes; 35 amplification cycles each for 30 seconds at 94°C, 30 1 minute at 55°C and 1 minute at 72°C. This was followed by an additional extension step of 10 minutes at 72°C. The PCR product of the dltS gene was electrophoresed on 1% agarose gel containing 1x RedSafe DNA stain (Intron Biotechnology, Seoul, South Korea). Table 1 Target genes and their primers used in the present study Primer Sequence (5′-3′) Products sizes (bp) Annealing (°C) Ref. dltS Fw- AGGAATACCAGGCGATGAAC Rv- TGCTCTAATTCTCCCCTTATGGC 952 55 (7) ermB Fw- CGACGAAACTGGCTAAAATA Rv- AATTGCTGAATCGAGACTTG 331 58 Present Study mefA Fw- GGTGTGCTAGTGGATCGTC Rv- GTAACCGCATTGAGAGCCG 188 53 Present Study Antibiotic Susceptibility Testing The antibiotic resistance profile of the isolates was determined by the Kirby-Bauer disk-diffusion method on Muller-Hinton agar (MHA) (Merck & Co., Kenilworth, NJ, USA) with 5% sheep's blood, and the results were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines. 12 The antimicrobial agents (Mast Group Ltd, Bootle, UK) tested in the present study included ampicillin (10 μg), vancomycin (30 μg), erythromycin (15 μg), clindamycin (2 μg), levofloxacin (5 μg), chloramphenicol (30 μg), cefepime (30 μg), and linezolid (30 μg). Streptococcus pneumoniae ATCC 49619 was used for quality control of antibiotic susceptibility testing. Detection of Erythromycin Resistance Genes In the present study, due to the high rates of resistance to erythromycin in GBS, the mechanism of resistance to this antibiotic was studied with detection of ermB and mefA genes by PCR. The PCR was performed in the total volume of 25 μl (12.5 μl of 2x Hot Star Taq Master Mix, 1 μl of the DNA template, 1 μl of each primer [50 pmol/μl] and 9.5 μl of ddH2O) utilizing the Hot Star Taq Master Mix kit (SinaClon, Tehran, Iran). DNA amplification was performed in a thermocycler (Eppendorf, Hamburg, Germany) with an initial denaturation step at 95°C for 5 minutes, 30 amplification cycles each with 30 seconds at 95°C; 30 seconds at different temperatures for the various genes ( Table 1 ); and 40 seconds at 72°C, followed by an additional extension step of 7 minutes at 72°C. The amplified products were electrophoresed on 1.5% gel agarose containing 1x RedSafe DNA stain (Intron Biotechnology, Seoul, South Korea). Sequencing of amplicons was done by the Bioneer Company (Daejeon, South Korea). The BLAST program from the national center for biotechnology information (NCBI) Web site ( http://www.ncbi.nlm.nih.gov/BLAST ) was used to analyze the nucleotide sequences. Statistical Analysis The data were analyzed with the Pearson chi-squared and the Fisher exact tests, using SPSS Statistics for Windows, Version 21.0 (IBM Corp. Armonk, NY, USA), to evaluate the statistical significance of associations between potential variables. P-values < 0.05 were considered to be significant. Results In the present study, a total of 240 pregnant women (from 35 to 37 weeks of gestation) were enrolled. The mean age of the participants was 26.9 ± 4.41 years old, with the youngest being 16 and the oldest 45 years old. GBS Colonization and Related Risk Factors The results indicated that 16 (6.7%) among the 240 pregnant women screened were colonized by S. agalactiae in their rectovaginal area. Of the 16 colonized patients, 8 had strains cultured only from vaginal swabs (50%), while 5 had strains isolated only from rectal swabs (31.25%) and another 3 had strains isolated simultaneously from both the vaginal and rectal swabs (18.75%). Overall, the GBS vaginal and rectal colonization rates were 4.58% and 3.33% respectively, while concomitant rectovaginal colonization rate was reported as 1.25%. The sociodemographic and pregnancy-related characteristics of the pregnant women and their relationship with maternal rectovaginal colonization of GBS are summarized in Tables 2 and 3 . Statistical analysis results showed that there was no significant association between demographic-obstetric factors and colonization of the maternal rectovaginal region with GBS. Table 2 Association between sociodemographic factors and GBS colonization among pregnant women Variables Frequency n(%) Culture positive n(%) p-value Age group (years old) 0.494  20 ≤ 12 (5) 2 (16.7)  21–30 116 (48.3) 6 (5.2)  31–35 72 (30) 5 (6.9)  36–45 40 (16.7) 3 (7.5) Education 0.929  Illiterate 53 (22.1) 3 (5.7)  Pre-high school 35 (14.6) 2 (5.7)  High school 93 (38.8) 6 (6.5)  College 59 (24.6) 5 (8.5) Occupation 0.676  Housewife 218 (90.8) 15 (6.9)  Employed 22 (9.2) 1 (4.5) Ethnicity groups 0.541  Iranian 214 (89.2) 15 (7)  Afghan 26 (10.8) 1 (3.8) Table 3 Association between pregnancy-related characteristics and Group B Streptococcus colonization among pregnant women Variables Frequency n(%) Culture positive n(%) p-value Gravidity 0.137  Primigravida 79 (32.9) 8 (10.1)  Multigravida 161 (67.1) 8 (5) Type of delivery 0.251  Without delivery 77 (32.1) 8 (10.4)  Vaginal 86 (35.8) 5 (5.8)  Cesarean 77 (32.1) 3 (3.9) History of Abortion 0.155  Yes 67 (27.9) 2 (3)  No 173 (72.1) 14 (8.1) Contraceptive methods 0.777  None 45 (18.8) 5 (11.1)  Withdrawal 124 (51.7) 6 (4.8)  Condom 51 (21.3) 4 (7.8)  DMPA* injection 16 (6.7) 1 (6.3)  OCP** 2 (0.8) 0 (0)  IUD*** 2 (0.8) 0 (0) Vaginal infection 0.752  Yes 99 (41.3) 6 (6.1)  No 141 (58.8) 10 (7.1) Abbreviations: DMPA, depomedroxyprogesterone acetate; IUD, intrauterine device; OCP, oral contraceptive pills. Antibiotic Susceptibility The results of antimicrobial susceptibility testing also showed that GBS isolates isolated from pregnant women was susceptible mainly to linezolid (100%), vancomycin (100%), and ampicillin (89.5%) ( Table 4 ). The intermediate antimicrobial resistance of GBS was 15.8% against erythromycin, 10.5% against ampicillin and levofloxacin, and 5.3% against clindamycin. It is noteworthy that the highest antibiotic resistance of GBS was related to erythromycin (73.7%). Table 4 Antimicrobial susceptibility pattern of Group B Streptococcus isolates from pregnant women Antibiotics Susceptible (%) Intermediate (%) Resistant (%) Erythromycin 2 (10.5) 3 (15.8) 14 (73.7) Clindamycin 8 (42.1) 1 (5.3) 10 (52.6) Ampicillin 17 (89.5) 2 (10.5) 0 (0) Chloramphenicol 11 (57.9) 0 (0) 8 (42.1) Levofloxacin 13 (68.4) 2 (10.5) 4 (21.1) Cefepime 13 (68.4) 0 (0) 6 (31.6) Linezolid 19 (100) 0 (0) 0 (0) Vancomycin 19 (100) 0 (0) 0 (0) Prevalence of Erythromycin Resistance Genes In the present study, the mechanism of resistance to erythromycin in the GBS isolates was studied with detection of ermB and mefA genes. The ermB gene was identified in 6 (35.29%) erythromycin nonsusceptible isolates. However, the mefA gene was not detected in any of the isolates. Discussion In the last few decades, GBS has gained importance due to its implication in adverse obstetric outcomes, and its ability to cause serious neonatal infections. Epidemiological studies have revealed that GBS-colonized pregnant women are > 25 times more likely to deliver infants with early-onset GBS disease. 13 14 In the present study, the overall prevalence of GBS colonization among pregnant women was found to be 6.7%. This finding was slightly lower than many other reports in Iran 15 16 17 and other developing countries such as Ethiopia (7.2%), Turkey (8%), China (7.1%) and Korea (8.3%), 13 18 19 20 but higher than those reported in India (2.3%) and Taiwan (6.2%). 3 21 However, there are reports of higher rates of GBS colonization compared with our study from Tanzania (23%), Taiwan (21.8%) and Brazil (28.4%). 14 22 23 These disparities could be explained by the fact that rates of maternal GBS colonization during pregnancy varies in the worldwide population, possibly due to differences in the studied populations (in terms of age, ethnic group, socioeconomic status, sexual behavior and geographic areas), method of sample collection and the diagnostic techniques. It is noteworthy that in the present study the GBS vaginal and rectal colonization rates were 4.58% and 3.33%, respectively, while concomitant rectovaginal colonization rate was reported as 1.25%. This finding was almost similar with other studies 3 7 14 and reveals that multisite swabbing may be important in identifying GBS colonization. Knowledge about the risk factors associated with GBS colonization during pregnancy can be important in reducing the incidence of maternal GBS infections and related neonatal morbidity and mortality. 24 25 The results of our study showed that there is no significant association between demographic-obstetric factors and maternal GBS colonization in pregnant women. Similar findings have been reported in studies conducted elsewhere. 24 26 27 28 However, in most other studies, the GBS colonization rate has been associated with some sociodemographic and pregnancy-related characteristics of the pregnant women. 3 5 14 16 This might be due to the small sample size in the present study. Finally, it was noteworthy in our study that primigravida women were more often associated with GBS colonization, though it was not statistically significant. Similar findings have been reported in studies from Ethiopia, Nigeria, Brazil and India. 5 24 25 29 30 However, in other studies, the GBS colonization rate was significantly higher in multigravida compared with primigravida women. 3 20 31 This difference may be due to geographical variation and shows that further studies are needed to confirm the correlation between gravidity and GBS colonization among pregnant women in different geographical locations. Chemoprophylaxis remains the most effective means to prevent GBS maternal and neonatal infections. 9 13 The GBS strains isolated in the present study showed higher susceptibility to linezolid, vancomycin, and ampicillin. These results are consistent with the CDC clinical guidelines for the use of penicillin and ampicillin as the drugs of choice in prevention or treatment of GBS infections. 5 24 Furthermore, similar results were reported by other studies with high susceptibility rates of GBS strains to amoxicillin, linezolid and vancomycin. 7 32 33 It is noteworthy that clindamycin and erythromycin were recommended as antibiotic alternatives for penicillin-allergic women at high risk for anaphylaxis. However, recent reports had raised global concerns about increasing emergence of antimicrobial resistance to these antibiotics in GBS isolates. In the present study, the rates of resistance to erythromycin and clindamycin were reported as 73.7% and 52.6%, respectively. However, the erythromycin resistance rate among GBS isolates in the present study was relatively higher when compared with other studies in Iran, 34 35 36 but the high rates of resistance to erythromycin in GBS were reported in China (92.5% and 84.6%), Iraq (58.6%) and the USA (50.7%). 37 38 39 40 Furthermore, high resistance rates of GBS strains to clindamycin were reported from Iran (92.2%) and other countries such as China (55.7% and 87.5%), Iraq (45.6%) and Italy (32.20%). 19 37 39 41 It is noteworthy that the high rate of erythromycin and clindamycin resistance in GBS strongly supports the CDC recommendations for susceptibility testing of GBS isolates before initiating prophylaxis with erythromycin or clindamycin. Finally, the results of the present study showed that the ermB gene was present in 35.29% of GBS erythromycin-nonsusceptible isolates. However, the mefA gene was not detected in any of the isolates. Similar findings have been reported in other studies, in which the methylation of target encoded by ermB genes was one of the commonest mechanisms of resistance to erythromycin in GBS isolates. 23 42 In addition, in some studies similar to our study, the mefA gene has not been identified in erythromycin-resistant GBS isolates. 23 43 This result implies that there are additional mechanisms involved with erythromycin resistance, which require further investigation. Conclusion Given the relatively significant prevalence of S. agalactiae colonization in the pregnant women of the present study and the risk of serious neonatal infections, the screening of pregnant mothers for the bacteria seems necessary. Our findings highlight the importance of appropriate antibiotic prophylaxis during pregnancy for the prevention of early onset S. agalactiae -neonatal infection and comorbidity. It is noteworthy, considering the increasing concern about emergence of antimicrobial resistance to erythromycin and clindamycin as antibiotic alternatives in GBS isolates, that the susceptibility testing of the isolates before initiating prophylaxis with these antibiotics is recommended. Finally, further studies are needed to assess the correlation between different risk factors and maternal GBS colonization during pregnancy in various geographical locations. Acknowledgments This research was supported by the Islamic Azad University, Qom, Iran. The authors would like to express their deepest gratitude to the microbiology laboratory staff of the Kashan University of Medical Sciences, Kashan, Iran. Contributions Conflict of Interests The authors have no conflict of interests to declare. Nazari-Alam A. and Zolfaghari M. R. designed the study, collected the data, and revised the manuscript. Dashtizade M. collected the data and revised the manuscript. Yousefi M. wrote the draft manuscript and edited the paper. All authors read and approved the final manuscript. ==== Refs References 1 Le Doare K Heath P T An overview of global GBS epidemiology Vaccine 2013 31 04 D7 D12. Doi: 10.1016/j.vaccine.2013.01.00923973349 2 Teatero S Ferrieri P Martin I Demczuk W McGeer A Fittipaldi N Serotype distribution, population structure and antimicrobial resistance of Group B Streptococcus strains recovered from colonized pregnant women J Clin Microbiol 2017 55 02 412 422. Doi: 10.1128/JCM.01615-1627852675 3 Sharmila V Joseph N M Arun Babu T Chaturvedula L Sistla S Genital tract group B streptococcal colonization in pregnant women: a South Indian perspective J Infect Dev Ctries 2011 5 08 592 595. Doi: 10.3855/jidc.155121841303 4 Kolter J Henneke P Codevelopment of microbiota and innate immunity and the risk for group B streptococcal disease Front Immunol 2017 8 1497. Doi: 10.3389/fimmu.2017.0149729209311 5 Assefa S Desta K Lema T Group B streptococci vaginal colonization and drug susceptibility pattern among pregnant women attending in selected public antenatal care centers in Addis Ababa, Ethiopia BMC Pregnancy Childbirth 2018 18 01 135. Doi: 10.1186/s12884-018-1791-429728084 6 Yook J H Kim M Y Kim E J Yang J H Ryu H-M Oh K Y Risk factors associated with group B streptococcus resistant to clindamycin and erythromycin in pregnant korean women Infect Chemother 2013 45 03 299 307. Doi: 10.3947/ic.2013.45.3.29924396631 7 Nkembe N M Kamga H G Baiye W A Chafa A B Njotang P N Streptococcus agalactiae prevalence and antimicrobial susceptibility pattern in vaginal and anorectal swabs of pregnant women at a tertiary hospital in Cameroon BMC Res Notes 2018 11 01 480. Doi: 10.1186/s13104-018-3589-x30012198 8 Taylor J K Hall R W Dupre A R The incidence of group B streptococcus in the vaginal tracts of pregnant women in central Alabama Clin Lab Sci 2002 15 01 16 17 12778951 9 Division of Bacterial Diseases, National Center for Immunization and Respiratory Diseases, Centers for Disease Control and Prevention (CDC) Verani J R McGee L Schrag S J Prevention of perinatal group B streptococcal disease--revised guidelines from CDC, 2010 MMWR Recomm Rep 2010 59 (RR-10):1 36 10 Committee Opinion No. 485: prevention of early-onset group B streptococcal disease in newborns: correction Obstet Gynecol 2018 131 02 397. Doi: 10.1097/AOG.0000000000002466 11 Luce E Koneman's color atlas and textbook of diagnostic microbiology, 6th edition [book review] Plast Reconstr Surg 2010 125 01 414 415. Doi: 10.1097/01.prs.0000358868.74684.60 12 Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing. 27th ed Wayne CLSI 2017(CLSI Supplement M100) 13 Woldu Z L Teklehaimanot T G Waji S T Gebremariam M Y The prevalence of Group B Streptococus recto-vaginal colonization and antimicrobial susceptibility pattern in pregnant mothers at two hospitals of Addis Ababa, Ethiopia Reprod Health 2014 11 01 80. Doi: 10.1186/1742-4755-11-8025476269 14 Melo S CCS Costa A B Silva F TRD Silva N MMG Tashima C M Cardoso R F Prevalence of Streptococcus agalactiae colonization in pregnant women from the 18th Health Region of Paraná State Rev Inst Med Trop São Paulo 2018 60 e2. Doi: 10.1590/s1678-994620186000229451592 15 Mashouf R Y Mousavi S M Rabiee S Alikhani M Y Arabestani M R Direct identification of Streptococcus agalactiae in vaginal colonization in pregnant women using polymerase chain reaction J Compr Pediatr. 2014 5 04 e23339. Doi: 10.17795/compreped-23339 16 Akbarian Rad Z Haghshenas Mojaveri M Esmaeilzadeh S Firouzjahi A Laegh M Khafri S Colonization of rectovaginal Escherichia coli and group B streptococci in mothers and on infants' body surface and their related risk factors Caspian J Pediatr. 2016 2 02 148 52. Doi: 10.22088/acadpub.BUMS.2.2.148 17 Emaneini M Jabalameli F van Leeuwen W B Beigverdi R Prevalence of group B Streptococcus in pregnant women in Iran: a systematic review and meta-analysis Pediatr Infect Dis J 2018 37 02 186 190. Doi: 10.1097/INF.000000000000171328767617 18 Barbaros I Murat C Mehmet V Tekirdag A I Can K Sukufe D The colonization incidence of group B streptococcus in pregnant women and their newborns in Istanbul Pediatr Int 2005 47 01 64 66. Doi: 10.1111/j.1442-200x.2004.02003.x15693869 19 Lu B Li D Cui Y Sui W Huang L Lu X Epidemiology of Group B streptococcus isolated from pregnant women in Beijing, China Clin Microbiol Infect 2014 20 06 O370 O373. Doi: 10.1111/1469-0691.1241624118553 20 Kim E J Oh K Y Kim M Y Seo Y S Shin J-H Song Y R Risk factors for group B streptococcus colonization among pregnant women in Korea Epidemiol Health 2011 33 e2011010. Doi: 10.4178/epih/e201101022111030 21 Yang M J Sun P L Wen K C Chao K C Chang W H Chen C Y Wang P H Prevalence of maternal group B streptococcus colonization and vertical transmission in low-risk women in a single institute J Chin Med Assoc 2012 75 01 25 28. Doi: 10.1016/j.jcma.2011.10.01122240533 22 Joachim A Matee M I Massawe F A Lyamuya E F Maternal and neonatal colonisation of group B streptococcus at Muhimbili National Hospital in Dar es Salaam, Tanzania: prevalence, risk factors and antimicrobial resistance BMC Public Health 2009 9 437. Doi: 10.1186/1471-2458-9-43719948075 23 Lee W T Lai M C High prevalence of Streptococcus agalactiae from vaginas of women in Taiwan and its mechanisms of macrolide and quinolone resistance J Microbiol Immunol Infect 2015 48 05 510 516. Doi: 10.1016/j.jmii.2014.03.00224767417 24 Mohammed M Asrat D Woldeamanuel Y Assegu D Prevalence of group B Streptococcus colonization among pregnant women attending antenatal clinic of Hawassa Health Center, Hawassa, Ethiopia Ethiop J Health Dev. 2012 26 01 36 42 25 Patil K Singla S Nagmoti M B Swamy M K Group B streptococci colonization in pregnant women: is screening necessary? J South Asian Fed Obstet Gynaecol. 2013 5 64 7. Doi: 10.5005/jp-journals-10006-1226 26 Collins T S Calderon M Gilman R H Vivar A Charache P Group B streptococcal colonization in a developing country: its association with sexually transmitted disease and socioeconomic factors Am J Trop Med Hyg 1998 59 04 633 636. Doi: 10.4269/ajtmh.1998.59.6339790443 27 Costa A LR Lamy Filho F Chein M BC Brito L MO Lamy Z C Andrade K L [Prevalence of colonization by group B Streptococcus in pregnant women from a public maternity of Northwest region of Brazil] Rev Bras Ginecol Obstet 2008 30 06 274 280. Doi: 10.1590/s0100-7203200800060000219142504 28 Zusman A S Baltimore R S Fonseca S NS Prevalence of maternal group B streptococcal colonization and related risk factors in a Brazilian population Braz J Infect Dis 2006 10 04 242 246. Doi: 10.1590/s1413-8670200600040000517293904 29 Onipede A Adefusi O Adeyemi A Adejuyigbe E Oyelese A Ogunniyi T Group B Streptococcus carriage during late pregnancy in Ile-Ife, Nigeria Afr J Clin Exp Microbiol. 2012 13 03 135 43. Doi: 10.4314/ajcem.v13i3.2 30 Simoes J A Alves V MN Fracalanzza S EL Camargo R PS Mathias L Milanez H MBP Brolazo E M Phenotypical characteristics of group B streptococcus in parturients Braz J Infect Dis 2007 11 02 261 266. Doi: 10.1590/S1413-8670200700020001917625774 31 Orrett F A Colonization with Group B streptococci in pregnancy and outcome of infected neonates in Trinidad Pediatr Int 2003 45 03 319 323. Doi: 10.1046/j.1442-200x.2003.01705.x12828589 32 Ji W Zhang L Guo Z Yang W Chen J Colonization prevalence and antibiotic susceptibility of Group B Streptococcus in pregnant women over a 6-year period in Dongguan, China PLoS One 2017 12 08 e0183083. Doi: 10.1371/journal.pone.018308328813477 33 Khan M A Faiz A Ashshi A M Maternal colonization of group B streptococcus: prevalence, associated factors and antimicrobial resistance Ann Saudi Med 2015 35 06 423 427. Doi: 10.5144/0256-4947.2015.42326657224 34 Khoshkhoutabar T Zand S Abtahi H Rafiei M Frequency and drug resistance of Group B Streptococcus in pregnant women in Markazi Province, Iran Med Lab J. 2015 8 04 75 80 35 Mousavi S M Nasaj M Hosseini S M Arabestani M R Survey of strain distribution and antibiotic resistance pattern of group B streptococci (Streptococcus agalactiae) isolated from clinical specimens GMS Hyg Infect Control 2016 11 Doc18. Doi: 10.3205/dgkh00027827648402 36 Daramroodi A K Keshavarzi F The investigation of antibiotic resistance and rapid detection of group B Streptococcus (Bca) from vaginal specimens of pregnant women by colony PCR method J Basic Res Med Sci. 2018 5 02 27 32. Doi: 10.29252/jbrms.5.2.27 37 Wang P Ma Z Tong J Zhao R Shi W Yu S Serotype distribution, antimicrobial resistance, and molecular characterization of invasive group B Streptococcus isolates recovered from Chinese neonates Int J Infect Dis 2015 37 115 118. Doi: 10.1016/j.ijid.2015.06.01926141418 38 Wang S Li L Wu B Wu W Serotype, genotype, and clinical manifestations of Group B Streptococcus (GBS) isolated from neonates in China Iran J Pediatr. 2018 28 01 e14580. Doi: 10.5812/ijp.14580 39 Hamid Z O Zaki N H Ali M R Prevalence of macrolide resistance genes among Group B Streptococci in pregnant women Int J Curr Microbiol Appl Sci. 2015 4 01 419 36 40 Back E E O'Grady E J Back J D High rates of perinatal group B Streptococcus clindamycin and erythromycin resistance in an upstate New York hospital Antimicrob Agents Chemother 2012 56 02 739 742. Doi: 10.1128/AAC.05794-1122143529 41 Matani C Trezzi M Matteini A Catalani C Messeri D Catalani C Streptococcus agalactiae: prevalence of antimicrobial resistance in vaginal and rectal swabs in Italian pregnant women Infez Med 2016 24 03 217 221 27668902 42 Bolukaoto J Y Monyama C M Chukwu M O Lekala S M Nchabeleng M Maloba M RB Antibiotic resistance of Streptococcus agalactiae isolated from pregnant women in Garankuwa, South Africa BMC Res Notes 2015 8 364. Doi: 10.1186/s13104-015-1328-026289147 43 Dogan B Schukken Y H Santisteban C Boor K J Distribution of serotypes and antimicrobial resistance genes among Streptococcus agalactiae isolates from bovine and human hosts J Clin Microbiol 2005 43 12 5899 5906. Doi: 10.1128/JCM.43.12.5899-5906.200516333073