
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00851-4
10.1016/j.psj.2024.104272
104272
IMMUNOLOGY, HEALTH AND DISEASE
Characterization and functional analysis of chicken promyelocytic leukemia protein
Wang Shengnan *†‡
Li Jingwen *†‡
Miao Tiantian *†‡
Li Tuofan *†‡
Wan Zhimin *†‡
Xie Quan *†‡
Shao Hongxia *†‡
Qin Aijian *†‡§
Ye Jianqiang jqye@yzu.edu.cn
*†‡§1
⁎ Key Laboratory of Jiangsu Preventive Veterinary Medicine, Key Laboratory for Avian Preventive Medicine, College of Veterinary Medicine, Ministry of Education, Yangzhou University, Yangzhou, Jiangsu, China 225009
† Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, Jiangsu, China 225009
‡ Joint International Research Laboratory of Agriculture and Agri-Product Safety, the Ministry of Education of China, Yangzhou University, Yangzhou, Jiangsu, China 225009
§ Institutes of Agricultural Science and Technology Development, Yangzhou University, Yangzhou, Jiangsu, China 225009
1 Corresponding author: jqye@yzu.edu.cn
28 8 2024
12 2024
28 8 2024
103 12 10427230 5 2024
22 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
In mammals, promyelocytic leukemia (PML) protein, also named as TRIM19, is the key component of nuclear membrane-less sub structures PML nuclear bodies (PML-NB) or nuclear domains 10 (ND10). PML-NBs are dynamic foci that consist of numerous permanently or transiently associated proteins. The mammalian PMLs are involved in the regulation of various cellular pathways, including apoptosis, intrinsic and innate antiviral immunity, cell cycle, DNA damage, senescence and etc. Nevertheless, little is known about the role of chicken PML (chPML). In this study, chPML gene was cloned, and its several functions were characterized. We found that chPML was widely expressed in different tissues of chickens, and showed different subcellular distribution pattern in DF-1 cells comparing with LMH and HD11 cells. Like human PML, chPML was identified to be SUMOylated. K463 is 1 critical SUMOylation site and 240RARRG244 is SUMO interaction motif (SIM) of chPML. Moreover, qPCR showed that chPML could not only up-regulate the expression of host innate immune factor IFN-β and its downstream ISGs, but also antigen presentation-related factors including class II transactivator (CIITA) and MHC II DM beta 2 (DMB2). Notably, over-expression of chIFN-β could promote the expression of endogenous chPML. All these provide novel insights into the function of chPML, and pave the way for further studying the roles of chPML in biological process and anti-infection function.

Key words

chicken PML
distribution
SUMOylation
IFN-β
MHC II
==== Body
pmcINTRODUCTION

Promyelocytic leukemia nuclear bodies (PML-NB), also referred to as nuclear domains 10 (ND10), are dynamic, membrane-less, spherical, interchromatin speckles with a diameter of 0.1 to 2 μm in a majority of mammalian cell types (Lallemand-Breitenbach and de Thé, 2018; Negorev and Maul, 2001). PML is the organizer of PML-NBs and it plays versatile roles in metabolism, apoptosis, intrinsic and innate antiviral immunity, cell cycle, DNA damage, senescence, tumor response and etc. (Abou-Ghali et al., 2024; Lallemand-Breitenbach and de Thé, 2018). PML-NBs consist of 2 classes of proteins, one of them are permanent NB-associated proteins such as death-associated dead protein (Daxx) and speckled protein of 100 kDa (Sp100), the other is transiently localized proteins like p53. PML-NBs are mainly located in the nuclei of eukaryotic cells (Ryabchenko, et al., 2023). The numbers and morphology of these structures are dependent on the cell type and the cell cycle phase, and also vary according to the stimulus encountered (Ryabchenko, et al., 2023). PML is a member of the tripartite motif (TRIM) protein family that are characterized by the presence of a highly conserved RBCC motif included RING finger, 1 or 2 B-boxes (cysteine/histidine-rich motifs) and an α-helical coiled-coil domain (Neerukonda, 2021). Due to alternative splicing of the human PML gene transcript which consists of 9 exons, at least 7 different PML isoforms (I–VII) are generated, sharing an identical N-terminus but varying in their C-terminus (Tavalai and Stamminger, 2008).

PML is subjected to multiple post-translational modifications including SUMOylation, phosphorylation, ubiquitination, and acetylation. SUMOylation can affect the localization, stability or its binding ability with other partners of PML. The main human PML SUMOylation sites are K65, K160, and K490, although other sites such as K616 have also been reported (Cuchet-Lourenço et al., 2011; Kamitani et al., 1998). SUMOylation is critical for the assembly of PML into macromolecular PML-NBs as PML mutants without SUMOylation are unable to form these structures (Ishov et al., 1999).

Type I/II interferons (IFN) enhance the expression of the PML gene, thereby increasing the number and size of PML-NBs (Ryabchenko et al., 2023). In various cell lines, PML isoforms are increased in response to IFN. PML gene expression is directly induced by IFNs through identified IFN-stimulated response elements (ISRE:-GAGAATCGAAACT-) and gamma-activated site (GAS:-TTTACCGTAAG-) in its promoter (Stadler et al., 1995). On the other side, PML can positively regulate the IFN signaling pathway by interacting with transcription factor complexes to control the expression of IFN and ISGs, increasing the stability of each component and promoting the binding of transcription factors to the promoters (Chen et al., 2015; Kim and Ahn, 2015). Notably, apart from innate immunity, PML is also involved in adaptive immunity. Human PML is required for efficient IFN-γ-induced major histocompatibility complex class II (MHC II) gene transcription through regulation of the class II transactivator (CIITA) (Ulbricht et al., 2012).

Although human PML has been characterized in detail, the characteristics of chicken PML (chPML) remains unclear. In this study, the intact chPML gene was first cloned. The distribution of chPML in chicken tissues and different chicken cell lines was characterized. Moreover, SUMOylation of chPML and the role of chPML in regulating IFN-β signaling and MHC II-associated molecular expression were further analyzed.

MATERIALS AND METHODS

Cell Culture

HEK293T cells and HD11 cells were cultured in Dulbecco's modified Eagle's medium (DMEM, C11995500CP, Gibco) containing 10 % fetal bovine serum (FBS, S711-001S, Lonsera, Uruguay). DF-1 cells were cultured in DMEM with 5% FBS. LMH cells were cultured in DMEM/F-12 (1:1) (C11330500CP, Gibco) containing 10% FBS. All the cell mediums were supplied with 100 U/ml penicillin and 0.1 mg/ml streptomycin. HEK293T, HD11, LMH and DF-1 cells were all kept in our laboratory and cultured in the cell incubator with 5% CO2 at 37°C.

Plasmid Construction

To obtain the complete coding sequence of chPML, total RNA was extracted from DF-1 cells using FastPure Cell/Tissue Total RNA Isolation Kit V2 (RC112, Vazyme, China) according to the protocol. Reverse transcription was performed using Hiscript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R212, Vazyme). According to the predicted sequences of chicken PML (XM_040680517.2 and XM_015279031.4) deposited in GenBank, specific primers (chPML-F: 5′-ATGGAGGCCCGAATTATGCCCGGCAGCCCCGAAGC-3′ and chPML-R: 5′-TACCTCGAGAGATCTTCAGCAAGYAGTGAAGTCCGATGTCAC-3′) were designed. After amplification and purification, the PCR products were cloned into pCMV-HA-N (Clontech) and pCMV-Flag-N (Clontech). chPML variants were amplified from the full length chPML with specific primers and then cloned into pCMV-Flag-N. The resultant plasmids were Flag-chPML (K61R), Flag-chPML (K156R), Flag-chPML (K264R), Flag-chPML (K463R), Flag-chPML (mSIM1), Flag-chPML (mSIM2) and Flag-chPML (mSIM3). Chicken Ubc9 (chUbc9) and chicken SUMO1 (chSUMO1) were amplified from DF-1 cells, and then cloned into pCMV-Myc-N (Clontech) and pCMV-HA-N, respectively. The primers used are summarized in Table 1. The chicken IFN-β eukaryotic expression plasmid was preserved in our lab.Table 1 Primers for plasmid construction.

Table 1Name	Sequence (5′–3′)	
L-PCMV-F	AGATCTCTCGAGGTACCGCG	
L-PCMV-R	AATTCGGGCCTCCATGGCCAT	
Myc-chUbc9-F	ATGGAGGCCCGAATTATGTCTGGCATAGCTCTAAGTAG	
Myc-chUbc9-R	tACCTCGAGAGATCTTTATGATGGTGCAAACTTCTTGGC	
HA-chSUMO1-F
HA-chSUMO1-R
Flag-chPML (K61R)-F	ATGGAGGCCCGAATTATGTCGGACCAGGAAGCAAAGC
tACCTCGAGAGATCTCTAAACTGTTGAGTGACCCCCCG
AGGCTGCTCACCTGCCTGCACACGCTGTGCCT	
Flag-chPML (K61R)-R	GCAGGTGAGCAGCCTCAGGTTGGGCGATTCCTGCCG	
Flag-chPML (K156R)-F	AGGAAGAGGAGCCACGAAGCCAGGAAGGTGGAGGAGC	
Flag-chPML (K156R)-R	GTGGCTCCTCTTCCTAAAGAACCACTGGTGGTCCTCGAAG	
Flag-chPML (K264R)-F	AGAGGGTGGCGCGGCTGGAGGCGGAGG	
Flag-chPML (K264R)-R	GCCGCGCCACCCTCTCCTGCAGCGCCGCGTGC	
Flag-chPML (K463R)-F	AGGCTGGAGCGGGACGGCGGCGAGCCCAG	
Flag-chPML (K463R)-R	GTCCCGCTCCAGCCTCAGCAGCTTGGGTGAGACCTG	
Flag-chPML (mSIM1)-F	AGGGACAACAGGCGGTTCAGCAGCCTGCAGACCCGCC	
Flag-chPML (mSIM1)-R	CCGCCTGTTGTCCCTGTTGGGGATGCCGTCGGGCTGC	
Flag-chPML (mSIM2)-F	CGGGCAAGGCGGGGGCAGGAGCTGGCGCGGC	
Flag-chPML (mSIM2)-R	CCCCCGCCTTGCCCGCTCGTCCTGCCGCCGCTGG	
Flag-chPML (mSIM3)-F	AGCAGAAGAAGAAGCTCGGAGGACAGCGAGGAAGACA	
Flag-chPML (mSIM3)-R	GCTTCTTCTTCTGCTGCTGTCCTCTGCATCCCGAGTGC	

Sequence Analysis

The phylogenetic tree of the different amino acid sequences of PML proteins from different hosts was constructed by MEGA 7.0 software. The GenBank accession numbers of different PML used in this study are XP_040536452.1 (chicken), XP_038040922.1 (duck), NP_150241.2 (human), XP_006510923.1 (mouse), JAA74270.1 (pig), PKK25296.1 (pigeon), and XP_047937470.1 (goose).

RNA Extraction and Reverse Transcription

The RNA from cells cultured in 12-well plate and the homogenates of tissues from 1-day old chicks (n = 3) were extracted using FastPure Cell/Tissue Total RNA Isolation Kit V2 (RC112, Vazyme) following the manufacturer's instructions. After removal of genomic DNA, reverse transcription reactions were performed at 50°C for 15 min and 85°C for 2 min using Hiscript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) (R212, Vazyme).

Quantitative Real-Time PCR

After corresponding RNA was extracted, 1 μg of RNA was reverse-transcribed. Then, real-time PCR (qPCR) was performed in a LightCycler 96 real-time PCR system (Roche, Switzerland), and the relative gene expression levels were normalized to β-actin or 18s rRNA level using the 2−ΔΔCT method. The sequences of primer used are listed in Table 2.Table 2 Primers for qPCR detection.

Table 2Name	Sequence (5′–3′)	
qchPML-F	AAGAAGAGGAGCCACGAAGC	
qchPML-R	CCTGCAGAAGATGCTGGTGA	
β-actin-F	GAGAGAAGATGACACAGATC	
β-actin-R	GTCCATCACAATACCAGTGG	
chIFNβ-F	GCTCTCACCACCACCТТCТC	
chIFNβ-R	GCTTGCTTCTTGTCCTTGCT	
chOASL-F	GAGATAGAGAAGGAGTGGTG	
chOASL-R	GTAGACTGTGGTCTTGTTAC	
chMx1-F	GGAGCAAGTAAACGCCTGAG	
chMx1-R	AGGTTGCTGCTAATGGAGGA	
18s-F	TCAGATACCGTCGTAGTTCC	
18s-R	TTCCGTCAATTCCTTTAAGTT	
chCIITA-F	TGCCCCTGCAGTATCAACAG	
chCIITA-R	CACGCTCCACAGACACAGAT	
chDMB2-F	ATGTTGGTGCTATTGGGGCT	
chDMB2-R	GGGTAGTTGTGACCGGGAAG	

Co-Immunoprecipitation

To identify SUMOylation of chPML and its mutants, Flag tagged chPML or its mutants were co-transfected with Myc tagged chicken Ubc9 and HA tagged chicken SUMO1. To identify the interaction between chPML and chUbc9, Flag tagged chPML or Flag vector was co-transfected with Myc tagged chUbc9. Forty-eight h post-transfection, the cells were harvested and lysed at 4°C for 30 min with RIPA Lysis Buffer (P0013D, Beyotime, China) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, ST505, Beyotime). After centrifugation at 12,000 rpm for 20 min, the supernatant was mixed with 40 μL of Anti-DDDDK-tag mAb-Magnetic Agarose (M185-10, MBL, Japan) and rotated at 4°C for 3 h. Finally, beads were washed 5 times with PBS and boiled in PBS with 1×SDS loading buffer for 10 min. Then, the samples were subjected to Western blot.

Western Blot

Protein samples were separated on SDS-PAGE and transferred onto nitrocellulose (NC) membranes. After blocking in 5% skimmed milk, the NC membranes were then incubated with the indicated primary antibodies for 2 h at room temperature or overnight at 4°C. HA tag Rabbit Polyclonal Antibody (0906-1, HUABIO, China), DDDDK-Tag Rabbit mAb (AE063, ABclonal, China), Myc tag Rabbit Polyclonal Antibody (R1208-1, HUABIO), and anti-chPML monoclonal antibody 4C2 (generated and kept in our laboratory) were used as primary antibodies. Peroxidase AffiniPure Goat Anti-Mouse IgG (H+L) (115-035-003, Jackson ImmunoResearch) or Peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L) (111-035-003, Jackson ImmunoResearch) was used as secondary antibody after 3 washes with PBST. At last, the NC membranes were incubated with Enhanced Chemiluminescent (P10300, NCM Biotech, China) and images were taken using Tanon 5200 chemiluminescence image analysis system.

Confocal Microscopy

Cells grown on confocal plates were fixed with 4% paraformaldehyde for 20 min at room temperature and washed 1 time with 1×PBS. The cells were then permeabilized with 0.2% Triton X-100 and blocked with 3% BSA. Afterwards, the cells were incubated with Mouse anti HA-Tag mAb (AE008, ABclonal) or DDDDK-Tag Rabbit mAb (AE063, ABclonal) as primary antibody at 37°C for 45 min and with FITC labeled Goat Anti-Mouse IgG (H+L) (172-1806, KPL) or Anti-Rabbit IgG (H+L) Antibody (172-1506, KPL) as secondary antibodies at 37°C for 45 min, followed by Hoechst 33342 Stain solution (C0030, Solarbio, China) staining. Finally, the stained cells were viewed under a confocal microscope.

Nuclear-Cytoplasmic Separation

Flag tagged chPML, chPML-K463R, and chPML-mSIM2 were separately transfected into DF-1 cells for 36 h. Nuclear-cytoplasmic separation was performed using a Nuclear and Cytoplasmic Protein Extraction Kit (P0027, Beyotime) as per the manufacturer's instructions. In Western blot, the nuclear and cytoplasmic components were detected by Histone H3 Rabbit pAb (A2348, ABclonal) and GAPDH Mouse mAb (AC002, ABclonal), respectively.

Statistical Analysis

All the result are presented as means ± standard deviations. The statistical analysis here was performed using a Student's t test by GraphPad 8. The P-value refers as below: ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05.

RESULTS

Molecular Cloning, Recombinant Expression, and Sequence Analyses of chPML

Analysis of the predicted coding sequence (CDS) of chPML gene showed that there were 2 possible sequences with a length of 1593 bp, encoding 530 amino acid residues. The nucleotides similarity and amino acids similarity between the 2 sequences were 99.4% and 98.9%, respectively. We cloned full length chPML gene from DF-1 cells and the obtained sequence was the same with GenBank accession no. XM_040680517.2. Western blot results showed that the HA-tagged chPML was effectively expressed in 293T cells (Figure 1A).Figure 1 chPML cloning, expression, and sequence analysis. (A) 293T cells were transfected with 2 μg of HA-chPML or equal amounts of empty vector for 36 h. Transfected cells were harvested and subjected to Western blot analysis. (B) Sequence similarity analysis of PML from different species using MegAlign of Lasergene7.0 (DNAstar). (C) The phylogenetic tree of the different amino acid sequences of PML was constructed using MEGA 7.0 software according to neighbor-joining method. (D) Comparison of the predicted structure of chPML with the structure of human PML. B1 and B2 represent B-box1 and B-box2, respectively. CC means coiled-coil domain.

Figure 1

Human PML is classified into 7 groups, designated PMLI-VII, sharing a common N-terminal region but differing in their C termini due to the alternative splicing of exons 7 to 9 (Jensen, et al., 2001). PML-I, the longest PML isoform was used to perform sequence alignment. Likewise, PML proteins of goose, duck, pigeon, mouse, and pig were selected for amino acid sequence alignments. Multiple alignments results showed that the amino acids similarity between chPML and that of the other 6 species was relatively low and chPML had the highest similarity (61.5%) to pigeon PML (Figure 1B). Phylogenetic analysis based on amino acids showed that PML from different species were clustered into 2 major groups. Birds’ PML formed an independent evolutionary branch while the pigeon PML showed the closest evolutionary relationship to chPML. PML from mammals, including human, pig and mouse were in another group (Figure 1C). To analyze the functional domains of chPML, an online software (https://www.ebi.ac.uk/interpro/) was used. The result showed that chPML also contained a RING domain followed by 2 B-boxes and a coiled-coil domain that defines the characteristic RING-B-boxes-coiled-coil (RBCC)/TRIM motif (Figure 1D), indicating that chPML may have the same function as human PML.

Tissues Expression and Subcellular Distribution of chPML

To evaluate the expression pattern of chPML in different tissues, the mRNA transcription levels of chPML were analyzed by qPCR, and we found that chPML was widely expressed in different tissues, including heart, liver, spleen, lung, kidney, brain, thymus, bursa of Fabricius, muscle, gizzard, and proventriculus (Figure 2A). The transcriptional level of chPML was the lowest in proventriculus and it was the highest in liver among the tissues detected here (Figure 2A). To analyze the sub-cellular distribution of chPML in different chicken cell lines, chPML was over-expressed in LMH, HD11, and DF-1 cells. Intriguingly, in LMH and HD11 cells, chPML was predominantly distributed in the nucleus (mostly probably associated with nucleoli) forming donut-like structures (Figure 2B). To our knowledge, this was the first observation of nearly all the PML distributed like donut under standard growth conditions. In DF-1 cells, chPML showed different localization pattern. chPML formed dots in the nucleus of some DF-1 cells, which were typical PML-NBs structures, while in other DF-1 cells, a few large, hollow circles in the nucleus and dot/donut-like or evenly distributed cytoplasmic chPML were observed (Figure 2C). The different localization of chPML in different cells may be relevant with the cell cycle and cell type.Figure 2 Tissues expression and sub-cellular localization of chPML. (A) qPCR analysis of the relative expression level of chPML in different tissues of 1-day old chicks (n = 3). Data are representative of 3 independent experiments with 3 biological replicates (mean ± SD). ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05. (B–C) LMH, HD11 cells (B) and DF-1 cells (C) were transfected with HA-chPML or Flag-chPML for 36 h, respectively. After staining, the samples were visualized using a confocal microscope under a 63 × oil immersion objective lens. The scale bar represents 5 μm.

Figure 2

Identification of SUMOylation of chPML

To identify whether chPML could be SUMOylated, we performed SUMOylation assay. As described in Figure 3A, the SUMOylated chPML bands with molecular weights of ∼95 kDa to ∼180 kDa could be detected by anti-HA antibody, while the free chPML (∼75 kDa) and SUMOylated chPML (∼95 kDa to ∼180 kDa) could be detected by anti-Flag antibody, demonstrating that chPML could be efficiently attached to SUMO1 molecules. Besides, the interaction between chUbc9 and chPML was confirmed by co-immunoprecipitation (co-IP) (Figure 3B).Figure 3 SUMOylation modification of chPML. (A) Flag-chPML was co-transfected with or without HA-chSUMO1 and Myc-chUbc9 in 293T cells. After 48 h of transfection, co-IP and Western blot were performed using the indicated antibodies. (B) 293T cells were co-transfected with empty vector or Flag-chPML and Myc-chUbc9 for 48 h and analyzed by co-IP and Western blot analysis. (C–D) chPML and its mutants were co-transfected with HA-chSUMO1 and Myc-chUbc9 in 293T cells. After 48 h of transfection, co-IP and Western blot were performed using the indicated antibodies. (E–F) Flag-chPML, Flag-chPML-K463R, Flag-chPML-mSIM2 or empty vector was respectively transfected into 293T cells for 36 h. Nuclear-cytoplasmic separation was performed to detect the distribution of chPML and its mutants.

Figure 3

Ubc9 catalyzes the formation of an isopeptide bond between SUMO and lysine (K) residues of substrates. To identify 4 predicted potential SUMOylation sites of chPML according to GPS-SUMO (https://sumo.biocuckoo.cn/online.php), we generated K61R, K156R, K264R, and K463R chPML mutants by mutating K to arginine (R) and performed SUMOylation assay. As shown in Figure 3C, the SUMOylated K463R chPML bands with molecular weights of ∼95 kDa and ∼130 kDa were undetectable, indicating K463 is 1 critical SUMOylation site of chPML. However, the SUMOylated band with molecular weight of ∼115 kDa was still present after mutating K463 to R, implying that other amino acid residues of chPML may be also important for SUMOylation. As predicted by GPS-SUMO, 99VDNVL103, 240LAVLG244, and 511IIISS515 were potential SUMO interaction motif (SIM) of chPML. mSIM1 (99RDNRR103), mSIM2 (240RARRG244) and mSIM3 (511RRRSS515) chPML mutants were constructed by mutating all the hydrophobic residues to R. As a result of SUMOylation assay, the middle (∼115 kDa) SUMOylation band of mSIM2 was undetectable (Figure 3D), indicating 240LAVLG244 is critical for chPML SUMOylation. Besides, the expression level of mSIM1 was extremely low, showing that 99-103 AA of chPML may be tightly associated with chPML expression or stability.

To identify whether SUMOylation could affect the distribution of chPML, the nuclear-cytoplasmic separation was performed. As a result, more chPML-mSIM2 and K463R were retained in the cytoplasm compared with WT chPML (Figures 3E and 3F).

chPML Up-Regulates IFN-β, ISGs, and MHC II -Related Molecular Expression

To test whether chPML is involved in the regulation of type Ⅰ IFN response, qPCR was performed to detect the mRNA levels of IFN-β and its downstream ISGs (OASL and Mx1) after chPML over-expression. As a result (Figure 4A), chPML could significantly up-regulate IFN-β (∼14 fold), OASL (∼9 fold) and Mx1 (∼9 fold). IFNs are the best characterized inducers of human PML. In consistent with this, over-expression of IFN-β could up-regulate the expression of chPML and the increasing OASL mRNA level indicated that IFN-β stimulation was effective (Figures 4B and 4C). Apart from innate immunity, over-expression of chPML could increase the mRNA level of CIITA (∼2.5 fold) and MHC II DM beta 2 (DMB2) (∼1.8 fold) (Figure 4D), respectively.Figure 4 chPML up-regulates the mRNA levels of IFN-β, OASL, Mx1, CIITA, and DMB2. (A) Flag-chPML or empty vector was transfected into DF-1 cells for 48 h. After subsequent RNA extraction and reverse transcription, the mRNA levels of IFN-β, OASL, and Mx1 were detected by qPCR. (B, C) pcDNA3.1-chicken IFN-β or empty vector was transfected into DF-1 cells for 48 h. Total RNA was extracted and reverse transcription was performed. The mRNA levels of chPML and OASL were detected by qPCR (B). The protein level of endogenous chPML was analyzed by Western blot (C). (D) HA-chPML or HA tagged empty vector was transfected into DF-1 cells for 48 h. qPCR was performed to detect the mRNA levels of CIITA and DMB2. Data are representative of 3 independent experiments with 3 biological replicates (mean ± SD). ****P < 0.0001, ***P < 0.001, **P < 0.01, *P < 0.05.

Figure 4

DISCUSSION

PML is involved in a wide variety of cellular functions, which regulates host antiviral response, tumor response, senescence, apoptosis, etc (Shan, et al., 2024; Mattsson, et al., 2001). Chickens are of great importance in global economy, which are susceptible to many kinds of threats, like viruses and bacteria. Although some studies have studied the role of PML on Marek's disease virus (MDV) pathogenesis, these previous studies only evaluated PML in human cell lines or the transcription level of chPML in MDV-infected chicken tissues (Liao, et al., 2021; Jiang, et al., 2022). Therefore, it is worth studying whether chPML participates in the regulation of chickens’ biological process and anti-infection activity. To elucidate the biological role of chPML, we cloned chPML from DF-1 cells, and found that chPML shared a low amino acid sequence similarity with that from mammals (human, pig, and mouse) and other birds (pigeon, duck, and goose), which showing the highest similarity of 61.5% with that of pigeon (Figure 1B). However, structure prediction demonstrated that like human PML, chPML also contains RBCC domain in its N-terminus, indicating chPML may have similar function with human PML (Figure 1D). Whether these domains serve the same roles in chPML needs to be further investigated. In addition, chPML is widely expressed in different tissues of chickens (Figure 2A). The specific biological significance of differential expression of PML in different tissues also needs to be studied.

Through alternative splicing, at least 7 human PML isoforms (PML I-VII) are generated (Geoffroy and Chelbi-Alix, 2011). On the basis of their length, and numbered accordingly, PML-I is the longest and PML-VII is the shortest. Nuclear localization signal (NLS, located on exon 6) is expressed in PML I-VI and these isoforms are also termed as nuclear isoforms and can localize to the nucleus (Previati et al., 2018; Silonov et al., 2023). Except for NLS, PML-I also contains a nuclear export signal (NES) and consequently is expressed both at cytoplasmic and nuclear level (Previati et al., 2018). The localization of chPML in different chicken cell lines was also analyzed. PML-NBs are usually dot-like, as observed in DF-1 cells (Figure 2C). Intriguingly, in LMH and HD11 cells, most chPML formed donut-like structures in the nucleus (most likely in nucleolus). To our knowledge, this was the first time that nearly all the PML distributed like donut in untreated cells. Reportedly, donut-like PML-NBs were observed in 1% of confluent middle passage human mesenchymal stem cells (a large portion of PML-NBs were still dot-like) under normal growth conditions (Janderovd-Rossmeislova et al., 2007). This kind of donut-like PML-NBs were in close connection with the nucleolus and contained nucleolar proteins (Janderovd-Rossmeislova et al., 2007; Mattsson, et al., 2001). Remarkably, the association of PML with the nucleolus was not found in tumor-derived cells like HeLa, H1299, U-2 OS, A549, and SaOS-2 cell lines under standard growth conditions (Janderovd-Rossmeislova, et al., 2007). All these cells bear various defects (i.e. partial or complete deletion) in tumor suppressors (pRb, ARF, p16, and p53) (Janderovd-Rossmeislova et al., 2007). Donut-like PML-NBs were induced after simultaneous treatment with 5-bromodeoxyuridine (5-BrdU) and distamycin A (DMA) to activate both p53 and pRb tumor suppressor pathways in HeLa and H1299 (Janderovd-Rossmeislova et al., 2007). In contrary to the above study, donut-like PML-NBs were formed in a hepatocellular carcinoma cell line, LMH, and a tumorigenic virus (Avian leukosis virus) induced chicken macrophage-like cell line, HD11. The tumor suppressors might be normally expressed in LMH and HD11 or other mechanisms are involved, which deserve further investigation. When IDH4 cells were arrested in G1, the large donut-like structures or fiber like structures in addition to the spherical bodies were observed (Jiang and Ringertz 1997). Thus, cell cycle may also account for the different distribution pattern of chPML in DF-1 cells.

Human PML is subjected to SUMOylation, and SUMOylation has important consequences on PML functions (Geoffroy and Chelbi-Alix, 2011). K65, K160, K490, and K616 are the main SUMOylation sites of human PML (Cuchet-Lourenço et al., 2011; Kamitani et al., 1998). In this study, K463 and 240LAVLG244 were identified as SUMOylation site and SIM of chPML, respectively (Figures 3C and 3D), and further research should be done to identify if there are other SUMOylation sites and SIM. Besides, when the chPML SUMOylation level was decreased, more chPML was retained in cytoplasm (Figures 3E and 3F), which clearly demonstrates the importance of SUMOylation on chPML localization. The changes of chPML localization may thus affect its interaction with the protein both in the cytoplasm and the nucleus, and thus change its regulatory functions. Future study should focus on the effect of SUMOylation and other modifications of chPML on its regulated functions.

The interplay between PML-NBs and innate immunity was first discovered with the observation that IFN treatment induces an upregulation of several NB proteins, including PML and Sp100, and enhances their antiviral activity (Scherer and Stamminger, 2016). Moreover, IFN signaling can be directly regulated by PML (Kim and Ahn, 2015; Scherer, et al., 2016). PML-II associated with specific transcription factors NF-κB and STAT1, as well as the coactivator CREB-binding protein (CBP), can facilitate transcriptional complex formation at promoters of IFN-β and numerous ISGs (Chen et al., 2015). PML-IV enhances IFN-β synthesis by inducing Pin1 recruitment to PML-NBs, thus preventing the degradation of activated IRF3 (El Asmi et al., 2014; Saitoh et al., 2006). Like human PML, we found that chPML could also positively regulate IFN-β signaling pathway and IFN-β could elevate the expression level of endogenous chPML (Figures 4A-C). However, the underlying mechanism needs further investigation. Reportedly, PML promotes IFN-γ-induced MHC II expression through protection of CIITA from proteasomal degradation (Ulbricht, et al., 2012). In accordance with the above findings, chPML could regulate MHC II-related molecular expression, which indicates chPML may be involved in antigen presentation (Figure 4D). However, since PML and IFN can positively regulate each other (Ryabchenko, et al., 2023; Chen, et al., 2015; Kim and Ahn, 2015), and which host factor plays a negative role in regulating them to prevent excessive immune response needs further exploration.

Taken together, chPML was cloned and expressed in this study, and its partial regulatory function on innate and acquired immunity was demonstrated. Moreover, chPML was identified to be SUMOylated at position K463, and 240RARRG244 of chPML was identified as SIM. However, the specific mechanisms associated with immunity and antiviral effects of chPML need further investigation.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

This study was supported by the National Natural Science Foundation of China (32302839 ), the Basic Research Program of Jiangsu Province (BK20220579 ), Jiangsu Province Agricultural Science and Technology Independent Innovation Fund Project (CX(23)3075), the National Key Research & Development (R&D) Plan (2022YFD1800301 ), the 111 Project (D18007), the Research Foundation for Talented Scholars in Yangzhou University and the Priority Academic Program Development of Jiangsu Higher Education Institutions.
==== Refs
REFERENCES

Abou-Ghali M. Lallemand-Breitenbach V. PML Nuclear bodies: The cancer connection and beyond Nucleus 15 2024 2321265
Chen Y.X. Wright J. Meng X.Q. Leppard K.N. Promyelocytic leukemia protein isoform II Promotes transcription factor recruitment to activate interferon beta and interferon-responsive gene expression Mol. Cell. Biol. 35 2015 1660 1672 25733689
Cuchet-Lourenço D. Boutell C. Lukashchuk V. Grant K. Sykes A. Murray J. Orr A. Everett R.D. SUMO pathway dependent recruitment of cellular repressors to herpes simplex virus type 1 genomes PLoS. Pathog. 7 2011 13
El Asmi F. Maroui M.A. Dutrieux J. Blondel D. Nisole S. Chelbi-Alix M.K. Implication of PMLIV in both intrinsic and innate immunity PLoS. Pathog. 10 2014 18
Geoffroy M.C. Chelbi-Alix M.K. Role of Promyelocytic leukemia protein in host antiviral defense J. Interferon. Cytokine. Res. 31 2011 145 158 21198351
Ishov A.M. Sotnikov A.G. Negorev D. Vladimirova O.V. Neff N. Kamitani T. Yeh E.T.H. Strauss J.F. Maul G.G. PML is critical for ND10 formation and recruits the PML-interacting protein Daxx to this nuclear structure when modified by SUMO-1 J. Cell. Biol. 147 1999 221 233 10525530
Janderovd-Rossmeislova L. Novakova Z. Vlasakova J. Phillmonenko V. Hozak P. Hodny Z. PML protein association with specific nucleolar structures differs in normal, tumor and senescent human cells J. Struct. Biol. 159 2007 56 70 17428679
Jensen K. Shiels C. Freemont P.S. PML protein isoforms and the RBCC/TRIM motif Oncogene 20 2001 7223 7233 11704850
Jiang B. Wang J. Cao M.Y. Jin H. Liu W.X. Cheng J. Zhou L.Y. Xu J. Li Y.Q. Differential replication and cytokine response between vaccine and very virulent Marek's disease viruses in spleens and bursas during latency and reactivation Viruses 15 2022 6 36680047
Jiang W.-Q. Ringertz N. Altered distribution of the promyelocytic leukemia-associated protein is associated with cellular senescence Cell. Growth. Differ. 8 1997 513 522 9213441
Kamitani T. Kito K. Nguyen H.P. Wada H. Fukuda-Kamitani T. Yeh E.T.H. Identification of three major sentrinization sites in PML J. Biol. Chem. 273 1998 26675 26682 9756909
Kim Y.E. Ahn J.H. Positive role of promyelocytic leukemia protein in type I interferon response and its regulation by human cytomegalovirus PLoS. Pathog. 11 2015 24
Lallemand-Breitenbach V. de Thé H. PML nuclear bodies: From architecture to function Curr. Opin. Cell. Biol. 52 2018 154 161 29723661
Liao Y. Lupiani B. Reddy S.M. Manipulation of promyelocytic leukemia protein nuclear bodies by Marek's disease virus encoded us3 protein kinase Microorganisms 9 2021 685 33810320
Mattsson K. Pokrovskaja K. Kiss C. Klein G. Szekely L. Proteins associated with the promyelocytic leukemia gene product (PML)-containing nuclear body move to the nucleolus upon inhibition of proteasome-dependent protein degradation Proc. Natl. Acad. Sci. U S A. 98 2001 1012 1017 11158586
Neerukonda S.N. Interplay between RNA viruses and promyelocytic leukemia nuclear bodies Vet. Sci. 8 2021 17 33499429
Negorev D. Maul G.G. Cellular proteins localized at and interacting within ND10/PML nuclear bodies/PODs suggest functions of a nuclear depot Oncogene 20 2001 7234 7242 11704851
Previati M. Missiroli S. Perrone M. Caroccia N. Paliotto F. Milani D. Giorgi C. Functions and dys-functions of promyelocytic leukemia protein PML Rend. Lincei.-Sci. Fis. Nat. 29 2018 411 420
Ryabchenko B. Sroller V. Horníková L. Lovtsov A. Forstová J. Huérfano S. The interactions between PML nuclear bodies and small and medium size DNA viruses Virol. J. 20 2023 20 36739398
Saitoh T. Tun-Kyi A. Ryo A. Yamamoto M. Finn G. Fujita T. Akira S. Yamamoto N. Lu K.P. Yamaoka S. Negative regulation of interferon-regulatory factor 3-dependent innate antiviral response by the prolyl isomerase Pin1 Nat. Immunol. 7 2006 598 605 16699525
Shan L. Li P. Yu H. Chen L.-L. Emerging roles of nuclear bodies in genome spatial organization Trends. Cell. Biol. 34 2024 595 605 37993310
Silonov S.A. Smirnov E.Y. Kuznetsova I.M. Turoverov K.K. Fonin A.V. PML body biogenesis: A delicate balance of interactions Int. J. Mol. Sci. 24 2023 16702 38069029
Stadler M. Chelbi-Alix M.K. Koken M.H.M. Venturini L. Lee C. Saib A. Quignon F. Pelicano L. Guillemin M.-C. Schindler C. De The H. Transcriptional induction of the PML growth suppressor gene by interferons is mediated through an ISRE and GAS element Oncogene 11 1995 2565 2573 8545113
Tavalai N. Stamminger T. New insights into the role of the subnuclear structure ND10 for viral infection Biochim. Biophys. Acta Mol. Cell. Res. 1783 2008 2207 2221
Ulbricht T. Alzrigat M. Horch A. Reuter N. von Mikecz A. Steimle V. Schmitt E. Krämer O.H. Stamminger T. Hemmerich P. PML promotes MHC class II gene expression by stabilizing the class II transactivator J. Cell. Biol. 199 2012 49 63 23007646
