
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00854-X
10.1016/j.psj.2024.104275
104275
GENETICS AND MOLECULAR BIOLOGY
Duck enteritis virus LORF4 gene is a late gene and nonessential for virus replication in vitro
Huang Jie *†‡§║1
Wang Mingshu *†‡§║1
Cheng Anchun chenganchun@vip.163.com
*†‡§║2
Yang Qiao *†‡§║
Tian Bin *†‡§║
Wu Ying *†‡§║
Ou Xumin *†‡§║
Sun Di *†‡§║
He Yu *†‡§║
Wu Zhen *†‡§║
Zhao Xinxin *†‡§║
Zhang Shaqiu *†‡§║
Huang Juan *†‡§║
Zhu Dekang *†‡║
Jia Renyong *†‡§║
Liu Mafeng *†‡§║
Chen Shun *†‡§║
⁎ Engineering Research Center of Southwest Animal Disease Prevention and Control Technology, Ministry of Education of the People's Republic of China, Chengdu 611130, China
† Key Laboratory of Animal Disease and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
‡ International Joint Research Center for Animal Disease Prevention and Control of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China
§ Institute of Veterinary Medicine and Immunology, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
║ Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
2 Corresponding author: chenganchun@vip.163.com
1 Equal contributing first authors.

31 8 2024
12 2024
31 8 2024
103 12 10427514 6 2024
26 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Duck enteritis virus (DEV) is an avian alpha-herpesvirus that primarily causes an acute and highly contagious infectious disease of ducks. The LORF4 gene is one of the specific genes of DEV, with limited reports on its biological characteristics and functions. This study investigates the basic biological properties of LORF4 protein (pLORF4). The results show that DEV LORF4 is a late gene mainly localized in the cytoplasm of DEV-infected DEF. To explore the role of pLORF4 in the DEV replication life cycle, a recombinant virus lacking pLORF4 expression was constructed. The results showed that pLORF4 is not essential for virus replication and does not affect virus adsorption, assembly and release, it plays a positive role in virus invasion and DNA replication. In summary, this study provides a foundation for further research on the function of the LORF4 gene.

Key words

Duck enteritis virus
LORF4
specific gene
virus replication
nonessential gene
==== Body
pmcINTRODUCTION

Duck virus enteritis (DVE), also known as duck plague (DP), is one of the major infectious and fatal diseases affecting ducks, geese, swans, and other waterfowl of various ages. It can cause massive spot hemorrhage in solid organs, lymphoid tissues, and the digestive tract, leading to considerable mortality and significant economic losses in the world's duck farming industry (Dhama et al., 2017). DVE is caused by the duck enteritis virus (DEV), also known as duck herpesvirus type 1 (Anatid herpesvirus-1, AHV-1) or duck plague virus (DPV). DEV belongs to the genus Mardivirus, family Herpesviridae, and sub-family Alpha-herpesvirinae.

DEV is one of the avian herpesviruses, which also include Marek's disease virus (MDV), Turkey herpesvirus (HVT, also known as MDV-3), Infectious laryngotracheitis virus (ILTV), Psittacid herpesvirus (PsHV), Vulture herpesvirus (VHV), Pigeon herpesvirus (PiHV) (Thureen and Keeler, 2006). DEV CHv strain was isolated, identified and preserved in our laboratory. The genome of DEV is approximately 162kbp and contains 78 open reading frames (ORFs) predicted to encode functional proteins. The genomic structure of DEV includes a unique-long (UL) region and unique-short (US) region, there are inverted repeat sequences (IRS) between the UL and US regions, and terminal repeat sequences (TRS) at the 3′end of the US region and form UL-IRS-US-TRS (5′-3′). Among the 78 ORFs, 65 are located at the UL region, while 11 are in the US regions, and the IRS and TRS contain 1 ORF, respectively (Wu et al., 2012).

The genes of avian herpesviruses are divided into 2 categories: genes homologous to other herpesviruses and genes specific to avian herpesviruses, which are related to the unique biological characteristics of these viruses and are usually named “ORF+ number”. Based on their location in the genome, they are named LORF, RLORF, SORF, RSORF (Lee et al., 2000). There are approximately 10 specific genes in avian herpesviruses, of which the genes located in the UL region are named LORF1, LORF2 (vLIP), LORF3, LOR4 (LORF9), LORF5 (LORF11) and LORF10(Cui et al., 1991; Liao et al., 2020; Niikura et al., 2004; Schrag and Cygler, 1997; Shen et al., 2021; Shen et al., 2023; Yang et al., 2015; Yang et al., 2017). Genes located in the US region include SORF1, SORF2, SORF3 and SORF4(Brunovskis and Velicer, 1995). Additionally, there are special genes that exist only in the inverted repeat regions of specific viruses and play crucial role in the pathogenicity, such as MDV Meq (RLORF7), RLORF4 and MeHV-1 Bcl2 genes (Liu et al., 2019). There are few studies on the functions of proteins encoded by DEV-specific genes (Shen et al., 2021; Shen et al., 2023). As one of the DEV-specific genes, the LORF4 gene is located between the UL55 and UL54 genes, but the function of its encoded protein remained unclear.

In this study, we report the molecular characterization of the DEV LORF4 gene, which has a full length of 969bp and encodes a protein (pLORF4) with a theoretical molecular weight of 36 kDa. Furthermore, we investigated the role of DEV pLORF4 in the DEV life cycle by constructing a DEV LORF4 deletion strain (ΔLORF4) and a revertant strain (ΔLORF4-R). This study provides the foundation for understanding the function of DEV pLORF4, demonstrating that LORF4 is a late gene and nonessential for virus replication in vitro.

MATERIALS AND METHODS

Cells and Viruses

Duck embryo fibroblasts (DEF) were cultured in minimal Eagle's medium (MEM; Gibco) supplemented with 10% (v/v) newborn calf serum. The cells were maintained at 37°C in a humidified 5% CO2 atmosphere. The DEV CHv strain (labeled WT, GenBank accession no. JQ647509.1) was used in this experiment. The DEV ΔLORF4 strain (labeled as ΔLORF4) and the DEV ΔLORF4 revertant strain (labeled as ΔLORF4-R) were prepared and provided by our laboratory based on the DEV recombinant virus artificial chromosome rescue platform constructed.

Antibodies

Rabbit anti-DEV UL29, UL47, UL51, and LORF4 polyclonal antibody serum were prepared and served by our laboratory. The following antibodies were purchased commercially: Mouse anti-β-actin antibody was purchased from Yisheng Biotechnology (Shanghai, CHN), Goat anti-Mouse IgG (H/L): HRP was purchased from Bio-Rad, Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 was purchased from the Thermo Fisher Scientific.

RT-qPCR

To detect the transcription phase of LORF4, total RNA was isolated at different time points (0, 6, 12, 24, 48 and 72h) after DEV infected of DEF. The isolated RNA was then reverse transcribed into cDNA using the PrimeScript RT reagent Kit. Quantitative primers ICP4-F/R, UL29-F/R, UL47-F/R, LORF4-F/R and β-actin F/R were used (Table 1).The quantitative RT-qPCR reaction system (20 μL) comprised 10 μL of 2ⅹqPCR SYBR Green Master Mix, 0.5 μL of each primer, 0.5 μL of cDNA, 8.5 μL of RNase-free water. The reaction program was as follows: 95°C 3min for 1 cycle; 95 °C for 10s, 55°C for 20s, and 72°C for 20s for 40 cycles; followed by a melting curve analysis starting at 65°C, increasing the temperature at 0.5°C/s to 95°C for 1 cycle. All tests were performed in triplicate. After the RT-qPCR reaction, the transcription phase of each gene was analyzed using the Bio-Rad CFX Maestro software. β-actin was used as the reference gene, ICP4 served as the immediate early (IE) gene control, UL29 as the early (E) gene control, and UL47 as the late (L) gene control (He et al., 2020; Zhou et al., 2023).Table 1 Primer sequences for PCR and RT-Qpcr.

Table 1Primer	Primer sequence (5′–3′)	Gene	
ΔLORF4-Kan-F	ATCGGTGCTCCGCAACGAGACAGTCAAAGCGATAAGCAAGTAGGGATAACAGGGTAATCGATTT	LORF4-deleted targeting fragment	
ΔLORF4-Kan-R	GAAAGCAGAAAGATAACACGAAGGTATAATAATAATTTCTTACTTGCTTATCGCTTTGACTGTCTCGTGCGGAGCACCGATGCCAGTGTTACAACCAAT	LORF4-deleted targeting fragment	
LORF4 Rev-F	ACACGGCCCCTCAGAACTGATCGGTGCTCCGCAACGAGACAGTCAAAGCGATAAGCAAGATGGCCACGCAGACCGAAGGTC	LORF4-returned targeting fragment	
LORF4 Rev-R	CGAAGGTATAATAATTTCTTTATCACTCATCCGAAGAGTTACACGC	LORF4-returned targeting fragment	
LORF4 Rev-Kan-F	TAAAGAAATTATTATACCTTCGTGTTATCTTTCTGCTTTCTAAACCTAGGGATAACAGGGTAATCGATTT	LORF4-returned targeting fragment	
LORF4 Rev-Kan-R	CAAATTGAAGATTTACATAGTCGTTTAGTGGTTTAGAAAGCAGAAAGATAACACGAAGGTATAATAATTTCTTTACAGTGTTACAACCAAT	LORF4-returned targeting fragment	
L4-JD-F	CTCTTATTCCAACCGCCTT	LORF4 deletion identified	
L4-JD-R	TTTCTATCTGAGCAACCGTCT	LORF4 deletion identified	
UL30-F	TTTTCCTCCTCCTCGCTGAGT	UL30	
UL30-R	GGCCGGGTTTGCAGAAGT	UL30	
DEV probe	CCCTGGGTACAAGCG	UL30	
LORF4-F	ATGATCTTTTCGGCGGAC	LORF4	
LORF4-R	AATGATTTCAGTGCACCG	LORF4	
β-actin-F	CCGGGCATCGCTGACA	β-actin	
β-actin-R	GGATTCATCATACTCCTGCTTGCT	β-actin	
ICP4-F	CGTTCGCTCAGCTATACCCT	ICP4	
ICP4-R	GGTCCGCTTATACTGAGTCCA	ICP4	
UL29-F	AACCTGCGTTCGTCTCCAAT	UL29	
UL29-R	GTCTCTCTAGTCGCATCCGC	UL29	
UL47-F	AACGGAGTTGCTTGGAGAACA	UL47	
UL47-R	TGGGCGATGAAACAGAGTAGG	UL47	

Drug Inhibition of GCV/CHX

DEF were prepared in 12-well plates and replaced with maintenance medium after the cells have reached the monolayer. Then, 300μg/mL ganciclovir (GCV) and 100 μg/mL cycloheximide (CHX) were added to the respective wells, and the DEF were simultaneously infected with DEV at a multiplicity of infection (MOI) of 0.01. Both negative control (no drug exposure) and positive control (drug exposure) group were set up. The cultures were incubated for 24 h at 37°C in a humidified 5% CO2 atmosphere. After the incubation period, the culture medium was discarded, and the cells were washed 3 times with PBS. Cell samples were then collected for RNA extraction, which was followed by reverse transcribed into cDNA using a reverse transcription kit. Quantitative primers ICP4-F/R, UL29-F/R, UL47-F/R, LORF4-F/R and β-actin F/R (Table 1) were used for PCR amplification. The PCR products were subsequently identified by agarose gel electrophoresis.

Western Blot

Whole-cell lysates were prepared from DEV-infected DEF at the indicated times postinfection by harvesting the cells in strong radioimmunoprecipitation assay (RIPA) buffer supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF). The lysates were subjected to SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk in Tris-buffered saline containing 0.1% Tween-20 (TBST). The primary antibodies used were rabbit anti-LORF4 polyclonal antibody, rabbit anti-UL29 polyclonal antibody, rabbit anti-UL47 polyclonal antibody (all at a dilution ratio of 1:500), as well as mouse anti-β-actin antibody (1:2000). Secondary antibodies used were goat anti-rabbit HRP antibody (1:3000) and goat antimouse HRP antibody (1:3000). Detection was performed using the chemiluminescence (ECL) ultrasensitive chromogenic kit (Beyotime, CHN) and imaged with the ChemiDoc XRS imaging system (Bio-Rad).

Immunofluorescence Microscopy and Imaging

The coverslips containing DEV-infected DEF were fixed in 4% paraformaldehyde at 2 to 8°C overnight. After fixation, the cell coverslips were rinsed with PBS containing 0.5% Tween-20 (PBST). For permeabilization, 0.25% Triton X-100 was added. Primary and secondary antibodies were diluted in PBST. Alexa Fluor 594-conjugated secondary antibodies (Invitrogen) used as the secondary antibodies. The coverslips were mounted with DAPI to stain the nuclei. Images were captured using a fluorescence microscope (Nikon) and processed using NIS Elements software.

Construction and Identification of Recombinant Viruses

The DEV ΔLORF4 strain and DEV ΔLORF4-R strain used in this study were prepared by our laboratory based on the DEV recombinant virus artificial chromosome rescue platform. Recombinant viruses were generated as previously described (Shen et al., 2023). Relevant primers for recombineering are listed in Table 1. After the recombinant viruses were generated, PCR amplification was performed using L4-JD-F/R primers. Restriction endonucleases BamHI and XhoI were used for restriction fragment length polymorphism (RFLP) analysis. The recombinant viruses were further confirmed by western blot analysis, Sanger sequencing and immunofluorescence assays (IFA), verifying successful construction.

Growth Curves

The ΔLORF4, ΔLORF4-R viruses mentioned above were generated from BAC stocks. Infection with ΔLORF4, ΔLORF4-R, and WT viruses were carried out at an MOI of 3.0 for single-step growth curves and at an MOI of 0.01 for multistep growth curves, each in triplicate. For single-step growth curves, the cell culture medium was harvested at 6, 12, 24 and 36 h post infection (hpi). For multistep growth curves, the medium was harvested at 24, 48, 72 and 96 hpi. The virus titer at different times was determined using the half tissue culture infectious dose (TCID50) method. The cultures were incubated in a 37°C, 5% CO2 incubator for 5 d. Cytopathic effects (CPE) were observed and recorded under a microscope, and TCID50 was calculated to draw a growth curve. Statistical analysis was performed using GraphPad Prism version 8.0 software, with data considered significantly different if the P-value was ≤0.05. The growth kinetic data represent the results of 3 repeated experiments.

Quantitative Plaque Size Assays

12-well tissue culture plates were seeded with 2.0ⅹ106 DEF the day before infection. Infection was initiated by removing the growth medium and addition maintenance medium containing viruses at an MOI of 0.01. After incubation at 37°C for 2 h, the virus solution was discarded. A mixture of 2.5% low-melting point agarose gel (Solarbio, CHN) and MEM maintenance medium (1:4 ration to achieve a final concentration of 0.5%) was added to cover the cells and allowed to solidify at room temperature for 20min. Four days postinfection, the agarose gel block was discarded. The monolayers were then fixed by incubation in 4% paraformaldehyde in PBS for 1h. After fixation, the monolayers were washed twice with PBS, stained with 500 µL of 0.5% crystal violet for 15 min, and then washed twice with PBS. The plaques were photographed, and the plaque areas were analyzed using Image J software. Statistical analysis was performed using GraphPad Prism version 8.0 software.

Virus Adsorption, Invasion, DNA Replication and Release

Adsorption: Monolayer DEF in 6-well plates were cultured until confluency. The cells were then precooled at 4°C for 1h. Dead cells were washed away with 4°C precooled PBS. The cells were infected with the virus at an MOI of 0.01 for 2h, followed by 3 washes with precooled PBS. The cell samples were collected for virus copy number determination (Guo et al., 2009).

Invasion: Following the adsorption procedure, the virus solution was discarded after 2h, and the cells were replaced with 2% NBS maintenance solution. The cells were then cultured at 37°C and 5% CO2 for 1h. After this incubation, the cells were washed 3 times with precooled PBS. The cell samples were collected for virus copy number determination.

DNA replication: Monolayer of DEF in 12-well plates were cultured until they reached confluency. The cells were infected with the virus at an MOI of 0.01and 1.0, respectively. After 6h of incubation at 37°C, the virus solution was discarded, and the cell maintenance medium was replaced with 2% NBS. The culture was continued at 37°C and 5% CO2, and cell samples were collected at 16, 18 and 20 hpi for virus copy number determination.

Release: Monolayer of DEF in 12-well plates were cultured until they reached confluency. The cells were infected with the virus at an MOI of 1.0. After 24 h of infection at 37°C, the virus solution was discarded, and the cell maintenance medium containing 2% NBS was added. The culture was continued at 37°C and 5% CO2. The supernatant was collected at 1, 2, 3 and 4 h postincubation for virus TCID50 determination.

Electron Microscopy

DEF were seeded in a T125 square flask and infected at an MOI of 5 for 20h. At 20phi, the maintenance medium (2% NBS in MEM medium) was discarded from in the cell flask. The cells were then digested with trypsin for 2 to 3 min, and the digested liquid was collected into an Eppendorf (EP) tube and centrifuged at 100ⅹg for 2 min. The supernatant was discarded, and 0.5% glutaraldehyde fixative was slowly added along the tube to resuspend the cells, which were then left to stand at 4°C for 5 min. The cell suspension was transferred to a 1.5 mL sharp-bottomed EP tube and centrifuged at 13500ⅹg for 10 min. The supernatant was gently discarded, and 3% glutaraldehyde fixative was slowly added to the precipitate. After collection, the samples were processed by Chengdu Lilai Biological Technology Co., Ltd. Images were acquired using a JEOF JEM-1400FLASH digital-capture transmission electron microscope.

Statistical Analysis

Comparisons between groups were performed using by 1-way ANOVA or 2-way ANOVA with GraphPad Prism version 8.0 software (La Jolla, CA). Data is the means and standard deviations from a representative experiment performed in triplicate. Asterisks indicate *P < 0.05, ***P < 0.001, and ***P < 0.0001.

RESULTS

LORF4 Gene Is a Late Gene of DEV

To determine the transcription and expression phases of DEV LORF4 gene, we analyzed its mRNA and protein levels. The results showed that LORF4 mRNA began to accumulate to observable levels between 12 to 24 hpi, reaching a peak at 48 hpi. The transcription phase was similar to that of the DEV UL47 gene (Figure 1A). To correlate the increase in mRNA with protein levels, we prepared rabbit anti-polyclonal antibodies against pLORF4. These antibodies were used for WB analysis of lysate products at different time points after DEV infection. The results indicated that pLORF4 started to be detected at 36 hpi, which was consistent with the timing of the late pUL47 (Figure 1B). To confirm whether LORF4 is a late gene, we added GCV and CHX drugs for inhibition. The results showed that the target band of the LORF4 gene was not detected in the presence of either drug, which was consistent with the results observed for late UL47 gene (Figure 1C). These finding indicate that LORF4 is a late gene in DEV.Figure 1 LORF4 gene was a late gene of DEV. A. For uninfected samples and 6, 12, 24, 48, and 72 h after DEV infection, RT-qPCR was performed to detect the relative transcription levels of DEV ICP4, UL29, UL47 and LORF4 genes relative to the β-actin gene, with 3 replicates for each data. B. Western blot analysis of uninfected DEF (Mock) and DEV- infected (MOI,0.1) at 6, 12, 24, 36, 48, 60, and 72hpi detected UL29, UL47, LORF4, and β-actin. C. Detection of LORF4 gene by PCR after drug inhibition with GCV and CHX. “+” indicates DEV infected cell lysates without drug addition, “−” indicated DEF lysates without infection and drug addiction.

Figure 1

pLORF4 Was Mainly Localized in DEF Cytoplasm

To study the localization of pLORF4 in DEF during the infection stage, the localization of the protein in DEF after DEV infection was detected by indirect immunofluorescence assay (IFA) using LORF4 rabbit antiserum as the primary antibody. As shown in Figure 2, the pLORF4 specific fluorescence could be detected in the cytoplasm at 36hpi with a scattered distribution, which is consistent with the observed time phase of the protein expression. As the infection progressed, a small amount of this specific fluorescence was also observed in the nucleus at 60 hpi (Figure 2). No specific fluorescence was observed in uninfected cells. In summary, pLORF4 was mainly localized in the cytoplasm in DEV-infected DEF.Figure 2 The intracellular localization of pLORF4 in DEF infected with DEV. Immunofluorescence microscopy images of pLORF4 (red) at 24, 36, 48 and 60 hpi, DAPI stained cell nuclei (blue), DEF fluorescence microscopy images after merging (MERGE) (scale bar, 20μm), uninfected DEF (Mock), and finally captured on a Nikon fluorescence microscope (TS2FL), the images were processed with NIS Elements software.

Figure 2

Construction and Identification of Recombinant Virus

To study the function of DEV pLORF4, we constructed and rescued, recombinant virus with the full-length LORF4 gene knocked out and traceless (ΔLORF4) and a LORF4 revertant recombinant virus (ΔLORF4-R). The schematic diagram of the construction is shown in Figure 3A. The recombinant virus was sequenced by extracting its DNA, and PCR primers were used to identify the amplification of ΔLORF4. The target band size of ΔLORF4 was about 400 bp, and that of ΔLORF4-R and WT strains was about 1400 bp in size (Figure 3B). We performed restriction fragment length polymorphism (RFLP) analysis using Bam HI and Xho I for ΔLORF4, ΔLORF4-R and WT strains, respectively. The results were consistent with the theoretical predictions, as shown in Figure 3C. To confirm the expression of this protein after knocking out the LORF4 gene, we analyzed the recombinant virus infected DEF by WB analysis and IFA (Figures 3D and 3E). Production of pLORF4 was completely abolished in ΔLORF4 infected DEF. DEV UL51 protein (pUL50) was used as viral protein control and β-actin as loading control. In short, the recombinant virus was successfully constructed and rescued.Figure 3 Construction and identification of recombinant virus. (A) Schematic of recombinant virus construction. (B) PCR identification of recombinant virus. (C) RFLP analysis of the recombinant virus. After the infectious clone plasmid was digested with Bam HI and Xho I, the results of 0.8% agarose electrophoresis showed that only an 8kb band was missing in ΔLORF4 after digestion with Xho I (an asterisk). (D) WB analysis of pLORF4 expression, rabbit anti-LORF4 and UL51 polyclonal antibodies were used as primary antibodies to detect the protein, and β-actin was used as a control. (E) Detection of pLORF4 in virus infected DEF by IFA. DEF infected with indicated viruses were fixed at 48 hpi and then stained with a rabbit anti-LORF4 polyclonal antibody (green) and goat anti-rabbit IgG (H+L) cross-adsorbed secondary antibody, Alexa Fluor 488, and nuclei were visualized using DAPI (blue) (scale bar, 20μm).

Figure 3

Analysis of Growth Kinetics of Recombinant Virus in vitro

To analyze the role of pLORF4 in DEV replication, DEF were infected with different MOI. The results showed that ΔLORF4 did not significantly affect virion replication compared with WT and ΔLORF4-R. However, some inhibition of DEV replication by ΔLORF4 was observed at low MOI at 72 hpi (Figures 4A and 4B). Specifically, at an MOI of 0.01, 72 and 96 hpi, ΔLORF4 showed a significant difference compared to WT, with the virus titer being approximately 10-fold lower (Figure 4A). Conversely, at an MOI of 3.0, there was no significant difference in replication between ΔLORF4 and WT (Figure 4B). The replication of ΔLORF4-R and WT was consistent at both high and low MOI infection doses. The results suggest that pLORF4 inhibited the proliferation of DEV in vitro, particularly at lower MOIs and later time points.Figure 4 Analysis of in vitro growth kinetics of recombinant viruses and the impact of cell to cell spread. (A) Analysis of in vitro growth kinetics of DEVΔLORF4, ΔLORF4-R and WT strains (0.01MOI); (B) In vitro growth kinetics of DEVΔLORF4, ΔLORF4-R and WT strains (3.0MOI), were compared between groups using 2-way ANOVA (ns indicating no significant difference and **** P < 0.0001). (C) Low melting point agarose plaque plot. (D) Image J software was used to analyze the plaque area size map, and 1-way an ANOVA was used to analyze the difference between groups, ns indicates no significant difference.

Figure 4

Effect of pLORF4 Cell to Cell Spread of DEV

To determine the effect of pLORF4 on virus spread from cell to cell, a plaque assay was performed. The results showed that the plaque sizes after infection of DEF by ΔLORF4, ΔLORF4-R and WT were essentially the same (Figure 4C). The plaque area size was measured using Image J software, and statistical analysis indicated no significant difference between the plaque sizes of ΔLORF4, ΔLORF4-R and WT (Figure 4D). These results suggest that pLORF4 is not involved in the cell to cell spread of DEV.

Effects of pLORF4 on DEV Replication in vitro

After infection of DEF with DEV ΔLORF4, ΔLORF4-R, and WT, cell samples were collected for quantitative PCR to detect the viral copy number, and the data were analyzed using GraphPad Prism 8.0 software. The results showed that there was no significant difference in virus copy number among DEF infected with ΔLORF4, ΔLORF4-R, and WT, indicating that pLORF4 deletion did not affect DEV adsorption (Figure 5A). For virus invasion analysis, the same method was employed. The results showed a significant difference in virus copy number between ΔLORF4 and WT infected DEF, while there was no significant difference between ΔLORF4-R and WT infected DEF, indicating that pLORF4 deletion affected DEV invasion (Figure 5B).Figure 5 Effect of recombinant virus replication in vitro. (A) Adsorption of DEVΔLORF4, ΔLORF4-R and WT. (B) Invasion of DEVΔLORF4, ΔLORF4-R and WT. (C) Replication of DEVΔLORF4, ΔLORF4-R and WT (0.01 MOI). (D) Replication of DEVΔLORF4, ΔLORF4-R and WT (1.0 MOI). E. Effects of DEVΔLORF4, ΔLORF4-R, and WT on progeny virus release. Differences between groups were analyzed using 1-way ANOVA (ns indicating no significant difference and * P < 0.05, ***P < 0.001, and *** P < 0.0001).

Figure 5

To investigate the effect of the recombinant virus on virus replication, DEF were infected with DEVΔLORF4, ΔLORF4-R, and WT at the same MOI. The viral copy number was detected by quantitative PCR at 16, 18 and 20hpi. Data analysis revealed a significant difference in viral copy number between ΔLORF4 and WT at 0.01MOI, but no significant difference between ΔLORF4-R and WT (Figure 5C). No significant differences were observed among ΔLORF4, ΔLORF4-R and WT at 1.0 MOI (Figure 5D). These results indicate that pLORF4 deletion affected DNA replication at 0.01 MOI but not at 1.0 MOI.

To confirm the effect of pLORF4 on the release of DEV progeny virus, cells were infected with DEV ΔLORF4, ΔLORF4-R and WT at 1.0 MOI for 24 h. The medium was then replaced with 2% NBS cell maintenance medium, and the supernatant was collected at 1, 2, 3 and 4 hpi to measure the viral titer. Statistical analysis showed that there was no significant difference in progeny virion release among DEV ΔLORF4, ΔLORF4-R and WT (Figure 5E.). These results indicate that deletion of the LORF4 gene does not affect the release of progeny virus.

Ultrastructure of the Recombinant Virus

To analyze the impact of the pLORF4 deletion on the assembly process of DEV, DEF were infected with DEV ΔLORF4, ΔLORF4-R and WT at an MOI of 5. The infected cells were prepared for observation under a transmission electron microscope to visualize the assembly process of the recombinant virus. The DEV particle diameter was about 150∼300 nm. As shown in Figure 6, the transmission electron microscopy results demonstrated that the deletion of pLORF4 had no noticeable effect on the assembly process of DEV. Complete virus particles were observed in cells infected with ΔLORF4, ΔLORF4-R, and WT, indicating that the assembly of DEV can proceed normally without the LORF4 gene.Figure 6 Ultrastructural morphology of the recombinant virus. (A, C, and E) represent the transmission electron microscope observation results of DEF cells infected with DEVΔLORF4, ΔLORF4-R and WT, respectively (scale bar: 2 μm); (B, D, and F) represent partial enlarged images of the transmission electron microscope observation results of A, C, and E, respectively (Scale bar: 500nm), the position pointed by the white arrow is the morphology of the virus.

Figure 6

DISCUSSION

There are some specific ORF genes in the UL and US regions of avian herpesviruses, some of which are critical for viral replication and pathogenesis (Liao et al., 2021). Investigating the functions of proteins encoded by these genes is essential to deepen our understanding of avian herpesvirus biology. Despite existing research on certain ORF genes and their proteins, the function of DEV pLORF4 remains largely unexplored. In a preliminary study used continuous passages in chicken embryonic fibroblasts (CEF) to attenuate the Chinese standard challenge of DEV (DEV CSC) strain. Upon reaching passage 85 (P85), the attenuated strain was compared to the parental strain. This comparison revealed 22 amino acid mutations, one of which involved a change from aspartic acid to glutamic acid at position 101 of pLORF4. The relevance of this specific mutation to the virulence of DEV is still unknow and warrants further investigation (Yang et al., 2017). To advance our understanding of pLORF4, the current study focused on elucidating the basic properties of this protein and assessing the effects of its deletion on viral proliferation. This functional analysis is expected to shed light on the role of pLORF4 in the replication and pathogenicity of DEV.

The study observed the transcription of the LORF4 gene at 12hpi, with the pLORF4 being detectable at 36hpi. This expression pattern aligns with the previously characterized pUL47 gene, known to be a late (L) gene in DEV (He et al., 2020). Given this similarity, it is hypothesized that LORF4 may also function as an L gene in DEV. In the herpesvirus lifecycle, gene transcription occurs in a temporal cascade comprising 3 phases: immediately early (IE), early (E), and late (L) genes. Late genes primarily encode structural proteins necessary for virus assembly and require early gene products for their expression during transcription (Yang et al., 2020). To categorize the LORF4 gene, the study utilized GCV and CHX, which are inhibitors of DNA synthesis and protein synthesis, respectively. The transcription of LORF4 was sensitive to inhibition by both GCV and CHX, consistent with the characteristics of late genes. This sensitivity, along with the observed transcription and expression phases, supports the classification of LORF4 as a late gene in DEV. Furthermore, the localization study showed that pLORF4 is primarily found in the cytoplasm of DEV-infected DEF. This cytoplasmic localization is typical for many late gene products, which are often involved in virion assembly and egress. In all, based on the transcription timing, expression pattern, inhibitor sensitivity, and cytoplasmic localization, LORF4 is likely a L gene in DEV. Understanding its function and the impact of specific mutations, such as the aspartic acid to glutamic acid substitution at position 101, is essential for elucidating its role in viral replication and pathogenesis.

The growth curve analysis revealed that the deletion of the LORF4 gene in the recombinant virus significantly altered its ability to release complete virions within cells. Although the recombinant virus could still replicate following the LORF4 gene deletion, there was a notable decreased in the growth curve between 72 to 96 hpi at an MOI of 0.01. Cell-to-cell spread (CCS), which refers to the transmission of viruses between adjacent cells through specific transport to the cell junctions and subsequent released, is often dependent on conserved viral genes. Understanding these genes functions is crucial for the design of effective vaccines and therapies. CCS has been extensively studied in alpha-herpesviruses. For instance, the UL34 gene in HSV-1 is the first identified “core” herpesvirus gene with a CCS effect (Haugo et al., 2011). Furthermore, HSV-1 pUL51 mutants exhibit more severe CCS effect than gE-deleted viruses, indicating pUL51`s role in epithelial cell spread is independent for gE (Roller et al., 2014). Previous studies reported have indicated that DEV pUL14, pUL48, gJ, gI, pLORF3, and pLORF5 played a role in the CCS (Shen et al., 2023; Wan et al., 2022; You et al., 2018; Zhou et al., 2023). However, our study demonstrated that pLORF4 is not involved in CCS. The viral replication cycle encompasses several stages: adsorption, invasion, DNA replication, nucleocapsid assembly, maturation, and virus release (Owen et al., 2015). In this study, constructed ΔLORF4, ΔLORF4R and WT were used to investigate the effect of deletion of pLORF4 on the DEV replication cycle. The results showed that ΔLORF4 had no effect on virus adsorption and progeny virus release, but had a significant difference in virus invasion and replication. Previous studies have shown that the speed of virus replication is an important factor affecting the virulence of DEV (Shen et al., 2023). Although pLORF4 has been reported to be related to the virulence of DEV (Hu, 2020), the precise mechanisms by which this protein regulates DEV replication remain unclear.

CONCLUSIONS

In summary, this study has determined that the LORF4 gene is classified as a L gene of DEV, and its encoded protein primarily localizes in the cytoplasm and is not essential for virus replication in vitro. In addition, our findings demonstrated that pLORF4 does not affect virus adsorption, assembly, and release, but plays a positive role in virus invasion and DNA replication. These results provided a foundation for further in-depth studies of the function of the LORF4 gene.

DISCLOSURES

The authors declare no conflicts of interest.

Appendix Supplementary materials

Image, application 1

Image, application 2

ACKNOWLEDGMENTS

This work was Supported by China Agriculture Research System of MOF and MARA(CARS-42-17 ), the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2020-18 ).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104275.
==== Refs
REFERENCES

Brunovskis P. Velicer L.F. The Marek's disease virus (MDV) unique short region: alphaherpesvirus-homologous, fowlpox virus-homologous, and MDV-specific genes Virology 206 1995 324 338 7831788
Cui Z.Z. Lee L.F. Liu J.L. Kung H.J. Structural analysis and transcriptional mapping of the Marek's disease virus gene encoding pp38, an antigen associated with transformed cells J. Virol. 65 1991 6509 6515 1658357
Dhama K. Kumar N. Saminathan M. Tiwari R. Karthik K. Kumar M.A. Palanivelu M. Shabbir M.Z. Malik Y.S. Singh R.K. Duck virus enteritis (duck plague)—a comprehensive update Vet. Quart. 37 2017 57 80
Guo Y. Cheng A. Wang M. Shen C. Jia R. Chen S. Zhang N. Development of TaqMan MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1 Virol. J. 6 2009 71 19497115
Haugo A.C. Szpara M.L. Parsons L. Enquist L.W. Roller R.J. Herpes simplex virus 1 pUL34 plays a critical role in cell-to-cell spread of virus in addition to its role in virus replication J. Virol. 85 2011 7203 7215 21561917
He T. Wang M. Cheng A. Yang Q. Jia R. Wu Y. Huang J. Chen S. Zhao X.X. Liu M. Zhu D. Zhang S. Ou X. Mao S. Gao Q. Sun D. Wen X. Tian B. Liu Y. Yu Y. Zhang L. Pan L. Chen X. Duck enteritis virus pUL47, as a late structural protein localized in the nucleus, mainly depends on residues 40 to 50 and 768 to 777 and inhibits IFN-β signalling by interacting with STAT1 Vet. Res. 51 2020 135 33176874
Hu Y. Construction and immune effect evaluation of duck plague virus LORF4-deletion strain 2020 Sichuan Agricultural University Wenjiang, Sichuan
Lee L.F. Wu P. Sui D. Ren D. Kamil J. Kung H.J. Witter R.L. The complete unique long sequence and the overall genomic organization of the GA strain of Marek's disease virus P. Natl. Acad. Sci. USA 97 2000 6091 6096
Liao Y. Sun A. Zhuang G. Lupiani B. Reddy S.M. Deletion of LORF9 but not LORF10 attenuates Marek's disease virus pathogenesis Vet. Microbiol. 251 2020 108911
Liao Y. Lupiani B. Reddy S.M. Latest insights into unique open reading frames encoded by unique long (UL) and short (US) regions of Marek's disease virus Viruses 13 2021 974 34070255
Liu Y. Gao L. Xu Z. Luo D. Zhang Y. Gao Y. Liu C. Zhang Y. Qi X. Cui H. Li K. Wang X. Marek's disease virus RLORF4 inhibits Type I interferon production by antagonizing NF-κB activation J. Virol. 2019 93
Niikura M. Liu H.C. Dodgson J.B. Cheng H.H. A comprehensive screen for chicken proteins that interact with proteins unique to virulent strains of Marek's disease Virus1 Poult. Sci. 83 2004 1117 1123 15285502
Owen D.J. Crump C.M. Graham S.C. Tegument assembly and secondary envelopment of alphaherpesviruses Viruses 7 2015 5084 5114 26393641
Roller R.J. Haugo A.C. Yang K. Baines J.D. The herpes simplex virus 1 UL51 gene product has cell type-specific functions in cell-to-cell spread J. Virol. 88 2014 4058 4068 24453372
Schrag J.D. Cygler M. Lipases and alpha/beta hydrolase fold Methods Enzymol. 284 1997 85 107 9379946
Shen B. Li Y. Cheng A. The LORF5 gene is non-essential for replication but important for Duck plague virus cell-to-cell spread efficiently in host cells Front. Microbiol. 12 2021 744408
Shen B. Ruan P. Cheng A. Wang M. Zhang W. Wu Y. Yang Q. Tian B. Ou X. Mao S. Sun D. Zhang S. Zhu D. Jia R. Chen S. Liu M. Zhao X.X. Huang J. Gao Q. Yu Y. Zhang L. Pan L. Characterization of a unique novel LORF3 protein of Duck plague virus and its potential pathogenesis J. Virol. 97 2023 e0157722
Thureen D.R. Keeler C.L. Psittacid herpesvirus 1 and infectious laryngotracheitis virus: Comparative genome sequence analysis of two avian alphaherpesviruses J. Virol. 80 2006 7863 7872 16873243
Wan J. Li F. Wang M. Cheng A. Tian B. Yang Q. Wu Y. Ou X. Mao S. Sun D. Zhang S. Huang J. Gao Q. Zhao X. Chen S. Liu M. Jia R. Zhu D. The protein encoded by the duck plague virus UL14 gene regulates virion morphogenesis and affects viral replication Poult. Sci. 101 2022 101863
Wu Y. Cheng A.C. Wang M.S. Yang Q. Zhu D.K. Jia R.Y. Chen S. Zhou Y. Wang X.Y. Chen X.Y. Complete genomic sequence of Chinese virulent Duck enteritis virus J. Virol. 86 2012 5965 22532531
Yang C. Li J. Li Q. Li L. Sun M. Li H. Xia Y. Yang H. Yu K. Biological properties of a duck enteritis virus attenuated via serial passaging in chick embryo fibroblasts Arch. Virol. 160 2015 267 274 25392272
Yang C. Zhang B. Li J. Huang X. Liu D. Hou L. Li Q. Li H. Complete genomic sequence of a duck enteritis virus attenuated via serial passage in chick embryos Arch. Virol. 162 2017 3549 3550 28730521
Yang L. Wang M. Zeng C. Shi Y. Cheng A. Liu M. Zhu D. Chen S. Jia R. Yang Q. Wu Y. Zhang S. Zhao X. Huang J. Liu Y. Ou X. Mao S. Yu Y. Zhang L. Tian B. Pan L. Rehman M.U. Chen X. Duck enteritis virus UL21 is a late gene encoding a protein that interacts with pUL16 BMC Vet. Res. 16 2020 8 31915010
You Y. Liu T. Wang M. Cheng A. Jia R. Yang Q. Wu Y. Zhu D. Chen S. Liu M. Zhao X. Zhang S. Liu Y. Yu Y. Zhang L. Duck plague virus Glycoprotein J is functional but slightly impaired in viral replication and cell-to-cell spread Sci. Rep. 8 2018 4069 29511274
Zhou T. Wang M. Ruan P. Fan D. Cheng A. Zhang W. Tian B. Yang Q. Wu Y. Zhang S. Ou X. Mao S. Huang J. Gao Q. Sun D. Zhao X. Chen S. Liu M. Zhu D. Jia R. Research note: Duck plague virus pUL48 is a late protein that plays an important role in viral replication Poult. Sci. 102 2023 102358
