==== Front Microbes Environ Microbes Environ JSME2 Microbes and Environments 1342-6311 1347-4405 1342-6311 Japanese Society of Microbial Ecology / Japanese Society of Soil Microbiology / Taiwan Society of Microbial Ecology / Japanese Society of Plant Microbe Interactions / Japanese Society for Extremophiles 37357389 DN/JST.JSTAGE/jsme2/ME23023 10.1264/jsme2.ME23023 ME23023 Short Communication Species-specific Primer and Probe Sets for Detection of Syntrophic Long-chain Fatty Acid-degrading Bacteria in Anaerobic Digestion Using Quantitative PCR Quantification of Syntrophic Bacteria Sakurai Riku 1 Fukuda Yasuhiro 1 Tada Chika 1* 1 Laboratory of Sustainable Animal Environment, Graduate School of Agricultural Science, Tohoku University, Osaki, Miyagi, Japan * Corresponding author. E-mail: chika.tada.e1@tohoku.ac.jp; Tel: +81–229–84–7395; Fax: +81–229–84–6490. 2023 24 6 2023 38 2 ME2302320 3 2023 24 4 2023 2023 by Japanese Society of Microbial Ecology / Japanese Society of Soil Microbiology / Taiwan Society of Microbial Ecology / Japanese Society of Plant Microbe Interactions / Japanese Society for Extremophiles. 2023 https://creativecommons.org/licenses/by/3.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Lipid-rich wastes are energy-dense substrates for anaerobic digestion. However, long-chain fatty acids (LCFAs), key intermediates in lipid degradation, inhibit methanogenic activity. In this study, TaqMan-based qPCR assays targeting the 16S rRNA gene of the cardinal LCFA-degrading bacterial species Syntrophomonas palmitatica and S. zehnderi were developed and validated. A trial experiment showed the advantage of species-specific quantification versus genus-specific quantification in assessing bacterial capacity for lipidic waste degradation. These qPCR assays will serve as monitoring tools for estimating the LCFA-degrading capacity of anaerobic digester communities and developing an effective strategy to enrich LCFA-degrading bacteria. quantitative PCR long-chain fatty acid Syntrophomonas zehnderi Syntrophomonas palmitatica anaerobic digestion ==== Body pmcAnaerobic digestion is a practical method for recovering energy resources, such as methane, by treating various organic wastes. However, the broader application of anaerobic digestion requires further improvements in treatment efficiency and stability (Salama et al., 2019). The co-digestion of energy-rich wastes with wastewater sludge is attracting increasing attention due to improved digestion efficiency and biomethane yield (Wang et al., 2013). Lipidic wastes are considered to be desirable co-substrates because they exhibit higher levels of convertibility to biogas than sugars and proteins (Xu et al., 2018). However, long-chain fatty acids (LCFAs, with carbon chains of more than 12 carbon atoms) produced by the hydrolysis of lipids have been reported to inhibit anaerobic microorganisms (Shin et al., 2003; Palatsi et al., 2009; Silva et al., 2016). Therefore, LCFA degradation is required to promote stable and effective methane production from lipidic wastes. In an anaerobic environment, LCFAs are degraded to hydrogen and acetate via the beta-oxidation pathway (Elsamadony et al., 2021). This process is the rate-limiting step during the anaerobic digestion of lipid-rich substrates (Lalman and Bagley, 2002). The syntrophic relationship between beta-oxidizing bacteria and methanogenic archaea is necessary because the reaction only proceeds under very low H2 pressure (Weng and Jeris, 1976). For example, Schink and Friedrich (1994) reported that the oxidation of 3-hydroxy butyryl CoA to acetoacetyl CoA may be coupled to proton reduction at a hydrogen partial pressure close to 10–5 bar [=1 Pa]. Currently, all of the isolated bacterial species that grow on LCFAs with methanogens belong to the families Syntrophomonadaceae and Syntrophaceae (Elsamadony et al., 2021). The bacterial species detected in mesophilic anaerobic digestion are Syntrophomonas sapovorans (Roy et al., 1986), S. wolfei subsp. saponavida (Lorowitz et al., 1989), S. curvata (Zhang et al., 2004), S. zehnderi (Sousa et al., 2007), S. palmitatica (Hatamoto et al., 2007a), and Syntrophus aciditrophicus (Jackson et al., 1999). Previous studies indicated that, among these species, Syntrophomonas palmitatica and S. zehnderi are the most important for LCFA degradation. Hatamoto et al. (2007b) investigated LCFA-degrading microorganisms using RNA-based stable isotope probing with 13C-labeled palmitate (saturated LCFA) and demonstrated that S. palmitatica was the dominant bacterial species. We also showed that after an approximately two-year pre-incubation of anaerobic digester sludge, the dominant species of genus Syntrophomonas was the closest to S. palmitatica, and its abundance increased as the loading amount of an oily substrate became higher (Sakurai et al., 2021). Similarly, a previous study indicated that S. zehnderi-related species became dominant in a continuously fed anaerobic digester treating LCFA (Ziels et al., 2017); therefore, S. palmitatica and S. zehnderi both dominate the degradation of LCFAs. However, methods to quantify these species have been limited to full-length 16S rRNA amplicon sequencing, shotgun metagenomics, and metatranscriptomics, all of which are expensive and time-consuming. Quantitative PCR (qPCR) is a widely-employed, highly sensitive method for rapidly quantifying microorganisms of interest (Nadkarni et al., 2002). It is a proven and powerful tool for monitoring microbial populations in anaerobic digesters (Yu et al., 2005; Ziels et al., 2015). The use of a dual-labeled fluorogenic hydrolysis probe in the qPCR assay (TaqMan based) offers more specific detection than the SYBR Green assay (Wittwer et al., 1997). A previous study developed a TaqMan-based qPCR assay targeting the genus Syntrophomonas (Ziels et al., 2015). However, since not all Syntrophomonas members are capable of degrading LCFAs, species-specific quantification assays are needed to evaluate the LCFA-degrading potential of anaerobic digester communities. The present study aimed to develop and validate TaqMan qPCR assays targeting the two most important LCFA-degrader microorganisms during anaerobic digestion: S. palmitatica and S. zehnderi. The developed primer/probe sets targeting the S. palmitatica and S. zehnderi 16S rRNA genes are listed in Table 1, and the amplicon sizes for their qPCR assays were 256 and 420 bp, respectively. The specificity of each primer and probe set was tested in silico using SILVA TestPrime 1.0 and TestProbe 3.0 (Klindworth et al., 2013). Microbial organisms with three or more mismatches between each of the three nucleotide sequences were not identified and this was attributed to the low possibility of their amplification (Yu et al., 2005). As a result, no potential non-target organisms were detected by the in silico ana­lysis for the S. palmitatica or S. zehnderi qPCR assays. To further verify the specificity of the primer/probe set, experimental validation was conducted as follows. PCR was performed using the primer sets developed for S. palmitatica and S. zehnderi. PCR products were purified and cloned into T-Vector pMD19 (Simple) (TaKaRa Bio), and the resulting vectors were transformed into T-Competent Quick DH5a (TOYOBO). Positive transformants were randomly selected and colony PCR was performed using the M13 primer RV (5′-CAGGAAACAGCTATGAC-3′) and M13 primer M4 (5′-GTTTTCCCAGTCACGAC-3′) (TaKaRa Bio). Clones with inserted DNA were identified and successfully sequenced after purification using ExoSAP-IT (Thermo Fisher Scientific). The insertion sequences were aligned using MAFFT v7.475 (Katoh and Standley, 2013), and primer sequences were trimmed using Jalview v 2.9.0b2 (Waterhouse et al., 2009). The taxa from which the sequences arose were identified using BLAST (http://www.blast.ncbi.nlm.nih.gov/genbank/). Using these clone sequences as templates, TaqMan-based qPCR assays were conducted to confirm that the assays successfully detected the target sequences only. The 16S rRNA nucleotide sequences obtained in the present study were deposited in Genbank/EMBL/DDBJ under accession codes LC752552 to LC752640. Using the primer sets for the S. palmitatica qPCR assay, 37 clones were constructed and sequenced (Table S1): 18 clones for S. palmitatica (identity: 92–100%) and 19 for S. zehnderi (identity: 91–100%). There were 16 clones with the TaqMan probe sequence with fewer than three mismatches from the clone library. These clones were the closest to S. palmitatica (identity: 99–100%). Only these clones were amplified by qPCR targeting S. palmitatica (Fig. 1A). Using the primer sets for the S. zehnderi qPCR assay, 52 clones were constructed and sequenced (Table S2): 18 clones for S. zehnderi (identity: 93–99%), four for S. bryantii (identity: 95%), 19 for S. sapovorans (identity: 95–99%), and 11 for S. wolfei (identity: 93–100%) and 4 for S. bryantii (identity: 95%). Five clones carrying the region matching the TaqMan probe had less than three mismatches from the clone library. The species closest to these clones was S. zehnderi (identity: 97–99%). Only these clones were amplified by qPCR targeting S. zehnderi (Fig. 1B). Overall, the primer/probe sets developed for S. palmitatica or S. zehnderi successfully amplified only the target sequences. These results indicate the high specificity of the qPCR assays developed. DNA samples for calibration standards were prepared by cloning the target PCR amplicon fragment of each primer set, derived from pure culture DNA, using the same protocol described above. Pure S. palmitatica cultures were purchased from the National Institute of Technology and Evaluation (Tokyo, Japan). Pure‍ ‍S. zehnderi cultures were purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany). The slopes of the calibration dilution series were calculated using linear regressions by plotting Ct values versus template concentrations. A linear dynamic range spanning seven orders of magnitude (108–102 copies) is displayed for each species (Fig. 2). Slopes of –‍3.016 for S. palmitatica and –3.024 for S. zehnderi were obtained. The qPCR calibration slopes for the S. palmitatica and S. zehnderi assays corresponded to PCR efficiencies of 114.6 and 114.1%, respectively. These values were within the acceptable 80–120% range suggested in the MIQE guidelines (Bustin et al., 2009). The regression coefficients (R2) for S. palmitatica and S. zehnderi were 0.990 and 0.996, respectively. The utility of the qPCR assays developed was assessed using the two bioreactor samples described in our previous study: Sludge I and Sludge II (Sakurai et al., 2021). Briefly, Sludge I was prepared by incubating the collected sludge with lipidic waste for approximately 2 years. Sludge II was prepared by incubating it with glucose. In a batch experiment using scum from digested lipidic waste, Sludge I showed a 30% higher methane conversion rate than Sludge II. These sludges were used in the qPCR assay for specific 16S rRNA genes of the genus Syntrophomonas and species S. palmitatica and S. zehnderi (Table 2). Using the genus-specific primer/probe set developed by Ziels et al. (2015), the 16S rRNA gene copy numbers of Syntrophomonas were 3.9±0.9 E+05 in Sludge I and 2.2±0.2 E+06 copies mL–1 in‍ ‍Sludge II. The 16S rRNA gene copy number of S. palmitatica was 9.1±0.9 E+05 copies mL–1 in Sludge I and not detected in Sludge II. The 16S rRNA gene copy number of S. zehnderi was 2.9±0.3 E+05 copies mL–1 in Sludge I and not detected in Sludge II. Even though Sludge II showed a higher 16S rRNA gene copy number of Syntrophomonas, neither S. palmitatica nor S. zehnderi were detected. These results suggested that the presence of S. palmitatica and S. zehnderi in Sludge I contributed to a 30% higher methane conversion rate. In conclusion, the presented TaqMan-based qPCR assays targeting S. palmitatica and S. zehnderi were validated and applied. Field testing indicated the advantage of species-specific quantification towards genus-specific quantification when assessing the capability of lipidic waste degradation. The assays presented here enabled the absolute quantification of LCFA-degrading bacteria for the first time and may lead to the establishment of better anaerobic digester operating strategies. Citation Sakurai, R., Fukuda, Y., and Tada, C. (2023) Species-specific Primer and Probe Sets for Detection of Syntrophic Long-chain Fatty Acid-degrading Bacteria in Anaerobic Digestion Using Quantitative PCR. Microbes Environ 38: ME23023. https://doi.org/10.1264/jsme2.ME23023 Supplementary Material Supplementary Material Acknowledgements This study was supported by BIOENERGY (Tokyo, Japan). This work was supported by the Project of Integrated Compost Science (PICS). We would like to thank Editage (www.editage.com) for English language editing. Fig. 1. Specific detection of target species as increases in fluorescence using the clone library. TaqMan-based qPCR assays targeting (A) Syntrophomonas palmitatica and (B) Syntrophomonas zehnderi. Samples colored in red did not produce a fluorescence signal. The number following # indicates the clone ID described in Supplementary Table S1. Fig. 2. Threshold cycle (Ct) values versus 16S rRNA gene copies on a typical standard calibration curve. Standard curves generated from qPCR assays targeting (A) Syntrophomonas palmitatica and (B) Syntrophomonas zehnderi. Triplicate points are shown for each standard dilution. Table 1. Characteristics of 16S rRNA gene-targeted qPCR primer/probe sets Target Oligo. sequence (5′-3′) E. coli position Product size (bp) Tm (°C)b SynPal_Probe (P) Syntrophomonas palmitatica TGTCTAGAGCAATAACACGGCTTTAGAA 547–574 67 SynPalF (F) GCGAAGAAGGCCTTAGGGTT 502–521 256 60 SynPalR (R) CCTGCCCTCAAGAACTCCAG 738–757 60 SynZehn_Probe (P) Syntrophomonas zehnderi TGTTCGCGTCAGTAATATGGGCGTGAAA 509–542 75 SynZehnF (F) GATGAGCCCGCGTCTGATTA 269–288 420 60 SynZehnR (R) CAGTTTCAAGTGCAACCCCG 669–688 60 a Designations in parentheses: P, TaqMan probe; F, forward primer; R, reverse primer. b Calculated using the nearest-neighbor method. Table 2. Quantification of LCFA-degrading bacteria in anaerobic digestion sludge using qPCR assays developed in this study Sample source Target Number of the 16S rRNA gene (copies mL–1*) Reference Sludge I Syntrophomonas 3.9±0.9 E+05 Sakurai et al., 2021 S. palmitatica 9.1±0.9 E+05 This study S. zehnderi 2.9±0.3 E+05 This study Sludge II Syntrophomonas 2.2±0.2 E+06 Sakurai et al., 2021 S. palmitatica n.d. This study S. zehnderi n.d. This study * Values represent the standard deviation of the mean (n=3 biological replicates). ==== Refs References Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., et al. (2009) The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55 : 611–622.19246619 Elsamadony, M., Mostafa, A., Fujii, M., Tawfik, A., and Pant, D. (2021) Advances towards understanding long chain fatty acids-induced inhibition and overcoming strategies for efficient anaerobic digestion process. Water Res 190 : 116732.33316662 Hatamoto, M., Imachi, H., Fukayo, S., Ohashi, A., and Harada, H. (2007a) Syntrophomonas palmitatica sp. nov., an anaerobic syntrophic, long-chain fatty-acid-oxidizing bacterium isolated from methanogenic sludge. Int J Syst Evol Microbiol 57 : 2137–2142.17766887 Hatamoto, M., Imachi, H., Ohashi, A., and Harada, H. (2007b) Identification and cultivation of anaerobic, syntrophic long-chain fatty acid-degrading microbes from mesophilic and thermophilic methanogenic sludges. Appl Environ Microbiol 73 : 1332–1340.17189450 Jackson, B.E., Bhupathiraju, V.K., Tanner, R.S., Woese, C.R., and McInerney, M.J. (1999) Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms. Arch Microbiol 171 : 107–114.9914307 Katoh, K., and Standley, D.M. (2013) MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol Biol Evol 30 : 772–780.23329690 Klindworth, A., Pruesse, E., Schweer, T., Peplies, J., Quast, C., Horn, M., and Glöckner, F.O. (2013) Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res 41 : 1–11.23143271 Lalman, J., and Bagley, D.M. (2002) Effects of C18 long chain fatty acids on glucose, butyrate and hydrogen degradation. Water Res 36 : 3307–3313.12188129 Lorowitz, W.H., Zhao, H., and Bryant, M.P. (1989) Syntrophomonas wolfei subsp. saponavida subsp. nov., a long-chain fatty-acid-degrading, anaerobic, syntrophic bacterium; Syntrophomonas wolfei subsp. wolfei subsp. nov.; and emended descriptions of the genus and species. Int J Syst Bacteriol 39 : 122–126. Nadkarni, M.A., Martin, F.E., Jacques, N.A., and Hunter, N. (2002) Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148 : 257–266.11782518 Palatsi, J., Laureni, M., Andrés, M.V., Flotats, X., Nielsen, H.B., and Angelidaki, I. (2009) Strategies for recovering inhibition caused by long chain fatty acids on anaerobic thermophilic biogas reactors. Bioresour Technol 100 : 4588–4596.19473835 Roy, F., Samain, E., Dubourguier, H.C., and Albagnac, G. (1986) Synthrophomonas sapovorans sp. nov., a new obligately proton reducing anaerobe oxidizing saturated and unsaturated long chain fatty acids. Arch Microbiol 146 : 142–147. Sakurai, R., Takizawa, S., Fukuda, Y., and Tada, C. (2021) Exploration of microbial communities contributing to effective methane production from scum under anaerobic digestion. PLoS One 16 : e0257651.34591868 Salama, E.S., Saha, S., Kurade, M.B., Dev, S., Chang, S.W., and Jeon, B.H. (2019) Recent trends in anaerobic co-digestion: Fat, oil, and grease (FOG) for enhanced biomethanation. Prog Energy Combust Sci 70 : 22–42. Schink, B., and Friedrich, M. (1994) Energetics of syntrophic fatty acid oxidation. FEMS Microbiol Rev 15 : 85–94. Shin, H., Kim, S., Lee, C., and Nam, S. (2003) Inhibitory effects of long-chain fatty acids on VFA degradation and β-oxidation. Water Sci Technol 47 : 139–146. Silva, S.A., Salvador, A.F., Cavaleiro, A.J., Pereira, M.A., Stams, A.J.M., Alves, M.M., and Sousa, D.Z. (2016) Toxicity of long chain fatty acids towards acetate conversion by Methanosaeta concilii and Methanosarcina mazei. Microb Biotechnol 9 : 514–518 27273786 Sousa, D.Z., Smidt, H., Madalena Alves, M., and Stams, A.J.M. (2007) Syntrophomonas zehnderi sp. nov., an anaerobe that degrades long-chain fatty acids in co-culture with Methanobacterium formicicum. Int J Syst Evol Microbiol 57 : 609–615.17329794 Wang, L., Aziz, T.N., and De los Reyes, F.L. (2013) Determining the limits of anaerobic co-digestion of thickened waste activated sludge with grease interceptor waste. Water Res 47 : 3835–3844.23648286 Waterhouse, A.M., Procter, J.B., Martin, D.M.A., Clamp, M., and Barton, G.J. (2009) Jalview Version 2-A multiple sequence alignment editor and ana­lysis workbench. Bioinformatics 25 : 1189–1191.19151095 Weng, C.-nan, and Jeris, J.S. (1976) Biochemical mechanisms in the methane fermentation of glutamic and oleic acids. Water Res 10 : 9–18. Wittwer, C.T., Herrmann, M.G., Moss, A.A., and Rasmussen, R.P. (1997) Continuous fluorescence monitoring of rapid cycle DNA amplification. BioTechniques 22 : 130–138 8994660 Xu, F., Li, Y., Ge, X., Yang, L., and Li, Y. (2018) Anaerobic digestion of food waste—challenges and opportunities. Bioresour Technol 247 : 1047–1058.28965912 Yu, Y., Lee, C., Kim, J., and Hwang, S. (2005) Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol Bioeng 89 : 670–679.15696537 Zhang, C., Liu, X., and Dong, X. (2004) Syntrophomonas curvata sp. nov., an anaerobe that degrades fatty acids in co-culture with methanogens. Int J Syst Evol Microbiol 54 : 969–973.15143051 Ziels, R.M., Beck, D.A.C., Martí, M., Gough, H.L., Stensel, H.D., and Svensson, B.H. (2015) Monitoring the dynamics of syntrophic β-oxidizing bacteria during anaerobic degradation of oleic acidby quantitative PCR. FEMS Microbiol Ecol 91 : fiv028 25873606 Ziels, R.M., Beck, D.A.C., and Stensel, H.D. (2017) Long-chain fatty acid feeding frequency in anaerobic codigestion impacts syntrophic community structure and biokinetics. Water Res 117 : 218–229.28402870