==== Front MicroPubl Biol MicroPubl Biol microPublication Biology 2578-9430 Caltech Library 10.17912/micropub.biology.000863 WBPaper00065564 New Finding Materials and Reagents Expression Data C. Elegans Apical-basal polarity of the spectrin cytoskeleton in the C. elegans vulva Barker Trevor J. Investigation Methodology Visualization Data curation Conceptualization Writing - review & editing 1 Chan Fung-Yi Resources Methodology Visualization 23 Carvalho Ana X. Funding acquisition Project administration Supervision Writing - review & editing Resources Conceptualization 32 Sundaram Meera V. Conceptualization Funding acquisition Project administration Supervision Writing - original draft Data curation Formal analysis 1§ 1 Department of Genetics, University of Pennsylvania, Philadelphia, Pennsylvania, United States 2 i3S-Instituto de Investigação e Inovação em Saúde, University of Porto, Porto, Portugal 3 IBMC-Instituto de Biologia Molecular e Celular, University of Porto, Porto, Portugal Cram Erin § Correspondence to: Meera V. Sundaram ( sundaram@pennmedicine.upenn.edu ) The authors declare that there are no conflicts of interest present. 14 6 2023 2023 2023 10.17912/micropub.biology.00086315 5 2023 7 6 2023 12 6 2023 Copyright: © 2023 by the authors 2023 https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. The C. elegans vulva is a polarized epithelial tube that has been studied extensively as a model for cell-cell signaling, cell fate specification, and tubulogenesis. Here we used endogenous fusions to show that the spectrin cytoskeleton is polarized in this organ, with conventional beta-spectrin ( UNC-70 ) found only at basolateral membranes and beta heavy spectrin ( SMA-1 ) found only at apical membranes. The sole alpha-spectrin ( SPC-1 ) is present at both locations but requires SMA-1 for its apical localization. Thus, beta spectrins are excellent markers for vulva cell membranes and polarity. T.J.B. and M.V.S. are supported by NIH grant R35GM136315. A.X.C. is supported by a Principal Investigator position from the Portuguese Foundation for Science and Technology (CEECIND/01967/2017). F.-Y.C. is supported by a junior researcher position from the Portuguese Foundation for Science and Technology (DL57/2016/CP1355/CT0013). ==== Body pmc Figure 1. Apical-basal polarity of the spectrin cytoskeleton in the C. elegans vulva A, A’) SPC-1 /α-spectrin marks all vulva cell membranes; A’ is a cartoon tracing of the 7 vulA-vulF rings. B, B') UNC-70 /β-spectrin marks basolateral membranes. C, C') SMA-1 /βH-spectrin marks apical cell membranes. B' and C' cartoons are drawn in comparison to A’. D) VAB-10a/spectraplakin marks apical vulva cell membranes. E, F) SMA-1 /βH-spectrin is required for apical localization of SPC-1 /α-spectrin (E) but not VAB-10a/spectraplakin (F). F' shows DIC channel, with disorganized tissue occluding the connection between the gonad and the dorsal apex of the vulva (cog phenotype, arrow). All images are single confocal Z-slices through the medial portion of the mid-L4 vulva tube and are representative of at least n=10 animals examined per genotype. Description The spectrin cytoskeleton lines the cytoplasmic sides of cell plasma membranes (Teliska and Rasband 2021; Lorenzo et al. 2023). There, spectrins serve as linkers to connect plasma membranes and transmembrane proteins to the actin cytoskeleton (Xu et al. 2013; Machnicka et al. 2014; Liem 2016; Li et al. 2023). They play numerous roles in membrane and cytoskeletal organization and stability, tissue mechanics, and morphogenesis (Hammarlund et al. 2007; Bennett and Healy 2008; Duan et al. 2018; Mylvaganam et al. 2020, 2022; Krueger et al. 2020) Spectrins exist as tetramers composed of two dimers, each with an alpha (α) and beta (β) subunit (Liem 2016; Lorenzo et al. 2023). Vertebrates have multiple α-spectrin and β-spectrin genes. Invertebrates such as Drosophila melanogaster and Caenorhabditis elegans have just one α-spectrin and two β-spectrin genes, a conventional β-spectrin and a larger or “heavy” β-spectrin (βH). C. elegans α-spectrin is encoded by spc-1 , and β-spectrin and βH-spectrin are encoded by unc-70 and sma-1 , respectively (McKeown et al. 1998; Hammarlund et al. 2000; Norman and Moerman 2002). SPC-1 functions with either UNC-70 or SMA-1 to control different processes. In general, UNC-70 is widely expressed and plays key roles in neuron and muscle structure (Hammarlund et al. 2000, 2007; Moorthy et al. 2000; Jia et al. 2019), while SMA-1 is expressed more specifically in epithelial cells and affects tissue morphogenesis (Praitis et al. 2005). We also discovered a role for SMA-1 in blastomere cytokinesis (Sobral et al. 2021; Silva et al. 2023). In D. melanogaster , the two β-spectrins exhibit apical-basal polarity in epithelial cells, with conventional β-spectrin found primarily at basolateral membranes and βH-spectrin found primarily at apical membranes, while α-spectrin is found at both locations (Thomas and Kiehart 1994; Thomas and Williams 1999) . D. melanogaster βH-spectrin can also influence apical localization of other factors (Zarnescu and Thomas 1999; Dubreuil et al. 2000; Pogodalla et al. 2021). In C. elegans , immunolocalization and/or transgenic reporter studies in the embryo detected UNC-70 /β-spectrin at many sites of cell-cell contact but SMA-1 /βH-spectrin only at apical membranes (Moorthy et al. 2000; Norman and Moerman 2002; Praitis et al. 2005), suggesting that apical vs. basal partitioning of different β-spectrins is conserved; however, there has been limited analysis of spectrin polarity in larval or adult epithelia (Wirshing and Cram 2018) . Here we visualized the spectrin cytoskeleton in the C. elegans vulva. The vulva is a polarized epithelial tube used for egg-laying. It has been studied extensively as a model for cell-cell signaling, cell fate specification, and tubulogenesis (Sharma-Kishore et al. 1999; Schindler and Sherwood 2013; Gauthier and Rocheleau 2017). Vulva anatomy is well characterized and apical vs. basal cell surfaces can be distinguished easily using simple light microscopy of live animals. Endogenous GFP fusions for SPC-1 /α-spectrin and UNC-70 /β-spectrin have been reported previously (Jia et al. 2019). We used CRISPR/Cas9 to tag the endogenous SMA-1 /βH-spectrin protein with GFP (Methods) and then examined the localization patterns of all three fusions in the developing vulva. At the mid-L4 larval stage, vulva cells are organized into a series of 7 stacked rings (named vulA-vulF), surrounding a central lumen cavity (Sharma-Kishore et al. 1999). SPC-1 ::GFP outlined all 7 rings ( Fig. 1A, A ’) and was present near apical (luminal) membranes and also at sites of cell-cell contact (basolateral membranes). In contrast, UNC-70 ::GFP was present only at basolateral membranes ( Fig. 1B, B '), while SMA-1 ::GFP was present only at apical membranes ( Fig. 1C, C '). We showed previously that the spectrin-related protein VAB-10a/spectraplakin also localizes apically in the vulva (Cohen et al. 2020) ( Fig. 1D ). Thus, β-spectrin and βH-spectrin localize in a polarized fashion in the vulva, and the βH-spectrin and spectraplakin patterns appear very similar ( Fig. 1C '). In agreement with SMA-1 / SPC-1 tetramer formation, we found that SMA-1 /βH-spectrin is needed to localize SPC-1 /α-spectrin to apical membranes. In all sma-1 ( ru18 ) null mutants examined, SPC-1 ::GFP failed to localize to apical membranes and was found only at basolateral membranes ( Fig. 1E ), resembling the pattern seen with UNC-70 ::GFP ( Fig. 1B ). In contrast, VAB-10a::GFP remained unchanged compared to wild type ( Fig. 1D,F ). Therefore, SMA-1 is not required for overall polarity of the vulva. The similarly polarized distributions of β-spectrin and βH-spectrin in C. elegans and D. melanogaster suggest this may be an ancestral feature of metazoan β-spectrins that has been conserved across the many hundreds of millions of years since the evolutionary divergence of nematodes and insects. Some vertebrate tissues also exhibit a polarized spectrin cytoskeleton, but the clear distinction between conventional β-spectrins and βH spectrin appears to have been lost in vertebrates, since either can be found apically or basolaterally (Stabach and Morrow 2000; Cortese et al. 2017; Mylvaganam et al. 2020, 2022). The roles of polarized spectrins in vulva development remain to be determined. Vulva cell types must divide in a stereotyped fashion, migrate inward to form a luminal cavity, and then assemble into doughnut-like rings via cell-cell fusion (Sulston and Horvitz 1977; Sharma-Kishore et al. 1999). These rings adopt specific shapes and undergo stereotypical movements during morphogenesis. The vulva also must connect appropriately with the uterus to allow the passage of eggs, and with the sex muscles and neurons that control egg-laying (Trent et al. 1983; Schindler and Sherwood 2013). Many of these cell behaviors depend on the actin cytoskeleton and/or on interactions with apical or basal extracellular matrices (Bulik and Robbins 2002; Farooqui et al. 2012; Hagedorn et al. 2013; Morrissey et al. 2014; Yang et al. 2017; Cohen et al. 2020). We observed a variety of vulva shape abnormalities in sma-1 mutants (e.g. Fig. 1F '), which may involve some of the above processes and will be described in a separate report. In the meantime, the spectrin fusions described here will be useful membrane markers for studies of vulva development. Methods Caenorhabditis elegans strains were grown at 20˚C under standard conditions (Brenner 1974) . For immobilization during imaging, L4 larvae were mounted on 2% agar pads containing 20 mM sodium azide, along with 10 mM levamisole in a drop of M9 buffer. Confocal z-stacks were collected with a 63X Plan Apo objective (HC PL APO CS2 63x/1.30 GLYC) on a Leica TCS SP8 confocal microscope. Images were processed in FIJI (Schindelin et al. 2012) and the panels assembled with Adobe Illustrator. CRISPR/Cas9-mediated genome editing to tag endogenous SMA-1 with GFP was performed by Suny Biotech. The tag is inserted at the SMA-1 C-terminus, immediately preceding the stop codon, as shown below. This endogenous fusion is functional based on normal body morphology, brood size and embryonic viability of the homozygotes. 1) Wild type sequence: TTATTCAAGCGTGGATCCAAACATTCAAAG* TAG atacctcaccacacgctgatcttcata Bold TAG is the stop codon of sma-1 ; asterisk is where the GFP was inserted 2) Precise sequence knock-in, sma-1 ( syb4954 [ SMA-1 ::GFP]) V C T G TTCAAGCGTGGATCCAAACATTCAAAG AGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGgtaagtttaaacatatatatactaactaaccctgattatttaaattttcagCCAACACTTGTCACTACTTTCTgTTATGGTGTTCAATGCTTcTCgAGATACCCAGATCATATGAAACgGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACgtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTgtaagtttaaacatgattttactaactaactaatctgatttaaattttcagAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAA TAG atacctcaccacacgctgatcttcata Bold italics indicate silent mutations; underline indicates the GFP sequence. Reagents Strains used: GOU2043 vab-10 ( cas602 [VAB-10a::GFP]) I GOU2936 spc-1 ( cas815 [ SPC-1 ::GFP]) X GOU3103 unc-70 ( cas962 [ UNC-70 ::GFP)] V PHX4954 sma-1 ( syb4954 [ SMA-1 ::GFP]) V UP4241 sma-1 ( ru18 ) V; spc-1 ( cas815 [ SPC-1 ::GFP]) X UP4252 vab-10 ( cas602 [VAB-10a::GFP]) I; sma-1 ( ru18 ) V Acknowledgments Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). We thank Andrea Stout and the UPenn CDB Microscopy core for training and assistance with confocal microscopy and Nathalie Pujol (Aix Marseille Univ.) for helpful comments and for hosting M.V.S. during the preparation of this manuscript. ==== Refs Bennett V Healy J 2007 12 20 Organizing the fluid membrane bilayer: diseases linked to spectrin and ankyrin. Trends Mol Med 14 1 1471-4914 28 36 10.1016/j.molmed.2007.11.005 18083066 Brenner S 1974 5 1 The genetics of Caenorhabditis elegans. Genetics 77 1 0016-6731 71 94 10.1093/genetics/77.1.71 4366476 Bulik DA Robbins PW 2002 12 19 The Caenorhabditis elegans sqv genes and functions of proteoglycans in development. Biochim Biophys Acta 1573 3 0006-3002 247 257 10.1016/s0304-4165(02)00391-4 12417407 Cohen JD Sparacio AP Belfi AC Forman-Rubinsky R Hall DH Maul-Newby H Frand AR Sundaram MV 2020 9 25 A multi-layered and dynamic apical extracellular matrix shapes the vulva lumen in Caenorhabditis elegans. Elife 9 10.7554/eLife.57874 32975517 Cortese M Papal S Pisciottano F Elgoyhen AB Hardelin JP Petit C Franchini LF El-Amraoui A 2017 2 8 Spectrin βV adaptive mutations and changes in subcellular location correlate with emergence of hair cell electromotility in mammalians. Proc Natl Acad Sci U S A 114 8 0027-8424 2054 2059 10.1073/pnas.1618778114 28179572 Duan R Kim JH Shilagardi K Schiffhauer ES Lee DM Son S Li S Thomas C Luo T Fletcher DA Robinson DN Chen EH 2018 5 25 Spectrin is a mechanoresponsive protein shaping fusogenic synapse architecture during myoblast fusion. Nat Cell Biol 20 6 1465-7392 688 698 10.1038/s41556-018-0106-3 29802406 Dubreuil RR Wang P Dahl S Lee J Goldstein LS 2000 5 1 Drosophila beta spectrin functions independently of alpha spectrin to polarize the Na,K ATPase in epithelial cells. J Cell Biol 149 3 0021-9525 647 656 10.1083/jcb.149.3.647 10791978 Farooqui S Pellegrino MW Rimann I Morf MK Müller L Fröhli E Hajnal A 2012 9 11 Coordinated lumen contraction and expansion during vulval tube morphogenesis in Caenorhabditis elegans. Dev Cell 23 3 1534-5807 494 506 10.1016/j.devcel.2012.06.019 22975323 Gauthier K Rocheleau CE 2017 C. elegans Vulva Induction: An In Vivo Model to Study Epidermal Growth Factor Receptor Signaling and Trafficking. Methods Mol Biol 1652 1064-3745 43 61 10.1007/978-1-4939-7219-7_3 28791633 Hagedorn EJ Ziel JW Morrissey MA Linden LM Wang Z Chi Q Johnson SA Sherwood DR 2013 6 10 The netrin receptor DCC focuses invadopodia-driven basement membrane transmigration in vivo. J Cell Biol 201 6 0021-9525 903 913 10.1083/jcb.201301091 23751497 Hammarlund M Davis WS Jorgensen EM 2000 5 15 Mutations in beta-spectrin disrupt axon outgrowth and sarcomere structure. J Cell Biol 149 4 0021-9525 931 942 10.1083/jcb.149.4.931 10811832 Hammarlund M Jorgensen EM Bastiani MJ 2007 1 29 Axons break in animals lacking beta-spectrin. J Cell Biol 176 3 0021-9525 269 275 10.1083/jcb.200611117 17261846 Jia R Li D Li M Chai Y Liu Y Xie Z Shao W Xie C Li L Huang X Chen L Li W Ou G 2019 7 12 Spectrin-based membrane skeleton supports ciliogenesis. PLoS Biol 17 7 1544-9173 e3000369 e3000369 10.1371/journal.pbio.3000369 31299042 Krueger D Pallares Cartes C Makaske T De Renzis S 2020 6 26 βH-spectrin is required for ratcheting apical pulsatile constrictions during tissue invagination. EMBO Rep 21 8 1469-221X e49858 e49858 10.15252/embr.201949858 32588528 Li N Chen S Xu K He MT Dong MQ Zhang QC Gao N 2023 4 11 Structural basis of membrane skeleton organization in red blood cells. Cell 186 9 0092-8674 1912 1929.e18 10.1016/j.cell.2023.03.017 37044097 Liem RK 2016 10 3 Cytoskeletal Integrators: The Spectrin Superfamily. Cold Spring Harb Perspect Biol 8 10 10.1101/cshperspect.a018259 27698030 Lorenzo DN Edwards RJ Slavutsky AL 2023 1 25 Spectrins: molecular organizers and targets of neurological disorders. Nat Rev Neurosci 24 4 1471-003X 195 212 10.1038/s41583-022-00674-6 36697767 Machnicka B Czogalla A Hryniewicz-Jankowska A Bogusławska DM Grochowalska R Heger E Sikorski AF 2013 5 11 Spectrins: a structural platform for stabilization and activation of membrane channels, receptors and transporters. Biochim Biophys Acta 1838 2 0006-3002 620 634 10.1016/j.bbamem.2013.05.002 23673272 McKeown C Praitis V Austin J 1998 6 1 sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development 125 11 0950-1991 2087 2098 10.1242/dev.125.11.2087 9570773 Moorthy S Chen L Bennett V 2000 5 15 Caenorhabditis elegans beta-G spectrin is dispensable for establishment of epithelial polarity, but essential for muscular and neuronal function. J Cell Biol 149 4 0021-9525 915 930 10.1083/jcb.149.4.915 10811831 Morrissey MA Keeley DP Hagedorn EJ McClatchey STH Chi Q Hall DH Sherwood DR 2014 10 23 B-LINK: a hemicentin, plakin, and integrin-dependent adhesion system that links tissues by connecting adjacent basement membranes. Dev Cell 31 3 1534-5807 319 331 10.1016/j.devcel.2014.08.024 25443298 Mylvaganam S Riedl M Vega A Collins RF Jaqaman K Grinstein S Freeman SA 2020 6 23 Stabilization of Endothelial Receptor Arrays by a Polarized Spectrin Cytoskeleton Facilitates Rolling and Adhesion of Leukocytes. Cell Rep 31 12 107798 107798 10.1016/j.celrep.2020.107798 32579925 Mylvaganam S Plumb J Yusuf B Li R Lu CY Robinson LA Freeman SA Grinstein S 2022 7 11 The spectrin cytoskeleton integrates endothelial mechanoresponses. Nat Cell Biol 24 8 1465-7392 1226 1238 10.1038/s41556-022-00953-5 35817960 Norman KR Moerman DG 2002 5 6 Alpha spectrin is essential for morphogenesis and body wall muscle formation in Caenorhabditis elegans. J Cell Biol 157 4 0021-9525 665 677 10.1083/jcb.200111051 11994313 Pogodalla N Kranenburg H Rey S Rodrigues S Cardona A Klämbt C 2021 11 4 Drosophila ß(Heavy)-Spectrin is required in polarized ensheathing glia that form a diffusion-barrier around the neuropil. Nat Commun 12 1 6357 6357 10.1038/s41467-021-26462-x 34737284 Praitis V Ciccone E Austin J 2005 7 1 SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol 283 1 0012-1606 157 170 10.1016/j.ydbio.2005.04.002 15890334 Schindelin J Arganda-Carreras I Frise E Kaynig V Longair M Pietzsch T Preibisch S Rueden C Saalfeld S Schmid B Tinevez JY White DJ Hartenstein V Eliceiri K Tomancak P Cardona A 2012 6 28 Fiji: an open-source platform for biological-image analysis. Nat Methods 9 7 1548-7091 676 682 10.1038/nmeth.2019 22743772 Schindler AJ Sherwood DR 2013 2 1 Morphogenesis of the caenorhabditis elegans vulva. Wiley Interdiscip Rev Dev Biol 2 1 1759-7684 75 95 10.1002/wdev.87 23418408 Sharma-Kishore R White JG Southgate E Podbilewicz B 1999 2 1 Formation of the vulva in Caenorhabditis elegans: a paradigm for organogenesis. Development 126 4 0950-1991 691 699 10.1242/dev.126.4.691 9895317 Silva AM Chan FY Norman MJ Sobral AF Zanin E Gassmann R Belmonte JM Carvalho AX 2022 10 11 β-heavy-spectrin stabilizes the constricting contractile ring during cytokinesis. J Cell Biol 222 1 0021-9525 10.1083/jcb.202202024 36219157 Sobral AF Chan FY Norman MJ Osório DS Dias AB Ferreira V Barbosa DJ Cheerambathur D Gassmann R Belmonte JM Carvalho AX 2021 10 18 Plastin and spectrin cooperate to stabilize the actomyosin cortex during cytokinesis. Curr Biol 31 24 0960-9822 5415 5428.e10 10.1016/j.cub.2021.09.055 34666005 Stabach PR Morrow JS 2000 7 14 Identification and characterization of beta V spectrin, a mammalian ortholog of Drosophila beta H spectrin. J Biol Chem 275 28 0021-9258 21385 21395 10.1074/jbc.C000159200 10764729 Sulston JE Horvitz HR 1977 3 1 Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56 1 0012-1606 110 156 10.1016/0012-1606(77)90158-0 838129 Teliska LH Rasband MN 2021 5 24 Spectrins. Curr Biol 31 10 0960-9822 R504 R506 10.1016/j.cub.2021.01.040 34033780 Thomas CM Williams JA 1999 9 1 Dynamic rearrangement of the spectrin membrane skeleton during the generation of epithelial polarity in Drosophila. J Cell Sci 112 ( Pt 17) 0021-9533 2843 2852 10.1242/jcs.112.17.2843 10444379 Thomas GH Kiehart DP 1994 7 1 Beta heavy-spectrin has a restricted tissue and subcellular distribution during Drosophila embryogenesis. Development 120 7 0950-1991 2039 2050 10.1242/dev.120.7.2039 7925008 Trent C Tsuing N Horvitz HR 1983 8 1 Egg-laying defective mutants of the nematode Caenorhabditis elegans. Genetics 104 4 0016-6731 619 647 10.1093/genetics/104.4.619 11813735 Wirshing ACE Cram EJ 2018 8 9 Spectrin regulates cell contractility through production and maintenance of actin bundles in the Caenorhabditis elegans spermatheca. Mol Biol Cell 29 20 1059-1524 2433 2449 10.1091/mbc.E18-06-0347 30091661 Xu K Zhong G Zhuang X 2012 12 13 Actin, spectrin, and associated proteins form a periodic cytoskeletal structure in axons. Science 339 6118 0036-8075 452 456 10.1126/science.1232251 23239625 Yang Q Roiz D Mereu L Daube M Hajnal A 2017 8 7 The Invading Anchor Cell Induces Lateral Membrane Constriction during Vulval Lumen Morphogenesis in C. elegans. Dev Cell 42 3 1534-5807 271 285.e3 10.1016/j.devcel.2017.07.008 28787593 Zarnescu DC Thomas CM 1999 9 6 Apical spectrin is essential for epithelial morphogenesis but not apicobasal polarity in Drosophila. J Cell Biol 146 5 0021-9525 1075 1086 10.1083/jcb.146.5.1075 10477760