
==== Front
J Vet Res
J Vet Res
jvetres
jvetres
Journal of Veterinary Research
2450-7393
2450-8608
Sciendo

39318522
jvetres-2024-0049
10.2478/jvetres-2024-0049
Article
Molecular analysis of Anaplasma ovis, Theileria ovis and Brucella abortus in adult Ornithodoros lahorensis soft ticks (Acari: Ixodida: Argasidae) isolated from the Xinjiang Uygur Autonomous Region, China
https://orcid.org/0009-0006-9162-2076
Liu Dandan
https://orcid.org/0000-0001-6542-7409
Wang Jinming
https://orcid.org/0009-0003-0033-8810
Liu Yutong
https://orcid.org/0009-0007-5665-0220
Wang Shuiyi
https://orcid.org/0009-0003-5786-9823
Zhu Huiru
https://orcid.org/0009-0000-2597-7318
Jiang Bingbing
https://orcid.org/0009-0001-9970-0765
Li Yongchang
https://orcid.org/0009-0001-6757-9884
Zhang Yang
https://orcid.org/0000-0003-3343-6057
Chahan Bayin
https://orcid.org/0009-0001-5872-6096
Zhang Wei zw2017xjau@163.com

College of Veterinary Medicine, Xinjiang Agricultural University, Ürümqi, 830052, China
23 9 2024
9 2024
68 3 355361
21 2 2024
3 9 2024
© 2024 Dandan Liu et al., published by Sciendo
2024
Dandan Liu et al., published by Sciendo
https://creativecommons.org/licenses/by-nc-nd/3.0/ This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Abstract

Introduction

Ticks are obligate blood-feeding arthropods that cause significant economic losses in domestic animal husbandry and threaten public health. However, information about soft ticks (Acari: Argasidae) and tick-borne pathogens in the Xinjiang Uygur Autonomous Region (XUAR) of China is scarce.

Material and Methods

In this study, PCR assays and gene sequencing were used to detect and analyse the epidemiological features of Anaplasma ovis, Theileria ovis and Brucella abortus parasitic infections in 366 Ornithodoros lahorensis soft ticks collected from five sampling sites in the XUAR from October 2019 to March 2022. The ticks were identified by morphological and molecular methods as O. lahorensis. The PCR was conducted using primers complementary to the major surface protein 4 (Msp4) gene of A. ovis, the 18S ribosomal RNA (18S rRNA) of T. ovis and the outer membrane protein 22 (Omp22) gene of B. abortus.

Results

The overall infection rate was 91/366 (24.9%) for A. ovis, 127/366 (34.7%) for T. ovis and 94/366 (25.6%) for B. abortus. Sequencing analysis indicated that A. ovis Msp4, T. ovis 18S rRNA and B. abortus Omp22 genes from XUAR isolates showed 99.58–100% identity with documented isolates from other countries.

Conclusion

This study provides fundamental evidence for the occurrence of A. ovis, T. ovis and B. abortus in O. lahorensis. Therefore, the potential threat of soft ticks to livestock and humans should not be ignored. This study expands the understanding of the existence of tick-borne pathogens in O. lahorensis and is expected to improve the strategies for prevention and control of ticks and tick-borne diseases in China.

Keywords

Ornithodoros lahorensis
tick-borne pathogens
Anaplasma ovis
Theileria ovis
Brucella abortus
==== Body
pmcIntroduction

As obligate blood-feeding arthropods, ticks are currently considered to be second only to mosquitoes as vectors of human, domestic and wild animal infectious diseases in the world, and they have caused significant economic losses in livestock farming and threatened public health. Ticks are monophyletic and comprise the Ixodidae, Argasidae and Nuttalliellidae families, in which approximately 900 species have been identified worldwide. Up to the present time, approximately 10% of the tick species currently known have been reported to act as vectors of numerous pathogens, including viruses, bacteria, protozoa and helminths. Generally, each tick species has its preferred environmental conditions and biotopes, which distributes ticks and the risk areas for particular tick-borne diseases heterogeneously over the world.

Besides the Ixodidae (hard ticks), the Argasidae (soft ticks) also have high medical significance. The Argasidae differ from the Ixodidae by having no scutum on the dorsum. This family survives at high temperatures and under relatively dry conditions, resists starvation, lives nidicolously in the nests, burrows and caves of vertebrate animals or in human and livestock habitations, and takes short-duration bloodmeals. The preference of Argasidae for sheltered microhabitats and their characteristically short blood feeding duration usually hides their presence, permitting their threat to human and animal health to generally be ignored. The Argasidae family is a complex and diverse assemblage of four genera and 183 species, namely Argas, Carios, Ornithodoros and Otobius, and at least 11 species in twc genera (Ornithodoros and Argas) have been reported in China. Typically, the argasid ticks of recognised medical and veterinary importance belong to the Argas, Ornithodoros and Otobius genera. As haematophagous arthropods, in addition to harming the host while sucking blood through causing, for instance, toxicosis, paralysis, irritation, allergies and blood loss, argasid ticks can spread a variety of tick-borne disorders, including human tick-borne relapsing fever, viral encephalitis, African swine fever, fowl spirochaetosis or anaplasmosis-like diseases and epizootic bovine abortion syndrome.

Ornithodoros lahorensis is a species of argasid tick which infests large domestic animals and can usually be collected from sheep, camels, cattle, goats, horses and donkeys. In these animal hosts, O. lahorensis can induce anaemia, toxic reactions and paralysis. More importantly, it has strong vectorial capacity for several pathogens. As far as we know, O. lahorensis may carry or transmit the Crimean–Congo haemorrhagic fever virus, Rickettsia sibirica, Rickettsia conorii, Brucella abortus, Francisella tularensis and Coxiella burnetii. However, there have been few relevant research undertakings into O. lahorensis and associated tick-borne pathogens in China, and pathogens of only three genera (i.e. Theileria spp., Anaplasma spp. and Babesia spp.) have been reported in studies so far.

The Xinjiang Uygur Autonomous Region (XUAR) is the largest administrative division of China, occupying one-sixth of its mainland and having an area of approximately 1,660,000 km2. It is halfway along the old Silk Road between eastern Asia and Europe and borders eight countries; therefore, international livestock trade is frequent in the XUAR. The complex geographical and diverse ecological environments, including the Gobi Desert, valleys, mountains, grassland and flatland, provide a natural habitat for ticks, making the XUAR one of the regions in China with the largest tick diversity.

Previous studies have mainly focused on ixodid ticks and ixodid tick–borne pathogens, and the potential threats of argasid ticks and argasid tick–borne pathogens to animal husbandry and public health have been underestimated. At least seven species of argasid tick have been identified in the XUAR alone, Ornithodoros lahorensis being the dominant one. In order to further investigate the vectorial capacity and pathogen burden of O. lahorensis, 366 adult O. lahorensis from five main habitats in the XUAR were collected and identified in the present study. In addition, molecular techniques were utilised to assess the presence of O. lahorensis-associated pathogens, namely Anaplasma ovis, Theileria ovis and Brucella abortus. To the best of our knowledge, this is the first experimental report of Brucella abortus in O. lahorensis from China.

Material and Methods

Tick collection

Adult O. lahorensis (n = 366) were collected in Shanshan County of Turpan City (n = 209), Awat County of Aksu City (n = 93), Hejing County of the Bayingolin Mongol Autonomous Prefecture (n = 24), and Yutian County (n = 20) and Qira County (n = 20) of Hetian City in the XUAR in China from October 2019 to March 2022 (Fig. 1 and Table 1). The samples were collected from the body surface (neck, back, axillary and thoracic regions) of sheep and were preserved in tubes containing moistened absorbent cotton. Subsequently, the samples were transported to the laboratory of the College of Veterinary Medicine at Xinjiang Agricultural University and identified by morphological and molecular methods. Briefly, preliminary identification was performed under a stereo microscope by the characteristics of the dorsal cuticle, anus, Haller’s organ, hypostome, spiracle and gonopore. Then the 16S rDNA genes of the ticks were amplified and the tick species were identified by sequence alignment.

Fig. 1. Map of the Xinjiang Uygur Autonomous Region (XUAR), China. The black dots indicate localities where samples were collected

Table 1. Collection of Ornithodoros lahorensis soft tick samples in the Xinjiang Uygur Autonomous Region, China

Collection date	Collection season	Region	Number of samples collected	Altitude (m), latitude and longitude	
Oct. 2020 and Mar. 2021	Autumn and spring	Shanshan	209	979; 42°82′ N, 90°25′ E	
Mar.–Apr. 2021	Spring	Awat	93	1028; 40°76′ N, 80°25′ E	
Oct. 2019	Autumn	Hejing	24	1100; 42°32′ N, 86°38′ E	
Mar. 2022	Spring	Yutian	20	1628; 36°41′ N, 81°29′ E	
Mar. 2022	Spring	Qira	20	1361; 37°3′ N, 80°46′ E	

DNA isolation

Fasting tick samples were ultrasonically washed in 70% ethanol for 30 min and washed with phosphate-buffered saline solution for 10 min. After drying, the tick samples were put into a porcelain mortar with liquid nitrogen and ground to a fine powder. A TIANamp Genomic DNA Kit (Tiangen Biotech Co., Ltd, Beijing, China) was used to isolate genomic DNA of each tick, following the manufacturer’s instructions, and the resulting DNA samples were stored at -20°C until subsequent use.

Pathogen detection

All the samples were screened with species-specific primers for Anaplasma ovis, Theileria ovis and Brucella abortus by PCR analysis (Table 2). The PCR reaction mixture (25 μL) was composed of 1 μL of the stored DNA templates, 1 μL of forward and reverse primers (10 μM), 12 μL of 2× EasyTaq PCR SuperMix (TransGen Biotech, Beijing, China) and 10 μL of nuclease-free water. The PCR products were subjected to 1% agarose gel electrophoresis, stained with ethidium bromide and then visualised under UV light.

Table 2. PCR amplification of genetic material of pathogens isolated from Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

Pathogen	Target gene/region	Primer (5′–3′)	EPS (base pairs)	AT (°C)	Reference	
Anaplasma ovis	Msp4	Forward: CGCCTGCTCCCTACTTGTT	322	58	(13)	
Reverse: TTCCACTCTGGCTCCTCCT	
Theileria ovis	18S rRNA	Forward: TCGAGACCTTCGGGT	520	52	(1)	
Reverse: TCCGGACATTGTAAAACAAA	
Brucella abortus	Omp2	Forward: TGATGGGAGGGACCGACTA	494	55	(24)	
Reverse: TGGTTCTTCAGGTTGTTACGC	
Msp 4 – major surface protein 4; 18S rRNA – 18 Svedberg ribosomal RNA; EPS – expected product size; AT – annealing temperature

Sequencing and phylogenetic analysis

All the evaluated amplification products were sequenced with an ABI PRISM 3730 XL DNA Analyzer (Applied Biosystems, Carlsbad, CA, USA), and the generated sequences were subsequently aligned using the NCBI nucleotide database (http://www.ncbi.nlm.nih.gov/nuccore/) and MEGA version X (20). In order to analyse the phylogenetic relationships, the gene sequences of Anaplasma ovis, Theileria ovis and Brucella abortus from different regions were downloaded from GenBank, and phylogenetic trees were constructed using the maximum likelihood algorithm in MEGA version X.

Results

Overall infection rate

The PCR assays revealed that out of the 366 samples, 256 (69.9%) carried one or two pathogens. Detailed tick-borne pathogen infection data are provided in Table 3. The highest rate was for infection with T. ovis at 34.7%, followed by the rate for infection with B. abortus at 25.6%), the A. ovis infection rate being 24.9%. The infection rates of the three pathogens showed obvious regional differences (Table 3).

Table 3. Prevalence of pathogens detected in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

	Prevalence (%)	
Pathogen	Shanshan (n = 209)	Awat (n = 93)	Hejing (n = 24)	Yutian (n = 20)	Qira (n = 20)	Overall (n = 366)	
Anaplasma ovis	28.2 (59/209)	23.6 (22/93)	0 (0/24)	40.0 (8/20)	10.0 (2/20)	24.9 (91/366)	
Theileria ovis	45.0 (94/209)	35.5 (33/93)	0 (0/24)	0 (0/20)	0 (0/20)	34.7 (127/366)	
Brucella abortus	24.4 (51/209)	39.8 (37/93)	25.0 (6/24)	0 (0/20)	0 (0/20)	25.6 (94/366)	

Co-infection analysis

Rate data for co-infection with two of the three pathogens were also analysed. No infection with all three pathogens simultaneously was detected. In total, 56 (15.3%) ticks bore two pathogens. The most common co-infection was with A. ovis and T. ovis, accounting for 6.8% of the 366 tick samples, followed by T. ovis + B. abortus (5.2%) and A. ovis + B. abortus (3.3%) (Table 4).

Table 4. Prevalence of single and co-infection with one or more of Anaplasma ovis, Theileria ovis and Brucella abortus in Ornithodoros lahorensis soft ticks in the Xinjiang Uygur Autonomous Region, China

	Pathogen	Number of positive samples/percentage (%)	
Single infection	Anaplasma ovis	54/366 (14.8)	
Theileria ovis	83/366 (22.7)	
Brucella abortus	63/366 (17.2)	
Co-infection	A. ovis + T. ovis	25/366 (6.8)	
T. ovis + B. abortus	19/366 (5.2)	
A. ovis + B. abortus	12/366 (3.3)	
A. ovis + T. ovis + B. abortus	0/366 (0)	

Comparative gene sequence analyses and phylogenetic analysis

All the tested amplicons of A. ovis, T. ovis and B. abortus were of the expected sizes of 322 bp, 520 bp or 494 bp, respectively, and all the sequences of a particular pathogen were identical. The major surface protein 4 (Msp4) gene sequence of A. ovis, the 18 Svedberg ribosomal RNA (18S rRNA) gene sequence of T. ovis and the outer membrane protein 22 gene sequence (Omp22) of B. abortus were all deposited to GenBank with the accession numbers OL769317, OL774380 and OL769318, respectively. Phylogenetic analysis indicated that the Msp4 gene sequence of A. ovis in this study and another three sequences of the same gene isolated from samples from different geographical regions grouped together in one clade, with identity of 99.65% (Fig. 2). Similarly, the 18S rRNA gene sequence of T. ovis in this study belonged to the same cluster as sequences from another eight isolates of T. ovis, with identity ranging from 99.58% to 100% (Fig. 3). Regarding the Omp22 gene sequence of B. abortus, the identity between OL769318 which was tested in this study and the Brucella abortus strains XUAR1 and XUAR2 was 100% (Fig. 4).

Fig. 2. The phylogenetic analysis of Anaplasma ovis identified in this study based on the Msp4 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 3. The phylogenetic analysis of Theileria ovis identified in this study based on the 18S rRNA gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Fig. 4. The phylogenetic analysis of Brucella abortus identified in this study based on the Omp22 gene sequences. The tree was constructed using the maximum likelihood method. The numbers at nodes represent the percentage occurrence of the clade in 1,000 bootstrap replications. The sequence from this study is indicated by a black dot

Discussion

As the dominant argasid tick species of the Ornithodoros genus in China, Ornithodoros lahorensis is widely distributed in the XUAR, especially in the regions around the Tarim Basin. As indicated by epidemiological investigation, O. lahorensis is mainly found in the Palaearctic region, including the five countries of central Asia, Russia, Georgia, Ukraine, Pakistan, Afghanistan, Iran, India and China (26, 34, 37). Regarding the ecology, the larvae of these ticks were reported to usually attach to hosts during the autumn or winter and the final nymph instars to moult to adults in the spring (15). In conformance with this seasonal pattern, according to Zhao et al. (41), O. lahorensis were collected from late February to early April in the XUAR – they only occurred in spring. However, in our research, besides their being found in spring, adult and nymph argasid ticks were also sampled in the autumn from the regions of Hejing and Shanshan (Table 1). Comparing annual temperature data for these two sampling sites, we found that the average temperatures in spring (4–18.5°C in March) and autumn (4–21°C in October) were almost the same, indicating that there might be two suitable seasons for O. lahorensis to moult to adults in the XUAR.

Anaplasma ovis is a tick-borne obligatory intraerythrocytic bacterium which can lead to ovine anaplasmosis, and usually infects sheep, goats and wild ruminants in tropical and subtropical regions. In general, the infection is subclinical; however, the acute phase can produce the symptoms of fever, progressive anaemia, icterus, weight loss and milk yield decrease, and can sometimes cause death (5). According to Chochlakis et al. (6), in 2007, a 27-year-old woman became infected with A. ovis after a tick bite in Cyprus, demonstrating that A. ovis is a zoonotic parasite. In 2018, O. lahorensis was first reported as a potential vector of A. ovis in the XUAR (41); however, the evidence was only derived from one sampling site of Uqturpan County of Aksu City, and the infection rate reports were lacking in detail. In this study, A. ovis was detected from O. lahorensis ticks collected from four sites around the Tarim Basin omitting Uqturpan, with a total carrier rate of 24.9%, which further indicated the important role for O. lahorensis as a vector of A. ovis. Among the five different sampling sites of Shanshan, Awat, Hejing, Yutian and Qira, O. lahorensis was only negative for A. ovis in Hejing. Further analysis found that only in the Hejing region was the sampling season the autumn, indicating that the A. ovis which was carried by O. lahorensis might be more prevalent in spring than in autumn.

Theileria ovis, a tick-borne haemoprotozoan parasite, is a global livestock pathogen that can cause ovine theileriosis, which is a significant infectious disease affecting small ruminants (2). In China, T. ovis was first reported in 2011 in the XUAR, when its transmission vector was demonstrated to be Hyalomma anatolicum anatolicum (22). Zhao et al. (43) first found T. ovis in O. lahorensis from the southern part of the XUAR in 2020, and revealed that the infection rates were 42.86% in Kashgar and 26% in Aksu. Subsequently, Li et al. (21) confirmed that T. ovis was distributed in the southern part of the XUAR in 2023, but the infection rate of O. lahorensis with the parasite was only 1.5% (5/330). However, in the present study, the overall rate for this soft tick to bear T. ovis was 22.7% (83/366), which was in agreement with the data of Zhao et al. (43). Interestingly, in this study, O. lahorensis which were collected from Shanshan (45.0%) and Awat (35.5%) were positive for T. ovis, but specimens from the other three sampling areas were negative. The positive regions are at the lowest altitude among the five sampling areas; therefore, the reason for the different prevalence of T. ovis in different areas might be the altitude of the sampling sites. This potential correlation still needs further research.

Brucellosis is one of the most important zoonotic diseases caused by Gram-negative bacteria belonging to the Brucella genus (8). Among all Brucella species, B. melitensis and B. abortus are the most pathogenic and virulent (10, 11, 18). As the main intracellular causative pathogen of brucellosis in cattle, Brucella abortus generally causes abortion and infertility in adult animals and is also an important cause of chronic infection in humans (7). According to Balashov (4) and Rodríguez et al. (31) Brucella could be cultivated from multiple tick species. Additionally, B. abortus which was cultivated from Boophilus annulatus hard ticks could be recultivated from the blood and organs of guinea pigs infected by tick bite (36). Similarly, Wang et al. (38) demonstrated that there was transovarial transmission of Brucella in Dermacentor marginatus. However, the current data are too scarce to clarify the relationship between B. abortus and Argasidae. According to Philip and Burgdorfer (29), in 1955 fasting O. lahorensis were found infected with Brucella abortus in areas where infected sheep had been kept one year before. Also, in 1962 the preservation of vaccinal strains of B. abortus 19-BA in O. lahorensis was reported (32). Since then, there has been no relevant experiment evidence found to demonstrate the relationship between O. lahorensis and Brucella. In 2020, Li et al. (24) tested 12 Ixodidae species collected from six counties in the XUAR and found that the infection rate with Brucella spp. was 26.2%. The present study gave a similar finding in Argasidae ticks: we found that O. lahorensis were positive for B. abortus in Shanshan, Awat and Hejing in the XUAR with an overall infection rate of 25.6%. Interestingly, B. abortus was not detected from the tick samples collected in Yutian and Qira, which had relatively high altitude and low latitude compared with the other regions.

Mixed infections of O. lahorensis involving more than one pathogen were observed in the present study. Most co-infections were caused by A. ovis + T. ovis or T. ovis + B. abortus. Although clinical cases were not observed in any of the sheep from which the O. lahorensis were collected, it is possible that animals infected with multiple pathogens may have more pronounced clinical signs or haematological abnormalities than those infected with single pathogens. It is suggested that A. ovis, B. abortus and T. ovis are potential pathogens that cause mixed infections in the sheep population of the XUAR.

Conclusion

This study revealed the existence of A. ovis, B. abortus and T. ovis in O. lahorensis collected from Shanshan, Awat, Hejing, Yutian and Qira, in the XUAR, China from October 2019 to March 2022. The current data determined the prevalence rates of the detected pathogens in O. lahorensis in that region and suggest the possible emergence of tick-borne diseases in local animals. This study also broadens the potential vector spectrum for these pathogens, and its findings imply that the role of Argasidae in disease transmission should not be ignored.

Conflict of Interests Statement: The authors declare that there is no conflict of interests regarding the publication of this article.

Financial Disclosure Statement: This research was funded by the National Natural Science Foundation of China (No. 32060803) and the Xinjiang Uygur Autonomous Region Natural Science Foundation Project (No. 2022D01A166).

Animal Rights Statement: All of the required procedures for the sample collection were carried out applying the ethical guidelines for the use of animal samples and were permitted by the Ethics Committee of Xinjiang Agricultural University, Xinjiang, China (Animal Experiment Permit No. 2018006).
==== Refs
References

1. Aktas M. Altay K. Dumanli N. : PCR-based detection of Theileria ovis in Rhipicephalus bursa adult ticks . Vet Parasitol 2006 , 140 , 259 – 263 , doi: 10.1016/j.vetpar.2006.04.005 . 16682122
2. Al-Hosary A.A. ElSify A. Salama A.A. Nayel M. Elkhtam A. Elmajdoub L.O. Rizk M.A. Hawash M.M. Al-Wabel M.A. Almuzaini A.M. Ahmed L.S.E.D. Paramasivam A. Mickymaray S. Omar M.A. : Phylogenetic study of Theileria ovis and Theileria lestoquardi in sheep from Egypt: Molecular evidence and genetic characterization . Vet World 2021 , 14 , 634 – 639 , doi: 10.14202/VETWORLD.2021.634-639 . 33935408
3. Bakkes D.K. de Klerk D. Latif A.A. Mans B.J. : Integrative taxonomy of Afrotropical Ornithodoros (Ornithodoros) (Acari: Ixodida: Argasidae) . Ticks Tick Borne Dis 2018 , 9 , 1006 – 1037 , doi: 10.1016/j.ttbdis.2018.03.024 . 29625921
4. Balashov Yu.S. : Blood sucking ticks (Ixodoidea)—vectors of diseases of man and animals . Misc Publ Entomol Soc Am 1972 , 8 .
5. Ben Said M. Belkahia H. Messadi L. : Anaplasma spp . in North Africa: A review on molecular epidemiology, associated risk factors and genetic characteristics. Ticks Tick Borne Dis 2018 , 9 , 543 – 555 , doi: 10.1016/j.ttbdis.2018.01.003 . 29398602
6. Chochlakis D. Ioannou I. Tselentis Y. Psaroulaki A. : Human anaplasmosis and Anaplasma ovis variant . Emerg Infect Dis 2010 , 16 , 1031 – 1032 , doi: 10.3201/eid1606.090175 . 20507768
7. Corbel M.J. : Brucellosis in humans and animals , edited by Corbel M.J. Elberg S.S. Cosivi O. , WHO Press , Geneva, Switzerland , 2006 .
8. Dorneles E.M.S. Sriranganathan N. Lage A.P. : Recent advances in Brucella abortus vaccines . Vet Res 2015 , 46 , 76 , doi: 10.1186/s13567-015-0199-7 . 26155935
9. Estrada-Peña A. Jongejan F. : Ticks feeding on humans: A review of records on human-biting Ixodoidea with special reference to pathogen transmission . Exp Appl Acarol 1999 , 23 , 685 – 715 , doi: 10.1023/A:1006241108739 . 10581710
10. Garin-Bastuji B. Oudar J. Richard Y. Gastellu J. : Isolation of Brucella melitensis biovar 3 from a chamois (Rupicapra rupicapra) in the southern French Alps . J Wildl Dis 1990 , 26 , 116 – 118 , doi: 10.7589/0090-3558-26.1.116 . 2304191
11. Gradwell D.V. Schutte A.P. van Niekerk C.A. Roux D.J. : The isolation of Brucella abortus biotype I from African buffalo in the Kruger National Park . J S Afr Vet Assoc 1977 , 48 , 41 – 43 , https://hdl.handle.net/10520/AJA00382809_4663 . 406393
12. Gray J.S. Dautel H. Estrada-Peña A. Kahl O. Lindgren E. : Effects of Climate Change on Ticks and Tick-Borne Diseases in Europe . Interdiscip Perspect Infect Dis 2009 , 2009 , 593232 , doi: 10.1155/2009/593232 . 19277106
13. Han R. Yang J. Liu Z. Gao S. Niu Q. Hassan M.A. Luo J. Yin H. : Characterization of Anaplasma ovis strains using the major surface protein 1a repeat sequences . Parasit Vectors 2017 , 10 , 447 , doi: 10.1186/s13071-017-2363-6 . 28962625
14. Hoogstraal H. : Argasid and Nuttalliellid Ticks as Parasites and Vectors . Adv Parasitol 1985 , 24 , 135 – 238 , doi: 10.1016/S0065-308X(08)60563-1 . 3904345
15. Hoogstraal H. Wassef H.Y. Diab F.M. Al-Asgah N.A. Al-Khalifa M.S. : Acarina of Saudi Arabia: Ornithodoros (Alveonasus) laborensis (Fam . Argasidae) in Saudi Arabia: biological, veterinary, and medical implications. Fauna Saudi Arab 1984 , 6 , 166 – 169 .
16. Horak I.G. Camicas J.-L. Keirans J.E. : The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida): A world list of valid tick names . Exp Appl Acarol 2002 , 28 , 27 – 54 , doi: 10.1023/A:1025381712339 . 14570115
17. Jongejan F. Uilenberg G. : The global importance of ticks . Parasitology 2004 , 129 , S3 – S14 , doi: 10.1017/S0031182004005967 . 15938502
18. Khosravi A.D. Abassi E. Alavi S.M. : Isolation of Brucella melitensis and Brucella abortus from brucellosis patients by conventional culture method and polymerase chain reaction technique . Pak J Med Sci 2006 , 22 , 369 – 400 .
19. Kleinerman G. Baneth G. : Part I, Family Argasidae Koch, 1844; Ornithodoros (Alectorobius) lahorensis Neumann, 1908 (Figs. 19 and 20) Ticks of Europe and North Africa , edited by Estrada-Peña A. Mihalca A.D. Petney T.N. , Springer Nature , Cham, Switzerland , 2018 63 – 66 , doi: 10.1007/978-3-319-63760-0_15 .
20. Kumar S. Stecher G. Li M. Knyaz C. Tamura K. : MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms . Mol Biol Evol 2018 , 35 , 1547 – 1549 , doi: 10.1093/molbev/msy096 . 29722887
21. Li S. Zhang L. Zhou P. Li Z. Song H. Song Y. Li C. Xiangzheng W. Wu J. : Detection of Babesia spp., Theileria spp., and Anaplasma ovis in Ornithodoros lahorensis from southern Xinjiang, China . J Vet Res 2023 , 67 , 79 – 85 , doi: 10.2478/jvetres-2023-0016 . 37008774
22. Li Y. Guan G. Ma M. Liu J. Ren Q. Luo J. Yin H. : Theileria ovis discovered in China . Exp Parasitol 2011 , 127 , 304 – 307 , doi: 10.1016/j.exppara.2010.07.002 . 20619262
23. Li Y. Li J. Chahan B. Guo Q. Zhang Y. Moumouni P.F.A. Lee S.H. Liu M. Galon E.M. Guo H. Gao Y. Song R. Li M. Tumwebaze M.A. Benedicto B. Xuan X. : Molecular investigation of tick-borne infections in cattle from Xinjiang Uygur Autonomous Region, China . Parasitol Int 2020 , 74 , 101925 , doi: 10.1016/j.parint.2019.05.003 . 31077806
24. Li Y. Wen X. Li M. Moumouni P.F.A. Galon E.M. Guo Q. Rizk M.A. Liu M. Li J. Ji S. Tumwebaze M.A. Byamukama B. Chahan B. Xuan X. : Molecular detection of tick-borne pathogens harbored by ticks collected from livestock in the Xinjiang Uygur Autonomous Region, China . Ticks Tick Borne Dis 2020 , 11 , 101478 , doi: 10.1016/j.ttbdis.2020.101478 . 32723638
25. Mans B.J. de Klerk D. Pienaar R. Latif A.A. : Nuttalliella namaqua: A living fossil and closest relative to the ancestral tick lineage: Implications for the evolution of blood-feeding in ticks . PLoS One 2011 , 6 , e23675 , doi: 10.1371/journal.pone.0023675 . 21858204
26. Moradi-Asl E. Jafari S. : The habitat suitability model for the potential distribution of Ornithodoros tholozani (Laboulbène et Mégnin, 1882) and Ornithodoros lahorensis (Neumann, 1908) (Acari: Argasidae): the main vectors of tick-borne relapsing fever in Iran . Ann Parasitol 2020 , 66 , 357 – 363 , doi: 10.17420/ap6603.274 . 33128518
27. Ochirkhuu N. Konnai S. Mingala C.N. Okagawa T. Villanueva M. Pilapil F.M.I. Murata S. Ohashi K. : Molecular epidemiological survey and genetic analysis of vector-borne infections of cattle in Luzon Island, the Philippines . Vet Parasitol 2015 , 212 , 161 – 167 , doi: 10.1016/j.vetpar.2015.05.019 . 26138152
28. Parola P. Raoult D. : Ticks and tickborne bacterial diseases in humans: An emerging infectious threat . Clin Infect Dis 2001 , 32 , 897 – 928 , doi: 10.1086/319347 . 11247714
29. Philip C.B. Burgdorfer W. : Arthropod vectors as reservoirs of microbial disease agents . Annu Rev Entomol 1961 , 6 , 391 – 412 , doi: 10.1146/annurev.en.06.010161.002135 . 13735249
30. Reháçek J. : Ecological relationships between ticks and rickettsiae . Eur J Epidemiol 1989 , 5 , 407 – 413 , doi: 10.1007/BF00140130 . 2691271
31. Rodríguez Y. Rojas M. Gershwin M.E. Anaya J.M. : Tick-borne diseases and autoimmunity: A comprehensive review . J Autoimmun 2018 , 88 , 21 – 42 , doi: 10.1016/j.jaut.2017.11.007 . 29183642
32. Sidorov V.E. Gubina E.A. : On the preservation of vaccinal strains of Br. abortus 19-BA in the tick Ornithodoros lahorensis Neumann . Zh Mikrobiol Epidemiol Immunobiol 1962 , 33 , 130 – 133 .
33. Takada N. Masuzawa T. Ishiguro F. Fujita H. Kudeken M. Mitani H. Fukunaga M. Tsuchiya K. Yano Y. Ma X.H. : Lyme Disease Borrelia spp . in Ticks and Rodents from Northwestern China. Appl Environ Microbiol 2001 , 67 , 5161 , doi: 10.1128/aem.67.11.5161-5165.2001 . 11679340
34. Tavassoli M. Malekifard F. Soleimanzadeh A. Pourseyed S.H. Bernousi I. Mardani K. : Susceptibility of different life stages of Ornithodoros lahorensis to entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana . Parasitol Res 2012 , 111 , 1779 – 1783 , doi: 10.1007/s00436-012-3023-6 . 22782474
35. Telmadarraiy Z. Ghiasi S.M. Moradi M. Vatandoost H. Eshraghian M.R. Faghihi F. Zarei Z. Haeri A. Chinikar S. : A survey of Crimean-Congo haemorrhagic fever in livestock and ticks in Ardabil Province, Iran during 2004-2005 . Scand J Infect Dis 2010 , 42 , 137 – 141 , doi: 10.3109/00365540903362501 . 19958240
36. Tovar R.M. : Infection and transmission of Brucella by ectoparasites . Am J Vet Res 1947 , 8 , 138 . 20284873
37. Vial L. : Biological and ecological characteristics of soft ticks (Ixodida: Argasidae) and their impact for predicting tick and associated disease distribution . Parasite 2009 , 16 , 191 – 202 , doi: 10.1051/parasite/2009163191 . 19839264
38. Wang Q. Zhao S. Wureli H. Xie S. Chen C. Wei Q. Cui B. Tu C. Wang Y. : Brucella melitensis and B. |abortus in eggs, larvae and engorged females of Dermacentor marginatus . Ticks Tick Borne Dis 2018 , 9 , 1045 – 1048 , doi: 10.1016/j.ttbdis.2018.03.021 . 29627394
39. Wu X.B. Na R.H. Wei S.S. Zhu J.S. Pen H.J. : Distribution of tick-borne diseases in China . Parasit Vectors 2013 , 6 , 1 – 8 , doi: 10.1186/1756-3305-6-119 . 23281838
40. Zhao G.-P. Wang Y.-X. Fan Z.-W. Ji Y. Liu M.-J. Zhang W.-H. Li X.-L. Zhou S.-X. Li H. Liang S. Liu W. Yang Y. Fang L.-Q. : Mapping ticks and tick-borne pathogens in China . Nat Commun 2021 , 12 , 1075 , doi: 10.1038/s41467-021-21375-1 . 33597544
41. Zhao L. Lin X.-M. Li F. Li K.-R. He B. Zhang L.-Y. Pan J.-J. Wang Q.-R. Gao J.-M. Johnson N. Yuan X.-F. Lv J.-Z. Wu S.-Q. Liu Y.-H. : A survey of argasid ticks and tick-associated pathogens in the Peripheral Oases around Tarim Basin and the first record of Argas japonicus in Xinjiang, China . PLoS One 2018 , 13 , e0208615 , doi: 10.1371/journal.pone.0208615 . 30586406
42. Zhao L. Lv J. Li F. Li K. He B. Zhang L. Han X. Wang H. Johnson N. Lin X. Wu S. Liu Y. : Identification and molecular analysis of ixodid ticks (Acari: Ixodidae) infesting domestic animals and tick-borne pathogens at the tarim basin of Southern Xinjiang, China . Korean J Parasitol 2020 , 58 , 37 – 46 , doi: 10.3347/kjp.2020.58.1.37 . 32145725
43. Zhao L. Wang J. Ding Y. Li K. He B. Li F. Zhang L. Li X. Liu Y. : Theileria ovis (Piroplasmida: Theileriidae) Detected in Melophagus ovinus (Diptera: Hippoboscoidea) and Ornithodoros lahorensis (Ixodida: Argasidae) Removed from Sheep in Xinjiang, China . J Med Entomol 2020 , 57 , 631 – 635 , doi: 10.1093/jme/tjz193 . 31751462
