==== Front MicroPubl Biol MicroPubl Biol microPublication Biology 2578-9430 Caltech Library 10.17912/micropub.biology.000871 WBPaper00065567 Materials and Reagents Negative Result Methods Expression Data Phenotype Data C. Elegans mScarlet and split fluorophore mScarlet resources for plasmid-based CRISPR/Cas9 knock-in in C. elegans Witten Gillian Investigation Methodology Resources 1 DeMott Ella Conceptualization Methodology Resources 1 Huang George Methodology Resources Validation 1 Zelasko Francis Investigation Resources 1 de Jesus Bailey Investigation Data curation 1 Mulchand Chandi Data curation Validation 1 Schuck Liam Investigation Resources 1 Pullman Stephen Data curation Project administration 1 Perez Amelie Methodology Resources 1 Mahableshwarkar Priya Investigation 1 Wu Zheng Investigation Formal analysis 2 Cardona Eric Andrew Conceptualization Supervision Formal analysis 2 Pierce Jonathan T Funding acquisition Conceptualization Formal analysis Writing - review & editing 2 Dickinson Daniel J Funding acquisition Writing - review & editing 3§ Doonan Ryan Investigation Methodology Formal analysis Conceptualization Project administration Supervision Writing - original draft 1§ 1 Glow Worms Stream, Freshman Research Initiative, College of Natural Sciences, The University of Texas at Austin, Austin, Texas, USA 2 Department of Neuroscience, The University of Texas at Austin, Austin, Texas, USA 3 Department of Molecular Biosciences, The University of Texas at Austin, Austin, Texas, USA Hastie Eric § Correspondence to: Daniel J Dickinson ( daniel.dickinson@austin.utexas.edu ) § Correspondence to: Ryan Doonan ( doonan@utexas.edu ) The authors declare that there are no conflicts of interest present. 14 6 2023 2023 2023 10.17912/micropub.biology.00087123 5 2023 30 5 2023 14 6 2023 Copyright: © 2023 by the authors 2023 https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Fluorescent proteins allow the expression of a gene and the behavior of its protein product to be observed in living animals. The ability to create endogenous fluorescent protein tags via CRISPR genome engineering has revolutionized the authenticity of this expression, and mScarlet is currently our first-choice red fluorescent protein (RFP) for visualizing gene expression in vivo . Here, we have cloned versions of mScarlet and split fluorophore mScarlet previously optimized for C. elegans into the SEC-based system of plasmids for CRISPR/Cas9 knock-in. Ideally, an endogenous tag will be easily visible while not interfering with the normal expression and function of the targeted protein. For low molecular weight proteins that are a fraction of the size of a fluorescent protein tag (e.g. GFP or mCherry) and/or proteins known to be non-functional when tagged in this way, split fluorophore tagging could be an alternative. Here, we used CRISPR/Cas9 knock-in to tag three such proteins with split-fluorophore wrmScarlet: HIS-72, EGL-1, and PTL-1. Although we find that split fluorophore tagging does not disrupt the function of any of these proteins, we were unfortunately unable to observe the expression of most of these tags with epifluorescence, suggesting that split fluorophore tags are often very limited as endogenous reporters. Nevertheless, our plasmid toolkit provides a new resource that enables straightforward knock-in of either mScarlet or split mScarlet in C. elegans. This project was supported by the College of Natural Sciences at The University of Texas at Austin via FRI Summer Research Fellowships (GW, BdJ, FZ, and CM) and an Inventors Program Fellowship (ED), as well as National Institute of Health grants R01 GM138443 (DJD), R01 MH133243 (JTP), R21 OD032463 (JTP), and RF1 AG057355 (JTP). ==== Body pmc Figure 1. Analysis of HIS-72 , EGL-1 , and PTL-1 split wrmScarlet tags in C. elegans (A) Plasmid maps for the mScarlet knock-in constructs developed as part of this project. pGLOW39 and pGLOW63 allow tagging of any gene of interest (GOI) with mScarlet-I-C1 or split fluorophore wrmScarlet 11 , respectively. ccdB regions are removed by DNA digest and homology arms for the GOI are cloned as described by Dickinson et al . 2015. pGLOW119 allows cloning of any promoter upstream of split fluorophore wrmScarlet 1-10 , and this construct can be inserted via CRISPR/Cas9 homologous recombination into the ttTi5605 locus on LGII. (B) Testing the split fluorophore system using HIS-72. (Top) Endogenous expression of tiny-tagged HIS-72 ( his-72::3xMyc::wrmScarlet 11 in an muIs252 (Peft-3::wrmScarlet 1-10 ) genetic background. HIS-72 is visible in all somatic nuclei, consistent with Goudeau et al . 2021. This confirms that the 3xMyc epitope tag does not interfere with complementation of the split fluorophore. (Middle) We created an alternative somatic expression construct for wrmScarlet 1-10 using the his-72 promoter and tbb-2 (3’UTR) rather than the eft-3 promoter and unc-54 (3’UTR). Both somatic wrmScarlet 1-10 constructs appear to have ubiquitous expression in all nuclei (compare top and middle panels). (Bottom) We also created a construct for neuronal expression of wrmScarlet 1-10 using the rab-3 promoter. Note that HIS-72::wrmScarlet 11 and wrmScarlet 1-10 complementation is visible in the neuronal nuclei of the head and ventral nerve cord. (C) egl-1 functions within the V5.paa lineages to eliminate the sister cell of PVD via programmed cell death. (D) The EGL-1 tiny tag is functional. We confirmed that the PVD sister cells undergo apoptosis in animals expressing egl-1::wrmScarlet 11 and Peft-3::wrmScarlet 1-10 . The dopaminergic neuron marker Pdat-1::gfp was used to identify PDE neurons and “undead” PVD sister cells in L3 worms. The relevant cell bodies are circled in white. (E) Animals with wild type EGL-1 or tiny-tagged EGL-1 have just 2 PDE neurons, whereas egl-1 knockout worms have an average of 3 (but sometimes 4) PDE and PDE-like neurons (p<0.0001, unpaired t-test). (F) To observe EGL-1 tiny tag expression, we induced programmed cell death in germ cells using UV irradiation. At 6 hours post-UV, we were unable to observe any expression in the germline (mitotic region nor death zone). Yellow arrowheads indicate out-of-focus, round, autofluorescent gut granules (i.e. halo effect). (G) N-terminal tiny-tagging strategy for the ptl-1 gene. Isoforms A-C share a common first exon, so we opted to do a 5’ knock-in of wrmScarlet 11 at this exon to simultaneously tag multiple isoforms of PTL-1. (H) Mechanosensation indicates the PTL-1 tiny tag is functional. Animals bearing tiny-tagged PTL-1(N) responded to gentle touch just as well as animals bearing wild-type PTL-1 (p>0.05, paired t-tests). (I) PTL-1 is expressed in the axons of posterior mechanosensory neurons PVM, PLMR, and PLML. (Top) DIC image of the tail of a young adult worm, with the structures of PVM, PLMR, and PLML superimposed diagrammatically in black. Circles represent the cell bodies, whereas lines represent the axons. (Bottom) We were unable to observe any PTL-1(N) expression in the posterior mechanosensory neurons of wrmScarlet 11 ::ptl-1(N); Prab-3::wrmScarlet 1-10 animals using epifluorescence microscopy at 40x, the highest resolution available in our laboratory. Description mScarlet is currently our first-choice red fluorescent protein for visualizing gene expression in vivo (Bindels et al. 2017). Compared to other RFPs like mCherry or mKate2, mScarlet is less prone to unwanted oligomerization and yields superior brightness and photostability (Bindels et al. 2017). mScarlet was subsequently optimized for C. elegans expression by two independent research groups as wrmScarlet (El Mouridi et al. 2017) or mScarlet-I-C1 (Dickinson et al. 2017; Dickinson et al. 2018). Although wrmScarlet and mScarlet-I-C1 are both available via Addgene, the only available version of the former lacks synthetic introns to improve expression and the latter is available only as part of the SapTrap system for CRISPR/Cas9 knock-in (pZCS16 and pMS050, respectively; Schwartz and Jorgensen 2016; Dickinson et al. 2018; Stevenson et al. 2020). Thus, to expand the mScarlet toolkit in C. elegans , we cloned mScarlet-I-C1 into the self-excising cassette (SEC) ccdB-based vector system for CRISPR/Cas9 knock-in (Dickinson et al. 2015), and this plasmid is now available via Addgene as pGLOW39 ( Fig. 1A ). We have tagged several proteins with mScarlet-I-C1 with excellent results and some of these strains are already available via the CGC. Despite the improved performance of contemporary monomeric fluorophores like mScarlet and mNeonGreen (Heppert et al. 2016; Bindels et al. 2017), sometimes the relatively large size of these tags can disrupt the function of the targeted protein. In this situation, a split fluorophore approach can be utilized, where the functional fluorescent protein tag is asymmetrically split into a small polypeptide that serves as the tag (i.e. “tiny tag”) and a large protein fragment that is conditionally disabled by the split (Cabantous et al. 2005). The two components must then be co-expressed to complement and yield fluorescence. wrmScarlet was recently redeveloped as a split fluorophore referred to as wrmScarlet 1-10 (large fragment) and wrmScarlet 11 (tiny polypeptide tag) (Goudeau et al. 2021). We cloned wrmScarlet 11 into the SEC system for versatile N- or C-terminal tagging of any protein of interest, and this plasmid is now available via Addgene as pGLOW63 ( Fig. 1A ). As with other SEC plasmids (Dickinson et al. 2015), an in-frame epitope tag is included (in this case 3xMyc) to allow purification or immunostaining of the tiny-tagged target protein. We confirmed that the epitope tag did not disrupt the interaction of the split fluorophore by examining the endogenous expression of tiny-tagged HIS-72 in an muIs252 ( Peft-3::wrmScarlet 1-10 ) genetic background (Goudeau et al. 2021). Indeed, the complemented RFP was visible in all somatic nuclei via epifluorescence ( Fig. 1B, top ). Currently available wrmScarlet 1-10 genetic backgrounds were created with MosSCI + unc-119 ( ed3 ) rescue and/or are limited to somatic-, germline-, or muscle-specific expression (Goudeau et al. 2021). Thus, we used CRISPR/Cas9 knock-in to create an alternative somatic wrmScarlet 1-10 construct (i.e. P his-72 ::wrmScarlet 1-10 ) that eliminates the need for unc-119 ( ed3 ) rescue, as well as a construct expressed only in the nervous system ( P rab-3 ::wrmScarlet 1-10 ) ( Fig. 1B ). Finally, to allow highly versatile wrmScarlet 1-10 expression, we created a plasmid for easy cloning of any PCR-amplified promoter upstream of wrmScarlet 1-10 via Gibson assembly. This plasmid allows SEC-based CRISPR knock-in of wrmScarlet 1-10 at the safe harbor ttTi5605 transposon site on LGII, and it is available via Addgene as pGLOW119 ( Fig. 1A ). To investigate the potential of tiny tagging, we opted to tag three widely-studied proteins that are either small – EGL-1 (106 aa) and HIS-72 (151 aa) – and/or not fully functional when tagged with conventional full-length fluorophores ( EGL-1 and PTL-1 ) (Krieg et al . 2017). We find that these tiny-tagged proteins appear to be fully functional, but in most cases we were unable to observe the expression of the endogenous tiny tag in vivo via epifluorescence. We first investigated the pro-apoptotic protein EGL-1 . To confirm that tiny-tagged EGL-1 is functional, we examined the number of dopaminergic PDE neurons in L3 larval worms using a Pdat-1::gfp reporter (Davies et al. 2003). In egl-1 null mutants, worms have additional PDE-like neurons as a result of blocked developmental cell death in the V5.paa neuronal lineage ( Fig. 1C ). Tiny-tagged EGL-1 animals have a wild-type number of PDE neurons, consistent with tiny-tagged EGL-1 being a fully functional protein ( Fig. 1D,E ). To visualize tiny-tagged EGL-1 expression, we exposed young adult worms to UV irradiation and screened for expression of the tag in pachytene germ cells undergoing DNA damage-induced apoptosis in the so-called “death zone” (Stergiou et al. 2007; Gartner et al. 2008). Unfortunately, we were unable to observe tiny-tagged EGL-1 expression anywhere in the germline of UV-treated worms at the timepoint egl-1 mRNA levels are known to peak (6-12 hours post-UV, Stergiou et al . 2007) ( Fig. 1F ). Although use of transgenic egl-1 reporter genes has been successful (e.g. Johnsen and Horvitz 2016), we suspect that endogenous egl-1 expression is too transient or limited to observe in vivo . We next investigated PTL-1 , the ortholog of the human tau/MAP2 protein implicated in Alzheimer’s disease. ptl-1 has a somewhat complex gene structure encoding four isoforms of PTL-1 , so we opted for an N-terminal tiny tag that tags three of the four isoforms ( Fig. 1G ). We call this set of proteins wrmScarlet 11 :: PTL-1 (N). To test the functionality of tiny-tagged PTL-1 (N), we examined sensitivity to gentle touch because loss of proper PTL-1 function has previously been reported to impair gentle touch sensation (Gordon et al . 2008). The six neurons which mediate this sensation are particularly enriched with ptl-1 , making them attractive targets to investigate. As with EGL-1 , tiny-tagging did not appear to disrupt the function of PTL-1 ( Fig. 1H ), but we were unable to observe tiny-tagged PTL-1 (N) expression in any mechanosensory neurons ( Fig. 1I ). This result was unexpected, but perhaps N-terminal tiny tags do not complement as well a C-terminal tiny tags or the fraction of PTL-1(N) complemented with wrmScarlet 1-10 is not enriched enough at microtubules to observe. Overall, our findings suggest that tiny tags are generally innocuous enough to not disrupt the function of low MW endogenous proteins, but that the split fluorophore system is often not sensitive enough to allow observable expression of the complemented proteins via endogenous tags. Overall, an important goal of the Glow Worms undergraduate research stream is to create and share resources with the C. elegans research community. Here, we have created several new plasmids and worm strains useful for CRISPR/Cas9 fluorescent protein knock-in. We anticipate that by expanding the CRISPR reagent toolkit, Glow Worms can have a meaningful and lasting impact on basic biological research, as well as foster a commitment to open and collaborative science in our students at a very early stage of their academic careers. Methods Plasmid construction pGLOW39 was constructed via Gibson assembly of PCR fragments amplified from parent vectors pDD287 (SEC^ccdB^AmpR^ccdB backbone; Addgene #70685) and pMS050 (mScarlet-I-C1; Addgene #91826). pGLOW63 was constructed via Gibson assembly of PCR fragments from parent vector pGLOW39 and the wrmScarlet 11 tiny tag sequence was cloned into the plasmid via PCR primer. pGLOW119 was constructed via Gibson assembly of PCR fragments amplified from parent vector pAP087 ( ttTi5605 ^SEC^ccdB^mKate2 backbone) and worm gDNA from strain CF4582 ( wrmScarlet 1-10 ). All primer sequences available by request. Cloning homology arms into pGLOW39 or pGLOW63 pGLOW39 (N-terminal) Digest (removes ccdB) NgoMIV / ClaI Gibson assembly sequence 5’ fwd primer gtcacgacgttgtaaaacgacggccagtcg Gibson assembly sequence 5’ rev primer TTGATGACGGCCTCTCCCTTGGAGACCAT Gibson assembly sequence 3’ fwd primer GAGCAGAAGTTGATCAGCGAGGAAGACTTG Gibson assembly sequence 3’ rev primer tcacacaggaaacagctatgaccatgttat pGLOW39 (C-terminal) Digest (removes ccdB) NgoMIV / AvrII Gibson assembly sequence 5’ fwd primer gtcacgacgttgtaaaacgacggccagtcg Gibson assembly sequence 5’ rev primer CATCGATGCTCCTGAGGCTCCCGATGCTCC Gibson assembly sequence 3’ fwd primer GAGCAGAAGTTGATCAGCGAGGAAGACTTG Gibson assembly sequence 3’ rev primer ggaaacagctatgaccatgttatcgatttc pGLOW63 (N-terminal) Digest (removes ccdB) NgoMIV / ClaI Gibson assembly sequence 5’ fwd primer gtcacgacgttgtaaaacgacggccagtcg Gibson assembly sequence 5’ rev primer TTCTCGTATTGCTCGACGACGGTGTACAT Gibson assembly sequence 3’ fwd primer GAGCAGAAGTTGATCAGCGAGGAAGACTTG Gibson assembly sequence 3’ rev primer tcacacaggaaacagctatgaccatgttat pGLOW63 (C-terminal) Digest (removes ccdB) NgoMIV / AvrII Gibson assembly sequence 5’ fwd primer gtcacgacgttgtaaaacgacggccagtcg Gibson assembly sequence 5’ rev primer CATCGATGCTCCTGAGGCTCCCGATGCTCC Gibson assembly sequence 3’ fwd primer GAGCAGAAGTTGATCAGCGAGGAAGACTTG Gibson assembly sequence 3’ rev primer ggaaacagctatgaccatgttatcgatttc Cloning a promoter into pGLOW119 Digest (removes ccdB) SpeI Gibson assembly sequence fwd primer ATGATGGTAGCAAACTCACTTCGTccggca Gibson assembly sequence rev primer CTTGATGACTGCTTCTCCCTTCGATACCAT Cloning the his-72 and rab-3 promoters into pGLOW119 For his-72 , a 1000 bp promoter was amplified from N2 gDNA with fwd primer 5’ ATGATGGTAGCAAACTCACTTCGTccggcaaaacgttatagtgtggacacca 3’ and rev primer 5’ CTTGATGACTGCTTCTCCCTTCGATACCATtgttgttctggaaattgagaattga 3’. For rab-3 , a 1776 bp promoter was amplified from N2 gDNA with fwd primer 5’ ATGATGGTAGCAAACTCACTTCGTccggcacttgtcagtgtgaaccatgc 3’ and rev primer 5’ CTTGATGACTGCTTCTCCCTTCGATACCATctgaaaatagggctactgtaga 3’. Making strains GLW59 and GLW70 SEC-based CRISPR/Cas9 (Dickinson et al . 2015) was used to insert all constructs into the genome. DNA was prepared and injected as previously described (Huang et al . 2021). The his-72 ::wrmScarlet 11 construct was injected into a P his-72 ::wrmScarlet 1-10 genetic background (strain GLW55) to make GLW59 [ his-72 ::wrmScarlet 11 ; P his-72 ::wrmScarlet 1-10 ]. GLW59 was crossed into a P rab-3 :: wrmScarlet 1-10 ::SEC ( Rol) genetic background (strain GLW66) followed by removal of the SEC via heat shock excision to make GLW70 [ his-72 ::wrmScarlet 11 ; P rab-3 :: wrmScarlet 1-10 ]. The wrmScarlet 1-10 constructs were targeted for CRISPR/Cas9 insertion at ttTi5605 on LGII via plasmid pDD122 (Addgene #47550). Insertions were verified by PCR genotyping and complemented his-72 ::wrmScarlet 11 expression. Cas9/sgRNA and FP^SEC repair plasmids (see Reagents) available by request. Making strains GLW29 and GLW49 The initial EGL-1 tiny tag strain was made by injecting the egl-1 ::wrmScarlet 11 construct into an muIs252 Peft-3:: wrmScarlet 1-10 genetic background (strain CF4582 ) to make GLW29 . This EGL-1 tiny tag was then crossed into other genetic backgrounds such as egIs1 [Pdat-1::GFP] (strain BZ555 ) to make GLW31 or glh-1 (sam140[ glh-1 ::T2A::wrmScarlet 1-10 ]) (strain DUP237) to make GLW71. The initial PTL-1 (N) tiny tag strain was made by injecting the wrmScarlet 11 :: ptl-1 (N) construct into an muIs252 Peft-3::wrmScarlet 1-10 genetic background (strain CF4582 ) to make GLW49. This PTL-1 (N) tiny tag was then crossed into the P rab-3 :: wrmScarlet 1-10 genetic background (strain GLW96) to make GLW97. The egl-1 and ptl-1(N) tiny tag edits were verified by PCR genotyping and Sanger sequencing. Cas9/sgRNA and FP^SEC repair plasmids (see Reagents) available by request. Epifluorescence imaging of Pdat-1::gfp, as well as his-72 and ptl-1(N) split fluorophores Epifluorescence microscopy was done on an Olympus BX51-F upright microscope using a 40x oil objective, Thorlabs CS2100M camera, and Micromanager/Fiji software. BZ555 egIs1 [Pdat-1::GFP] , JPS165 egIs1 [Pdat-1::GFP]; egl-1 ( ok1418 ) , and GLW31 egIs1 [Pdat-1::GFP]; muIs252 [Peft-3::wrmScarlet 1-10 ]; egl-1 (utx23 [ egl-1 ::wrmScarlet 11 ]) worms were collected as L3 larvae and mounted for microscopy using 10 mM levamisole. Pdat-1::gfp + PDE neurons were easily observed and counted. Split fluorophore strains were collected as adults and mounted for microscopy using a 3% agarose pad and 10 mM levamisole. We were not able to observe fluorescence of the PTL-1(N) tiny tag using the system available in our laboratory. Confocal imaging of the egl-1 split fluorophore following UV irradiation Synchronized young adult worms of strain GLW71 glh-1 (sam140[ glh-1 ::T2A::wrmScarlet 1-10 ]); egl-1 (utx23 [ egl-1 ::wrmScarlet 11 ]) were irradiated with 100 J/m 2 UV-C using a Stratalinker 1800 as previously described (Stergiou et al . 2007). The presence of dead embryos on the plate at 24 hours post-UV was used as a positive control that UV treatment was yielding DNA damage. At 6-12 hours post-UV, adult worms were mounted for iSim confocal microscopy using a 60x oil objective and Kinetix camera. We were unable to observe split wrmScarlet complementation and fluorescence using this system. Analysis of mechanosensation in ptl-1 genetic backgrounds Assays for gentle touch sensitivity were done as previously described (Chalfie et al . 2014). Briefly, each worm was touched (i.e. tapped) a total of 5 times on the head and 5 times on the tail to trigger posterior or anterior movement, respectively. A total of 20 worms were assayed for each genotype. If the worm moved following a tap, the worm was sensitive to that tap. Data represents the average number of times (out of 5) the worm responded to a tap. Reagents Plasmids Plasmid Construct / Function Location pGLOW30 Pmyo-2::mScarlet / RFP array marker Addgene pGLOW31 Pmyo-3::mScarlet / RFP array marker Addgene pGLOW39 mScarlet-I-C1 CRISPR knock-in / FP^SEC repair Addgene pGLOW63 wrmScarlet 11 CRISPR knock-in / FP^SEC repair Addgene pGLOW65 egl-1 Cas9/sgRNA Glow Worms pGLOW66 egl-1 FP^SEC wrmScarlet 11 C-terminal tag Glow Worms pGLOW73 ptl-1 (N) Cas9/sgRNA Glow Worms pGLOW77 Pmyo-2::mNeonGreen / GFP array marker Addgene pGLOW79 Pmyo-3::mNeonGreen / GFP array marker Addgene pGLOW87 his-72 Cas9/sgRNA Glow Worms pGLOW88 his-72 FP^SEC wrmScarlet 11 C-terminal tag Glow Worms pGLOW90 ttTi5605 ^P his-72 ^wrmScarlet 1-10 ^ tbb-2 (3'UTR) Glow Worms pGLOW105 ptl-1 (N) FP^SEC wrmScarlet 11 N-terminal tag Glow Worms pGLOW119 ttTi5605 ^ccdB^wrmScarlet 1-10 ^SEC^ttb-2 (3'UTR) Addgene pGLOW120 ttTi5605 ^P rab-3 ^wrmScarlet 1-10 ^ tbb-2 (3'UTR) Glow Worms Strains Strain Genotype Location GLW27 muIs252 [Peft-3::wrmScarlet 1-10 :: unc-54 3'UTR + Cbr-unc-119 (+)] II; unc-119 ( ed3 ), his-72 (utx21 [ his-72 ::wrmScarlet 11 ::3xMyc]) III CGC GLW29 muIs252 [Peft-3::wrmScarlet 1-10 :: unc-54 3'UTR + Cbr-unc-119 (+)] II; unc-119 ( ed3 ) III; egl-1 (utx23 [ egl-1 ::wrmScarlet 11 ::3xMyc]) V CGC GLW31 muIs252 [Peft-3::wrmScarlet 1-10 :: unc-54 3'UTR + Cbr-unc-119 (+)] II; unc-119 ( ed3 ) III; egl-1 (utx23 [ egl-1 ::wrmScarlet 11 ::3xMyc]) V; egIs1 [Pdat-1::GFP] Glow Worms GLW49 muIs252 [Peft-3::wrmScarlet 1-10 :: unc-54 3'UTR + Cbr-unc-119 (+)] II; ptl-1 (utx41 [wrmScarlet 11 ::3xMyc:: ptl-1 (N)]), unc-119 ( ed3 ) III Glow Worms GLW55 utxIs2 [P his-72 ::wrmScarlet 1-10 :: tbb-2 (3'UTR)] II CGC GLW59 utxIs2 [P his-72 ::wrmScarlet 1-10 :: tbb-2 (3'UTR)] II; his-72 (utx21 [ his-72 ::wrmScarlet 11 ::3xMyc]) III Glow Worms GLW66 utxIs3 [P rab-3 ::wrmScarlet 1-10 ::SEC:: tbb-2 (3'UTR)] II Glow Worms GLW70 utxIs4 [P rab-3 ::wrmScarlet 1-10 :: tbb-2 (3'UTR)] II; his-72 (utx21 [ his-72 ::wrmScarlet 11 ::3xMyc]) III Glow Worms GLW71 glh-1 (sam140[ glh-1 ::T2A::wrmScarlet 1-10 ]) I; egl-1 (utx23 [ egl-1 ::wrmScarlet 11 ::3xMyc]) V Glow Worms GLW96 utxIs4 [P rab-3 ::wrmScarlet 1-10 :: tbb-2 (3'UTR)] II CGC GLW97 utxIs4 [P rab-3 ::wrmScarlet 1-10 :: tbb-2 (3'UTR)] II; ptl-1 (utx41 [wrmScarlet 11 ::3xMyc:: ptl-1 (N)]) III Glow Worms Acknowledgments We would like to thank the Freshman Research Initiative for providing space and funding to carry out this work. We thank the Caenorhabditis Genetics Center, which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40OD010440), for providing strains for this study. ==== Refs Bindels DS Haarbosch L van Weeren L Postma M Wiese KE Mastop M Aumonier S Gotthard G Royant A Hink MA Gadella TW Jr 2016 11 21 mScarlet: a bright monomeric red fluorescent protein for cellular imaging. Nat Methods 14 1 1548-7091 53 56 10.1038/nmeth.4074 27869816 Cabantous S Terwilliger TC Waldo GS 2004 12 5 Protein tagging and detection with engineered self-assembling fragments of green fluorescent protein. Nat Biotechnol 23 1 1087-0156 102 107 10.1038/nbt1044 15580262 Chalfie M Hart AC Rankin CH Goodman MB 2014 7 31 Assaying mechanosensation. WormBook 10.1895/wormbook.1.172.1 25093996 Davies AG Pierce-Shimomura JT Kim H VanHoven MK Thiele TR Bonci A Bargmann CI McIntire SL 2003 12 12 A central role of the BK potassium channel in behavioral responses to ethanol in C. elegans. Cell 115 6 0092-8674 655 666 10.1016/s0092-8674(03)00979-6 14675531 Dickinson DJ Pani AM Heppert JK Higgins CD Goldstein B 2015 6 3 Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200 4 0016-6731 1035 1049 10.1534/genetics.115.178335 26044593 Dickinson DJ Schwager F Pintard L Gotta M Goldstein B 2017 8 21 A Single-Cell Biochemistry Approach Reveals PAR Complex Dynamics during Cell Polarization. Dev Cell 42 4 1534-5807 416 434.e11 10.1016/j.devcel.2017.07.024 28829947 Dickinson D Slabodnick M Chen A Goldstein B 2018 5 1 SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol 2018 10.17912/W2KT0N 32550377 El Mouridi S Lecroisey C Tardy P Mercier M Leclercq-Blondel A Zariohi N Boulin T 2017 5 5 Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable Phenotype. G3 (Bethesda) 7 5 1429 1437 10.1534/g3.117.040824 28280211 Gartner A Boag PR Blackwell TK 2008 9 4 Germline survival and apoptosis. WormBook 1 20 10.1895/wormbook.1.145.1 18781708 Gordon P Hingula L Krasny ML Swienckowski JL Pokrywka NJ Raley-Susman KM 2008 9 19 The invertebrate microtubule-associated protein PTL-1 functions in mechanosensation and development in Caenorhabditis elegans. Dev Genes Evol 218 10 0949-944X 541 551 10.1007/s00427-008-0250-z 18807071 Goudeau J Sharp CS Paw J Savy L Leonetti MD York AG Updike DL Kenyon C Ingaramo M 2021 4 15 Split-wrmScarlet and split-sfGFP: tools for faster, easier fluorescent labeling of endogenous proteins in Caenorhabditis elegans. Genetics 217 4 0016-6731 10.1093/genetics/iyab014 33693628 Heppert JK Dickinson DJ Pani AM Higgins CD Steward A Ahringer J Kuhn JR Goldstein B 2016 7 6 Comparative assessment of fluorescent proteins for in vivo imaging in an animal model system. Mol Biol Cell 27 22 1059-1524 3385 3394 10.1091/mbc.E16-01-0063 27385332 Huang G de Jesus B Koh A Blanco S Rettmann A DeMott E Sylvester M Ren C Meng C Waterland S Rhodes A Alicea P Flynn A Dickinson DJ Doonan R 2021 9 16 Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans . MicroPubl Biol 2021 10.17912/micropub.biology.000460 34549176 Johnsen HL Horvitz HR 2016 5 16 Both the apoptotic suicide pathway and phagocytosis are required for a programmed cell death in Caenorhabditis elegans. BMC Biol 14 39 39 10.1186/s12915-016-0262-5 27185172 Krieg M Stühmer J Cueva JG Fetter R Spilker K Cremers D Shen K Dunn AR Goodman MB 2017 1 18 Genetic defects in β-spectrin and tau sensitize C. elegans axons to movement-induced damage via torque-tension coupling. Elife 6 10.7554/eLife.20172 28098556 Schwartz ML Jorgensen EM 2016 2 2 SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics 202 4 0016-6731 1277 1288 10.1534/genetics.115.184275 26837755 Stergiou L Doukoumetzidis K Sendoel A Hengartner MO 2007 3 9 The nucleotide excision repair pathway is required for UV-C-induced apoptosis in Caenorhabditis elegans. Cell Death Differ 14 6 1350-9047 1129 1138 10.1038/sj.cdd.4402115 17347667 Stevenson ZC Moerdyk-Schauwecker MJ Jamison B Phillips PC 2020 10 5 Rapid Self-Selecting and Clone-Free Integration of Transgenes into Engineered CRISPR Safe Harbor Locations in Caenorhabditis elegans . G3 (Bethesda) 10 10 3775 3782 10.1534/g3.120.401400 32816924