
==== Front
STAR Protoc
STAR Protoc
STAR Protocols
2666-1667
Elsevier

S2666-1667(24)00480-5
10.1016/j.xpro.2024.103315
103315
Protocol
Protocol to identify receptors of secreted proteins through CRISPR-Cas9 whole-genome screening technology
Hu Xiaoli huxl18@mails.tsinghua.edu.cn
12∗
Wang Yiguo yiguo@mail.tsinghua.edu.cn
13∗∗
1 State Key Laboratory of Membrane Biology, MOE Key Laboratory of Bioinformatics, Tsinghua-Peking Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing 100084, China
∗ Corresponding author huxl18@mails.tsinghua.edu.cn
∗∗ Corresponding author yiguo@mail.tsinghua.edu.cn
2 Technical contact

3 Lead contact

14 9 2024
20 12 2024
14 9 2024
5 4 103315© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Summary

The interaction between cell surface receptors and their ligands is crucial for intercellular communication. However, current techniques for identifying direct receptor-ligand interactions remain limited. Here, we present a protocol to identify receptors of secreted proteins using a genome-scale CRISPR-Cas9 knockout genetic screening approach. We describe steps for creating a single-guide RNA (sgRNA) lentivirus library, infecting stable Cas9-MCF7 cells, staining with tagged Cholesin, and sorting non-binding cells via flow cytometry. We then detail procedures for extracting DNA, amplifying sgRNAs, and sequencing.

For complete details on the use and execution of this protocol, please refer to Hu et al.1

Graphical abstract

Highlights

• Detailed steps for screening cells based on receptor-ligand binding interactions

• Detailed description of how protein ligands are prepared for receptor screening

• Instructions for establishing cell lines with Cas9 activity and ligand-binding capability

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

The interaction between cell surface receptors and their ligands is crucial for intercellular communication. However, current techniques for identifying direct receptor-ligand interactions remain limited. Here, we present a protocol to identify receptors of secreted proteins using a genome-scale CRISPR-Cas9 knockout genetic screening approach. We describe steps for creating a single-guide RNA (sgRNA) lentivirus library, infecting stable Cas9-MCF7 cells, staining with tagged Cholesin, and sorting non-binding cells via flow cytometry. We then detail procedures for extracting DNA, amplifying sgRNAs, and sequencing.

Subject areas

Cell-based Assays
High Throughput Screening
Metabolism
==== Body
pmcBefore you begin

Cell-to-cell communication is vital for the proper functioning of multicellular organisms and relies heavily on interactions between secreted ligands and cell-surface receptors. These receptors act as the interface between cells and their external environment, binding specific ligands involved in processes such as signal transduction and nutrient transport.2 In developed organisms, intercellular communication orchestrates the activities of multiple cell types essential for complex processes like immune responses, growth, and homeostasis.3,4,5 Despite the importance of these interactions, studying them still presents technical challenges.

With the emergence of CRISPR-Cas9 genome editing tools, combined with the widespread application of single guide RNA (sgRNA) libraries and improvements in CRISPR screening analysis pipelines, genetic screening in mammalian cells has become an indispensable tool in cell biology research.6 In this context, genome-scale CRISPR knockout cell screening provides an alternative approach to traditional biochemical methods for studying the interactions between cell-surface receptors and extracellular ligands. Cells expressing specific sgRNAs are selectively enriched based on the phenotype of interest, typically involving their ability to bind ligands. Enrichment of cells losing the ability to bind the ligand is achieved through flow cytometry, followed by identification of genes that negatively affect cell-ligand binding using next-generation sequencing and bioinformatics analysis.

We have conducted a CRISPR knockout (KO) screen based on receptor-ligand binding and identified the endogenous receptor GPR146 for the protein hormone Cholesin.1 The method we employed is broadly applicable and can be used to address biological questions related to receptor screening. Here, we provide a detailed protocol where the binding of a recombinant protein ligand to cell lines serves as a measurable phenotype for identifying receptors of that ligand in mammalian cells.

Expression of protein ligands tagged with GST and His

Timing: 1.5 weeks

The initial screening step involves expressing and purifying tagged ligands in large quantities. The tags facilitate affinity purification of the ligand, enable immunofluorescence staining, and enhance ligand solubility. Furthermore, the tagged ligand can be directly conjugated with a fluorochrome, offering the advantage of direct applicability to cell binding analysis without the need for antibody staining. In this step, we provide a protocol for expressing tagged protein ligands using Cholesin as an example.1. Clone Cholesin-His into the pGEX-6P-1 vector to fuse the Cholesin protein with a GST tag at the N-terminus and a His tag at the C-terminus.

2. After sequence verification of the plasmid, transform 1 μL of plasmid DNA and empty vector separately into competent BL21 (DE3) E. coli cells using heat shock transformation.a. Place 100 μL of competent cells on ice to thaw.

b. Add 1 μL of the target plasmid to the competent cell suspension.

c. Gently rotate the centrifuge tube to mix the contents and place it on ice for 30 min.

d. Place the EP tube in a 42°C water bath for heat shock for 60 s.

e. Quickly transfer it back to an ice bath for 2–3 min, being careful not to agitate the tube.

f. Add 900 μL of antibiotic-free LB broth to the centrifuge tube.

3. After incubating on a bacterial shaker at 37°C for 1 h, take 100 μL and spread it onto LB plates containing ampicillin.

4. Incubate overnight in a biochemical incubator at 37°C.

5. Inoculate single clones into 50 mL LB medium containing ampicillin and incubate on a shaker at 37°C overnight for pre-culturing.

6. Gently mix the pre-cultured bacterial suspension with sterile 50% glycerol at a 1:1 ratio, then aliquot and store in a −80°C freezer.

7. Express GST-Cholesin-His in BL21 (DE3) at a small scale.a. Thaw one vial of glycerol stock and inoculate it into LB medium containing ampicillin.

b. Incubate overnight at 37°C with shaking.

c. Inoculate the overnight-cultured bacteria at a 1:100 dilution into 50 mL LB medium containing ampicillin.

d. Incubate on a shaker at 37°C for 2.5–3.5 h until the OD600 reaches 0.6–1.0.

e. Aliquot the bacterial culture into different shaking flasks.

f. Add different concentrations of IPTG (0–1 mM) to induce expression of the GST-tagged protein.

g. Shake the cultures overnight at 16°C. Centrifuge the bacterial cultures at 12,000 g for 2 min to collect 1 mL of bacterial cells.

h. Resuspend the pellets in 100 μL of lysis buffer (500 mM NaCl, 20 mM NaH2PO4, 1 mM PMSF, pH 7.4).CRITICAL: The pH of the cell lysis buffer should be kept as far as possible from the isoelectric point of the fusion proteins.

Note: PMSF degrades rapidly in aqueous environments, so it's typically prepared in isopropanol for its stock solution. The PMSF stock solution can be stably stored for up to one year at −20°C and for about one month at 4°C. It's recommended to add PMSF to lysis buffers or other aqueous solutions immediately before use to ensure optimal activity and effectiveness.

i. After sonication to lyse the cells, centrifuge the lysate at maximum speed for 10 min at 4°C to separate the soluble (supernatant) and insoluble (pellet) fractions.

j. The supernatant and pellet are then subjected to electrophoresis and staining to determine the optimal induction conditions for protein expression (Figure 1A).Note: High IPTG concentrations can accelerate protein expression, leading to the formation of insoluble proteins (inclusion bodies) due to improper folding.

Figure 1 Purification of GST-Cholesin-His

(A) Determining the optimal concentration of IPTG for induction of protein expression. IPTG, isopropyl-beta-D-thiogalactopyranoside. Arrow indicates GST-Cholesin-His.

(B) Coomassie staining showing purified GST-Cholesin-His. Mr, molecular weight marker.

Purification of protein ligands tagged with GST and His

Timing: 1.5 weeks

In this step, we base the large-scale protein purification on the optimal induction conditions obtained from small-scale expression experiments. Utilizing the His-tag located at the C-terminus of the protein, we perform affinity purification via nickel column chromatography. Following this, we subject the affinity-purified protein to a desalting process, with the resulting fusion protein intended for use in subsequent immunofluorescence staining.8. After identifying the optimal induction conditions, inoculate the bacterial culture at a 1:100 dilution into 1 L of LB medium.

9. Incubate on a shaker at 37°C for 2.5–3.5 h until the OD600 reaches 0.6–1.0. Then, induce protein expression under the optimal IPTG concentration.

10. Prepare the buffer solutions required for purification.

Equilibration/Lysis buffer: 500 mM NaCl, 20 mM NaH2PO4, pH 7.4;

Washing buffer: 500 mM NaCl, 20 mM NaH2PO4, 20 mM imidazole, pH 7.4;

Elution buffer: 500 mM NaCl, 20 mM NaH2PO4, 500 mM imidazole, pH 7.4.

After preparing all buffer solutions, filter them through a 0.22-μm membrane filter.CRITICAL: Since the purified protein ligands will be used for live-cell staining, care should be taken not to introduce any detergent components into the buffers.

Note: The buffers can be stored at 4°C for up to one month.

Note: The buffers containing imidazole should be stored away from light.

11. After overnight induction, centrifuge the bacterial culture at 4,000 g for 15 min at 4°C to collect the cells.

12. Discard the supernatant and add 50 mL of lysis buffer (1:100 dilution with proteinase inhibitor PMSF), then resuspend.

13. Use a high-pressure homogenizer to disrupt the cells.a. Wash the homogenizer twice with water.

b. Equilibrate once with lysis buffer.

c. Add the bacterial suspension to the homogenizer, and apply pressure (do not exceed 900 kPa).

d. Pass the suspension through the homogenizer three to five times until it becomes transparent and non-viscous.

Note: Using a high-pressure homogenizer for cell disruption is gentler compared to sonication and can effectively avoid the substantial heat generation during the sonication process, thereby preserving protein activity.

14. Centrifuge at 18,000 g for 40 min at 4°C to collect the supernatant.

15. Use a 0.22-μm filter membrane for sterile filtration to remove cell debris.

16. Perform nickel column affinity purification and desalting using the ÄKTA pure chromatography system.a. Flush pumps A1 and B1 with equilibration buffer, then balance at a flow rate of 5 mL/min until the UV280 reading stabilizes for at least 5 column volumes.

b. After pausing the machine, insert pump A1 into the filtered cell lysate supernatant and inject at a flow rate of 10 mL/min.

c. After completing the sample loading, flush pump A1 and place it into the wash buffer.

d. Wash the column at a flow rate of 10 mL/min until the UV280 reading stabilizes for at least 20 column volumes.

e. Place pump B1 into the elution buffer and set up a gradient elution program.

f. Simultaneously monitor UV280 and collect the protein peak sample once it elutes.

g. After protein collection, analyze each peak fraction by SDS-PAGE electrophoresis analysis.

h. Fractions containing the target protein are then used for the next purification step.

i. After mixing the proteins collected from nickel column purification, further purify them using a desalting column.CRITICAL: For proteins with low purity after affinity purification, direct desalting treatment is not recommended. Further purification steps such as secondary affinity purification, ion exchange chromatography, and gel filtration chromatography are necessary.

j. Connect the desalting column to the ÄKTA protein purification system.

k. Wash pump A1 with PBS buffer.

l. Equilibrate the desalting column with at least one column volume of PBS buffer at a flow rate of 5 mL/min until UV280 returns to baseline.

m. Then, load the sample using pump A1, not exceeding 15 mL.

n. Monitor UV280 for peak elution and collect the protein peak using 15 mL centrifuge tubes.

o. After desalting, perform electrophoresis, staining, and detection to assess the purity of the purified protein (Figure 1B).

Generating Cas9-expressing cells

Timing: 3 weeks

Prior to screening, the cells capable of ligand binding need to be modified to stably express Cas9. Furthermore, to enhance the stability of the gene knockout system, pooled cells need to undergo single-cell clone selection to identify clones with high Cas9 expression for subsequent screening.17. Plate 5 × 106 HEK293T cells into one 10-cm culture dish in 10 mL complete culture medium such that they are at 90% confluence 24 h later.

CRITICAL: Regular testing for mycoplasma is required to ensure cellular health.

Note: Easily and quickly detect mycoplasma contamination in cell cultures using MycoStrip (InvivoGen #rep-mys-10) test strips. This link will direct you to the online protocol. One band ('C' band only) indicates that mycoplasma was not detected in the processed sample. Two bands ('C' and 'T' bands) indicate that the processed sample is contaminated by mycoplasma.

18. After 24 h, transfect HEK293T cells with 40 μL Lipoplus transfection reagent, 7.5 μg lentiCas9-Blast, 5 μg psPAX2 and 2.5 μg pMD2.G.

19. Following transfection, replace the medium with fresh medium after 12 h.

20. Incubate the cells for 60 h.

21. After 60 h, collect the viral supernatant and centrifuge at 500 g for 10 min to remove cellular debris.

Note: Lentivirus can be stored at 4°C for up to one week or at −80°C for approximately six months.

22. Determine the optimal working concentration of blasticidin.a. Seed 1.5 × 105 MCF7 cells into 6-well plates and culture for 36 h.

b. After that, culture the cells with blasticidin at final concentrations of 0 μg/mL, 1 μg/mL, 2 μg/mL,4 μg/mL, and 8 μg/mL.

c. Every two days, replace the medium with fresh medium containing the corresponding concentration of blasticidin.

d. Observe cell viability daily. Culture the cells for one week.

e. The lowest concentration of blasticidin causing complete cell death is the optimal concentration for screening cells.

23. Plate 5 × 105 MCF7 cells into two wells of a 6-well tissue culture plate in complete culture medium such that cells are at 50% confluence 12 h later.

24. After 12 h, introduce 1 mL fresh complete culture medium and 1 mL pLenti-Cas9-blast lentivirus-containing medium to the cells in one well with 8 mg/mL polybrene. Incubate for 24 h.

25. After 24 h of lentivirus infection, discard the cell culture medium and wash once with PBS, then replace with complete culture medium.

Note: For cell lines sensitive to lentiviral infection, the lentiviral infection duration can be shortened. Subsequently, drug screening can be conducted after the cells have fully recovered.

26. Incubate cells in culture medium with the optimal concentration of blasticidin. Change the culture medium every two days. Wait until all negative control cells are dead, while cells in the experimental group exhibit normal growth.

Note: For the negative control, we typically transfect only the packaging plasmids psPAX2 and pMD2.G during virus packaging. The same procedure is followed during the collection of viral supernatant in culture medium to serve as a strict negative control.

27. When the antibiotic selection is complete, adjust the cell density to 106 cells/mL after trypsin digestion. Subsequently, single cells are sorted into a 96-well plate via a flow cytometer.a. Pre-add 200 μL of complete medium to each well of the receiving 96-well plate.

b. Perform gating on the BD FACSDiva software, excluding debris through FSC/SSC gating, and discriminate doublets using FSC-A versus FSC-H.

c. Sort target cells in single-cell mode, dispensing one cell per well into the pre-prepared 96-well plate.

Note: For some cells, it is difficult to obtain single-cell clones. Increasing the number of 96-well plates can enhance the success rate of clone formation.

28. Continue culturing for approximately two weeks, replenishing or changing the medium as needed. When the cells in the wells have grown into clones, pick them and transfer them into 24-well plates for further expansion.

CRITICAL: After clone formation, blasticidin should be reintroduced into the complete medium and continuously supplemented during subsequent culture to maintain blasticidin resistance.

Note: After clone formation, sustaining selective resistance pressure in long-term culture or storage of stable cell lines is vital for three reasons: potential gene silencing from genetic drift, reduced fitness of transgene-bearing cells without selection, and mutation accumulation affecting exogenous gene expression. Maintaining this pressure ensures the gene's ongoing expression and stability.

29. Divide the expanded cultured monoclonal cells into two portions: one portion is cryopreserved for subsequent experiments, while the other portion is lysed using RIPA buffer to perform Western blot (WB) analysis to detect the expression level of Cas9 protein (Figure 2).

Note: The C-terminus of Cas9 is fused with a FLAG tag, and FLAG antibody or Cas9 antibody can be used to detect the expression level of Cas9 on immunoblots.

30. Select the top 3 cell lines with the highest expression levels of Cas9 for cell cryopreservation and subsequent assays.

31. Freeze cells at −80°C and store in liquid nitrogen.

Figure 2 Generation of MCF7 cell lines with stable expression of Cas9

Immunoblots showing the varying levels of Cas9 expression among different clones (1–12).

Evaluating gene knockout efficiency and ligand binding capacity in MCF7-Cas9 stable cell lines

Timing: 2 weeks

For stable overexpression of Cas9 in monoclonal cell lines, it is necessary to confirm that Cas9 exhibits efficient gene editing activity and that the cell line maintains its binding affinity to the ligand. The lentiviral vector pXPR-011 can be used to assess Cas9 activity. In the absence of Cas9, cells transfected with pXPR-011 display resistance to puromycin and express EGFP. Conversely, with functional levels of Cas9, the sgRNA expressed from the U6 cassette of pXPR-011 targets EGFP, leading to the development of puromycin-resistant cells that no longer express EGFP.7

For assessing the ability of cells to bind the ligand, immunofluorescent staining of the ligand is conducted, followed by quantitative analysis of fluorescence intensity using flow cytometry. The binding capacity of cells to the ligand is expected to be positively correlated with fluorescence intensity.32. Determine the optimal working concentration of puromycin.a. Seed 1.5 × 105 MCF7 cells into 6-well plates and culture for 36 h.

b. After that, culture the cells with puromycin at final concentrations of 0 μg/mL, 0.1 μg/mL, 0.2 μg/mL, 0.4 μg/mL, and 0.8 μg/mL.

c. Every two days, replace the culture medium with fresh medium containing the corresponding concentration of puromycin.

d. Observed the cell viability daily.

e. After 5 days of culture, the lowest concentration of puromycin causing complete cell death is the optimal concentration for screening cells.

Note: Different antibiotics have varying effects, influencing the screening duration. Faster-acting antibiotics require a shorter screening period, while those with a milder impact need a longer observation period. Considering economic and general applicability, puromycin is commonly used.

33. Plate 5 × 107 HEK293T cells into one 10-cm culture dish in 10 mL complete culture medium such that they are at 90% confluence 24 h later.

34. After 24 h, transfect HEK293T cells with 40 μL Lipoplus transfection reagent, 7.5 μg pXPR-011, 5 μg psPAX2 and 2.5 μg pMD2.G.

35. After transfection, replace the medium with fresh medium after 12 h.

36. Incubate cells for 60 h.

37. After 60 h, collect the viral supernatant and centrifuge at 500 g for 10 min to remove cellular debris. Lentivirus can only be stored at 4°C for one week.

38. Use lentivirus expressing GFP and GFP sgRNA (multiplicity of infection [MOI] = 0.3) to infect wild-type MCF7 cells and MCF7-Cas9 monoclonal cells.

CRITICAL: The higher the number of lentivirus particles per cell, the stronger the expression of GFP. Therefore, the MOI for this assay should be controlled below 1.

39. 24 h post-infection, add puromycin at the optimal working concentration to the cell culture medium for selection. After 5 days, all the uninfected control cells will die.

40. Measure GFP fluorescence by flow cytometry to validate Cas9 activity (Figure 3A).

41. For the flow cytometry assay to detect the binding capacity of MCF7-Cas9 cells for Cholesin, culture wild-type and MCF7-Cas9 cell lines in 10-cm dishes.

42. Trypsinize cells for 2 min at 37°C, then terminate the digestion by adding complete culture medium.

Note: Accutase, a cell dissociation solution containing proteolytic and collagenolytic activities, can be used as an alternative to trypsin. Compared to trypsin, Accutase is milder and effectively detaches adherent cells while minimizing cell damage.

43. Centrifuge at 500 g for 2 min, discard the supernatant.

44. Resuspend cells in PBS, and proceed with cell counting.

45. After cell counting, take 1 × 106 cells for subsequent staining.

46. Resuspend cells in 100 μL of FACS buffer (2% FBS and 2 mM EDTA in DPBS) in a 1.5 mL EP tube.

Note: FBS is used to maintain cell viability, while EDTA is employed to reduce cell adhesion.

47. Add GST and GST-Cholesin-His (final concentration of 200 nM) separately to both wild-type cells and MCF7-Cas9 cells.

48. Mix well and incubate at room temperature for 30 min.

CRITICAL: Occasionally mix the cells during the incubation process.

49. After the incubation, centrifuge the cell suspension at 500 g for 3 min.

50. Discard the supernatant and wash the cells twice with 500 μL of FACS buffer each time.

51. Dilute the GST primary antibody in FACS buffer at a ratio of 1:1000.

52. After resuspending the cells in 100 μL of the antibody solution, incubate them on ice for 2 h.

Note: Staining on ice helps maintain cell viability.

53. Centrifuge the cells at 500 g for 3 min, discard the supernatant.

54. Wash the cells twice by adding 1 mL of FACS buffer each time.

55. Dilute the fluorescent secondary antibody in FACS buffer at a ratio of 1:1000.

56. Add 100 μL of the secondary antibody solution to resuspend the cells in each sample.

57. Incubate the samples on ice in the dark for 30 min.

58. Centrifuge the samples at 500 g for 3 min, discard the supernatant, and wash the cells twice with 1 mL of FACS buffer each time.

59. Resuspend the cells in 200 μL of FACS buffer.

60. Pass the cell suspension through a 300-mesh nylon mesh cell strainer into a flow cytometry tube.

61. Analyze 1 × 104 cells using a flow cytometer and calculate the average fluorescence intensity (Figure 3B).

62. From the three stable clones overexpressing Cas9, choose the one with the highest Cas9 activity and unaffected ligand-binding capability for whole-genome screening.

Figure 3 Assessment and selection of Cas9 single clones

(A) Analyzing Cas9 activity using the pXPR-011 system. MCF7 cells were infected with lentivirus expressing either sgEGFP or sgNone and selected with puromycin for 5 days. EGFP expression in cells was examined by flow cytometry.

(B) Testing the ligand binding capacity of the Cas9 stable cell lines by flow cytometry.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
	
Rabbit polyclonal anti-HSP90 (1:1,000 dilution)	Cell Signaling Technology	Cat#4874; RRID: AB_2121214	
Rabbit polyclonal anti-CAS9 (1:1,000 dilution)	ABclonal Technology	Cat# A14997; RRID: AB_2761880	
Rabbit monoclonal anti-GST (1:1,000 dilution)	Gene-Protein Link	Cat#P01L074	
Goat anti-mouse IgG HRP (1:5,000 dilution)	Bio-Rad	Cat#1706516; RRID: AB_11125547	
Goat anti-rabbit IgG HRP (1:5,000 dilution)	Bio-Rad	Cat#1706515; RRID: AB_11125142	
Goat anti-rabbit IgG, Alexa Fluor Plus 488 (1:1,000 dilution)	Thermo Fisher Scientific	Cat#A11008; RRID: AB_143165	
	
Bacterial and virus strains	
	
DH5α	Thermo Fisher Scientific	18265017	
BL21 (DE3)	NEB	C2527	
	
Chemicals, peptides, and recombinant proteins	
	
Sodium dihydrogen phosphate anhydrous	Macklin	S817780	
Glycerol	Macklin	G810575	
Oxoid tryptone	Thermo Scientific	LP0042B	
Sodium chloride	Thermo Scientific	424290010	
Oxoid yeast extract powder	Thermo Scientific	LP0021B	
PMSF	Thermo Scientific	36978	
Imidazole	Thermo Scientific	A10221	
Blasticidin S HCl (10 mg/mL)	Thermo Scientific	A1113903	
Gibco DMEM, high glucose	Thermo Scientific	11965118	
Gibco Penicillin-Streptomycin	Thermo Scientific	15140122	
Gibco Trypsin-EDTA (0.25%), phenol red	Thermo Scientific	25200072	
Isopropyl-β-D-thiogalactopyranoside	Merck Millipore	1370640100	
FBS	Gemini	900-108	
Corning phosphate-buffered saline, without calcium and magnesium	Corning	21-040-CV	
Carbenicillin, disodium salt	INALCO	1758–9317	
Sage LipoPlus DNA transfection reagent	SINSAGE	Q03003	
Lenti-X GoStix	Clontech	631280	
Q5 Hot Start high-fidelity 2× master mix	NEB	M0494S	
	
Critical commercial assays	
	
DNA Clean & Concentrator-100	Zymo Research	D4029	
Lenti-X GoStix	Clontech	631280	
MycoStrip	InvivoGen	rep-mys-10	
HiPure Tissue DNA Mini Kit	Magen	D3122	
HiPure Tissue DNA Kit	Magen	D3121	
VAHTS Universal DNA Library Prep Kit for Illumina V3	Vazyme	ND607	
	
Experimental models: Cell lines	
	
HEK293T	ATCC	Cat#CRL-3216; RRID: CVCL_0063	
MCF7	ATCC	Cat#CRL12584; RRID: CVCL_0031	
	
Oligonucleotides	
	
sgRNA amplifying primer F: TGGACTATCATATGCTTACCGTAACTTGAAAGT	This paper	N/A	
sgRNA amplifying primer R: AGTTTGTATGTCTGTTGCTATTATG	This paper	N/A	
	
Recombinant DNA	
	
pXPR_011	Addgene	RRID: Addgene_59702	
Human CRISPR knockout pooled library	Addgene	RRID: Addgene_1000000049	
pMDLg/pRRE	Addgene	RRID: Addgene_12251	
pRSV-Rev	Addgene	RRID: Addgene_12253	
pMD2.G	Addgene	RRID: Addgene_12259	
lentiCas9-Blast	Addgene	RRID: Addgene_52962	
	
Software and algorithms	
	
FlowJo v7.6	BD	www.flowjo.com	
FACSDiva software version 8.0	BD	N/A	
CorelDRAW 2022	Corel Corporation	https://www.corel.com/en/	
	
Other	
	
50 mL centrifuge tube	Corning	430290	
15 mL centrifuge tube	Corning	430052	
96-well cell culture plate	Corning	3300	
24-well cell culture plate	Falcon	351147	
1.5 mL EP tube	Axygen	MCT-150-A	
HisTrap excel	Cytiva	17371206	
Superdex 200 Increase 10/300 GL	Cytiva	28990944	
HiPrep 26/10 Desalting	Cytiva	17508701	
5 mL Falcon tube	Falcon	352054	
ӒKTA pure	GE	PURE L	
BD LSRFortessa SORP	BD	N/A, with 488 nm, 640 nm, 561 nm, and 405 nm lasers	
BD Aria III	BD	N/A, with 488 nm, 633 nm, 561 nm, and 375 nm lasers	

Materials and equipment

Lysis buffer, pH 7.4

Reagent	Final concentration	Amount	
NaH2PO4 (2 M)	20 mM	1 mL	
NaCl (5 M)	500 mM	10 mL	
PMSF (100 mM)	1 mM	1 mL	
Total	N/A	100 mL with ddH2O	

Note: A lysis buffer without added PMSF can be stored at 4°C for up to one month. Once PMSF is added to the buffer, it should be used within 30 min.

Note: PMSF has low solubility in water; hence, isopropanol is commonly used as the solvent.

CRITICAL: Be aware that PMSF is toxic and volatile; therefore, appropriate safety measures should be adopted, such as wearing gloves and a mask, and conducting the procedure in a fume hood.

Washing buffer, pH 7.4

Reagent	Final concentration	Amount	
NaH2PO4 (2 M)	20 mM	1 mL	
NaCl (5 M)	500 mM	10 mL	
Imidazole (5 M)	20 mM	400 μL	
Total	N/A	100 mL with ddH2O	

Note: Washing buffer can be stored at 4°C in the dark for up to one month.

Note: Imidazole solutions are relatively stable and can be preserved at temperatures between 2°C–8°C for up to two years.

Elution buffer, pH 7.4

Reagent	Final concentration	Amount	
NaH2PO4 (2 M)	20 mM	1 mL	
NaCl (5 M)	500 mM	10 mL	
Imidazole (5 M)	500 mM	10 mL	
Total	N/A	100 mL with ddH2O	

Note: Elution buffer can be stored at 4°C in the dark for up to one month.

FACS buffer

Reagent	Final concentration	Amount	
FBS	2%	1 mL	
EDTA (0.5 M)	2 mM	200 μL	
Total	N/A	50 mL with DPBS	

Note: FACS buffer can be stored at 4°C for up to one month.

Note: In FACS buffer, the addition of FBS serves three primary purposes: it supplies essential nutrients and growth factors to cells, aiding in the maintenance of cellular activity; it aids in stabilizing antibodies; and, due to the abundance of proteins and biomolecules in FBS, it reduces non-specific binding of antibodies.

Note: EDTA, a potent chelator, is included in FACS buffers to bind calcium and magnesium ions, reducing cellular adhesion and enhancing sample homogeneity. This facilitates flow cytometry by minimizing aggregation, improving data quality and consistency. If EDTA affects ligand binding to the receptor, please use FBS-free medium.

Step-by-step method details

Making virus, infecting cells, and selecting cells

Timing: 1 week

In this step, we create a lentiviral library of sgRNAs targeting the entire genome to infect MCF7 cells that stably overexpress Cas9, thereby constructing a cell library with genome-wide knockouts.1. Plate 5 × 106 HEK293T cells into one 10-cm culture dish in 10 mL complete culture medium such that they are at 90% confluence 24 h later.

2. After 24 h, transfect HEK293T cells with 40 μL Lipoplus transfection reagent, 7.5 μg lentiguide-Puro (GeCKO v2 A library), 5 μg psPAX2 and 2.5 μg pMD2.G.

3. 12 h post-transfection, replace the medium with fresh medium.

4. Incubate cells for 72 h.

Note: 48 h post-transfection, supplement with 5 mL of fresh complete culture medium to maintain cell viability and ensure efficient lentivirus production.

5. 72 h post-transfection, collect the culture medium, and centrifuge at 500 g for 10 min to remove cell debris.

6. The supernatant collected after centrifugation is the GeCKO library (Library A) lentivirus.

Note: Lentivirus can only be stored at 4°C for up to one week.

7. Roughly determine the titer of lentivirus using Lenti-X GoStix (Clontech #631280) test strips.Note: Lenti-X GoStix utilize lateral flow technology to rapidly detect p24 levels in the packaging cell supernatant, thereby measuring the lentiviral titer.

Note: The kit for determining the titer of lentivirus can be selected from other commercially available companies.

a. Take 20 μL of the virus and drop it onto the test strip.

b. Add 3–4 drops of Chase buffer.

c. Let it stand for 5–10 min until the reagents spread evenly on the strip and color appears.

d. The intensity of the band in the Test band of the GoStix test strip is directly proportional to the amount of lentivirus present, allowing for the calculation of lentiviral titer based on the band intensity.Note: Typically, one can obtain 15 mL of lentivirus with a titer of 1 × 106 IFU/mL. If the lentivirus titer is less than 1 × 106 IFU/mL, the volume of lentivirus added during infection can be proportionally increased.

8. Plate 5 × 107 MCF7 cells into five 15-cm dishes in complete culture medium such that cells are at 50% confluence 12 h later.

9. After 12 h, introduce 3 mL sgRNA-containing viral medium from step 6 (Approximately add 3 × 106 IFU of lentivirus) to the cells in each 15-cm dish with 8 mg/mL polybrene.

CRITICAL: Collectively, the lentiviruses carry the complete library of gRNA plasmids. During the transduction step, it is crucial to ensure that each cell is infected by only one lentivirus. This prevents multiple gene edits within a single cell that could affect subsequent data analysis and result interpretation. Therefore, it is necessary to assess and select the most appropriate MOI for the experiment. Typically, a relatively low MOI of approximately 0.3 is used to ensure that each cell is likely to receive only one viral particle.

Note: For lentiviral vectors carrying the puromycin resistance gene, accurately determining the MOI can be challenging. To obtain precise MOI values, one can use a sgRNA library expressing fluorescent proteins.

10. Incubate for 24 h.

11. After 24 h, remove all medium and begin antibiotic selection by adding complete culture medium containing 0.4 mg/mL puromycin.

12. Every two days, replace the selection medium.

Note: Control cells should be completely dead within 5 days.

13. After selection, approximately 1 × 108 cells are obtained, with at least 1,500 cells infected by each sgRNA.

Flow cytometry sorting

Timing: 1.5 weeks

In this step, we perform immunofluorescence staining on the genome-wide knockout cell library. Based on the principle that ligand binding capacity is impaired following receptor knockout, we sort out cells exhibiting reduced fluorescence intensity for subsequent sequencing analysis.14. Detach 1 × 108 cells from five 15-cm cell culture dishes and resuspend in FACS buffer.

Note: The total number of sorted cells is around 1 × 108. Ideally, there should be approximately 5,000 knockout cells for each gene.

15. To perform immunofluorescent staining, incubate the cells with 200 nM GST-Cholesin-His for 30 min at room temperature.

Note: There is a risk of protein internalization at room temperature, yet ligand binding to cells is more efficient at this temperature. If the protein-ligand binding efficiency is high, the binding conditions can be optimized to 30 min on ice.

16. After the incubation, centrifuge the cell suspension at 500 g for 3 min. Discard the supernatant and wash the cells twice with 1 mL of FACS buffer.

17. Dilute the GST primary antibody in FACS buffer at a ratio of 1:1000. After resuspending the cells in 500 μL of the antibody solution, incubate them on ice for 2 h.

18. Centrifuge the cells at 500 g for 3 min, discard the supernatant, and then wash the cells twice by adding 1 mL of FACS buffer each time.

19. Dilute the fluorescent secondary antibody in FACS buffer at a ratio of 1:1000. Add 500 μL of the secondary antibody solution to resuspend the cells in each sample. Incubate the samples on ice in the dark for 30 min.

20. Centrifuge the samples at 500 g for 3 min, discard the supernatant, and wash the cells twice with 1 mL of FACS buffer each time.

21. Resuspend the cells in 5 mL of FACS buffer. Pass the cell suspension through a 300-mesh nylon mesh cell strainer into a flow cytometry tube.

22. Gate the GFP-negative population as a control group, collect GFP-negative cells from the experimental group, and gather over 500,000 GFP-negative cells for subsequent PCR amplification. Simultaneously, save at least 107 unsorted cells as input for further experiments (Figure 4A).

Note: Approximately 5 μg of genomic DNA can be extracted from 500,000 cells per collection. This genomic DNA is used for PCR amplification, and after purification post-amplification, about 3 μg of PCR amplicons are typically obtained. At least 1.5 μg of these PCR amplicons are required for subsequent library preparation, ensuring a smooth process when starting with 500,000 cells.

Note: Due to the large volume of cells, sorting is recommended to be conducted simultaneously on three or more machines to shorten the sorting time. Try to keep the sorting duration within 3 h to maintain the cellular state.

23. Centrifuge the sorted cells and input cells at 500 g for 10 min, discard the supernatant, and store the cells in a −80°C freezer for subsequent genomic DNA extraction.

Figure 4 Cell screening and gRNA enrichment

(A) Selective isolation of cells that do not bind to the ligand via flow cytometric sorting (marked as “sorted”).

(B) PCR for gRNA enrichment. The amplified products are analyzed by agarose gel electrophoresis. The expected product size is approximately 300 base pairs (bp).

Genomic DNA extraction

Timing: 1 h

24. Extract genomic DNA from cells using the HiPure Tissue DNA Mini Kit.Note: Reagent kits extract genomic DNA through cell lysis, protein removal, and purification using silica-based spin columns. The purified DNA is then eluted for use in downstream applications.

Note: The starting cell number is approximately 500,000. For isolating genomic DNA from 107 cells for the control library, a different kit (Magen #D3122-02 HiPure Tissue DNA Midi Kit) is used.

Note: Using a kit to extract genomic DNA is essential, as kits can reduce contamination by proteins, nucleases, and other impurities, ensuring the efficiency of downstream PCR processes. Conventional genomic DNA extraction kits can serve as suitable alternatives.

a. Add 220 μL of PBS buffer, 10 μL of RNase A, and 20 μL of Proteinase K to the cells, mix gently, and incubate for 10 min.

b. Then add 250 μL of Buffer DL, vortex to mix thoroughly, and incubate at 65°C in a water bath for 15 min.

c. Add 250 μL of ethanol to the digestion solution, vortex to mix thoroughly, and transfer the mixture to the HiPure gDNA Mini Column.

d. Centrifuge at 12,000 g for 1 min, then discard the filtrate.

e. Add 500 μL of Buffer GW1, centrifuge at 12,000 g for 1 min, then discard the filtrate.

f. Add 650 μL of Buffer GW2, centrifuge at 12,000 g for 1 min, then discard the filtrate.

g. Centrifuge at 12,000 g for 2 min.

h. Transfer the column to a new 1.5 mL EP tube, then add 50 μL of Buffer AE. Let it sit at room temperature for 3 min to elute the DNA.

i. Centrifuge at 12,000 g for 1 min, then measure the DNA concentration using a Nanodrop. The genomic DNA is stored at −20°C.

25. Extract genomic DNA from control library cells using the HiPure Tissue Midi DNA Kit.Note: You can click on the link http://www.mgenbio.com/show-160-131-1.html to read the detailed instruction manual.

a. Add 100 μL of PBS buffer, 2.5 mL of Buffer ATL, and 100 μL of Proteinase K to the cells.

b. Vortex thoroughly to mix, and incubate at 55°C in a water bath for 3 h.

c. Add 50 μL of RNase A to the lysis solution.

d. Invert and mix thoroughly, then incubate at 37°C for 60–120 min.

e. Add 2.5 mL of Buffer DL to the lysis solution.

f. Vortex thoroughly for 20 s.

g. Place in a water bath at 70°C for 10 min.

h. Add 2.5 mL of ethanol to the lysate, and immediately vortex at maximum speed for 20 s to mix thoroughly.

i. Place the HiPure gDNA Mid Binding Column in the 15 mL collection tube.

j. Transfer the supernatant to the column.

k. Centrifuge at 5,000 g for 5 min, then discard the filtrate.

l. Add 2 mL of Buffer GW1 to the column, then centrifuge at 5,000 g for 5 min, then discard the filtrate.

m. Add 4 mL of Buffer GW2 to the column, then centrifuge at 5,000 g for 5 min, then discard the filtrate.

n. Centrifuge at 5,000 g for 10 min to dry the matrix in the column.

o. Transfer the column to a new 15 mL collection tube, then add 300 μL of Buffer AE.

p. Allow it to sit at room temperature for 3 min to elute the DNA.

q. Centrifuge at 5,000 g for 10 min, then measure the DNA concentration using a Nanodrop. Store the genomic DNA at −20°C.

Amplification and purification of the target gene

Timing: 4 h

26. Amplify the integrated sgRNA with the following reagents and reaction program:

Reagent	Amount	
gDNA template	1 μg	
10 μM forward primer	2.5 μL	
10 μM reverse primer	2.5 μL	
Q5 Hot Start High-Fidelity 2× Master Mix	25 μL	
ddH2O	to a final volume of 50 μL	

Steps	Temperature (°C)	Time	Cycles	
Pre-denaturation	98	2 min	1	
Denaturation	98	10 s	25	
Annealing	58	30 s	
Extension	72	30 s	
Final extension	72	10 min	1	
Hold	4			

The DNA fragments containing the sgRNA sequences are amplified by PCR using the following primers: forward, 5′-TGGACTATCATATGCTTACCGTAACTTGAAAGT-3’; reverse, 5′-AGTTTGTATGTCTGTTGCTATTATG-3’.Note: Both the control and sorted genomic DNA samples were amplified simultaneously in four 50 μL PCR reactions. One microgram of genomic DNA was used as a template in each reaction. The number of PCR reactions depends on the amount of extracted genomic DNA, and ideally, the number of reactions should be maximized to accommodate the available DNA.

27. Purify PCR products using the DNA Clean & Concentrator-100 kit.Note: You can click on the link https://zymoresearch.eu/products/dna-clean-concentrator-100 to read the detailed instruction manual.

Note: Using a kit for PCR product purification is necessary, as it ensures the purity of the DNA required for downstream library preparation and sequencing. Library-grade PCR purification kits can serve as suitable alternatives.

a. Add 5 volumes of DNA Binding Buffer to the PCR products and mix thoroughly.

b. Transfer the mixture to a Zymo-Spin V column, centrifuge at 500 g for 5 min, and discard the filtrate.

c. Add 2 mL of DNA Wash Buffer, centrifuge at 500 g for 5 min, and discard the filtrate.

d. Repeat the wash step once.

e. Transfer the column to a collection tube, centrifuge at maximum speed for 30 s, and discard the filtrate.

f. Transfer the column to a new 1.5 mL EP tube, then add 150 μL of DNA Elution Buffer. Allow it to stand for 1 min to elute the DNA.

g. Centrifuge at maximum speed for 30 s, then collect the filtrate.

28. Measure the DNA concentration using a Nanodrop. Approximately 3 μg of PCR amplicon can be obtained from every 500,000 cells collected.a. Assess the purity of the PCR products using agarose gel electrophoresis (Figure 4B).

b. For PCR amplicons, when using the VAHTS Universal DNA Library Prep Kit for Illumina V3 (Vazyme #ND607) for library preparation, the library amplification step is skipped and instead a PCR-Free approach is used directly for the amplicon library construction.

c. Send the library for deep sequencing. The sequencing platform for the CRISPR Screen is Illumina, with a sequencing strategy of PE150 (Paired End 150).

Note: For PCR-free library preparation, each sample typically generates between 1 and 10 GB of data.

Expected outcomes

In this protocol, we first obtained highly purified GST-Cholesin-His protein for subsequent ligand binding assays. As depicted in Figure 1A, the expression of soluble GST-Cholesin-His is optimal when the IPTG concentration reaches 0.25 mM. Therefore, in large-scale induction and purification processes, a final concentration of 0.25 mM IPTG was employed as the induction agent. Affinity purification was carried out using a nickel column, followed by desalting procedures. The purity of the protein was assessed via Coomassie staining, as illustrated in Figure 1B. The highly purified GST-Cholesin-His displays a molecular weight slightly under 50 kDa. Protein concentration was determined using the Bradford assay. The yield was approximately 2 mg of GST-Cholesin-His per liter of E. coli culture. This preparative process ensures a sufficient quantity and adequate quality of the recombinant protein for the intended downstream experiments.

Subsequently, we established stable MCF7 monoclonal cell lines expressing Cas9. Among the twelve derived monoclonal cell lines, the expression levels of Cas9 protein were examined using immunoblot analysis. Clone numbers 6, 9, and 12 displayed notably higher Cas9 expression profiles compared to others (Figure 2). These three high-expressing clones were then selected to proceed with further validation of both Cas9 enzyme activity and the ability of the cells to bind the ligand of interest (Cholesin). Employing the pXPR-011 system, we assayed the activity of Cas9 in the stable monoclonal cell lines. Flow cytometry results indicated that all three monoclonal lines exhibited high Cas9 activity (Figure 3A). Moreover, the overexpression of Cas9 did not interfere with the cells' ability to interact with the ligand Cholesin (Figure 3B), suggesting that the ligand binding affinity remained unaltered. Consequently, these results imply that all three monoclonal cell lines are suitable candidates for advancing to the subsequent receptor screening studies.

Flow cytometry was utilized to sort cells exhibiting reduced capacity for ligand binding. The gating strategy employed during this selection process is depicted in Figure 4A. In each experiment, the unsorted cells served as the input control. Genomic DNA was extracted from both the input cells and the sorted cells, followed by PCR amplification of the gRNA sequences. The resulting PCR products were then analyzed through agarose gel electrophoresis, where a distinct band at approximately 300 bp was observable (Figure 4B). These amplified PCR products were subsequently prepared for next-generation sequencing, enabling a comprehensive analysis of the genetic modifications introduced by the gRNA.

Limitations

When utilizing this method to identify a protein ligand’s receptor, a significant limitation arises from the necessity of finding cell lines capable of binding to the protein ligand. It can sometimes be challenging to procure appropriate cells. Additionally, the cell lines employed for screening must be readily cultured in large quantities and receptive to lentiviral infection. Cell lines with extended doubling time pose challenges in expanding cultures, while those resistant to infection necessitate larger quantities of lentivirus, leading to heightened experimental costs.

Furthermore, a ligand may exhibit promiscuity, binding to multiple receptors.8 Alternatively, a receptor may require pairing with an auxiliary receptor (known as a co-receptor) to effectively transmit signals or perform specific biological functions.9 In such cases, the ligand-receptor interaction network becomes more intricate, necessitating further investigation to comprehend the relevant interactions and their impact on biological processes. These complications can result in the possibility of incomplete abolishment of ligand binding signals upon receptor knockout, leading to false negatives in experiments.

In addition to loss-of-function screening, a CRISPRa system has been developed, which achieves upregulation of endogenous receptors through cost-effective gRNA libraries.6 This system enables the detection of ligand-cell interactions by augmenting the expression of interacting receptors. In the future, integrating the outcomes of CRISPR knockout and CRISPR activation experiments will yield a more comprehensive understanding of ligand functionality.

Troubleshooting

Problem 1

Low protein yield (purification of protein ligands tagged with GST and His, step 16).

Potential solution

• Conduct codon optimization on the coding sequence of the ligand.

• Enhance protein solubility while ensuring high expression levels. Experiments can be designed with varying temperature gradients and inducer concentration gradients, further optimizing the induction expression conditions.

• Regenerate or replace the nickel column.

Problem 2

Low protein purity (purification of protein ligands tagged with GST and His, step 16).

Potential solution

After affinity purification on the nickel column, the obtained proteins can be mixed and concentrated using concentrators containing 10 kDa NMWL membranes to a volume less than 2 mL. Further purification and separation can be carried out using a Superdex 200 Increase 10/300 GL column.

Problem 3

Formation of stable monoclonal cells overexpressing Cas9 is less frequent or not observed (generating Cas9-expressing cells, step 28).

Potential solution

• Ensure blasticidin selection time is limited to within one week to prevent increased drug resistance in the later stages of screening.

• During the monoclonal formation process, ensure that the culture medium does not contain blasticidin.

• When attempting cloning using the limiting dilution method, be sure to observe each well for the presence of multiple colonies.

Problem 4

After immunofluorescent staining for ligand binding on the membrane of the cells, the fluorescence intensity is weak or undetectable (evaluating gene knockout efficiency and ligand binding capacity in MCF7-Cas9 stable cell lines, step 61).

Potential solution

• The activity of the protein ligand may be low. It is advisable to shorten the duration of the protein purification procedure and maintain a low temperature throughout the purification process.

• Increase the antibody concentration to 1:500 or higher.

• Incubate with secondary antibody at room temperature.

Problem 5

The PCR amplification failed or yielded a low amount of PCR products (amplification and purification of the target gene, step 28).

Potential solution

• Check if the input sample can be successfully amplified by PCR. If the input sample fails to amplify as well, it suggests poor performance of the sgRNA library, and it is advisable to re-infect and rebuild the library.

• Increase the number of PCR amplification cycles.

• When sorting, dilute cells in DMEM medium, and collect them in tubes containing DMEM with 20% FBS to maintain cell viability.

Resource availability

Lead contact

Requests for further information, reagents and resources will be fulfilled by the lead contact, Yiguo Wang (yiguo@mail.tsinghua.edu.cn).

Technical contact

For further information and technical details, please contact the technical contact, Xiaoli Hu (huxl18@mails.tsinghua.edu.cn).

Materials availability

This study did not generate new unique reagents.

Data and code availability

This study did not generate datasets or codes.

Acknowledgments

This work was supported by grants from the 10.13039/501100002855 Ministry of Science and Technology of the People’s Republic of China (2021YFA0804801 ) and the 10.13039/100014717 National Natural Science Foundation of China (82088102 , 31830040 , and 91957206 ).

Author contributions

X.H. performed all experiments and analyzed the data. X.H. and Y.W. wrote the paper. Both authors approved the final manuscript.

Declaration of interests

The authors declare no competing interests.
==== Refs
References

1 Hu X. Chen F. Jia L. Long A. Peng Y. Li X. Huang J. Wei X. Fang X. Gao Z. A gut-derived hormone regulates cholesterol metabolism Cell 187 2024 1685 1700.e18 10.1016/j.cell.2024.02.024 38503280
2 Pires-daSilva A. Sommer R.J. The evolution of signalling pathways in animal development Nat. Rev. Genet. 4 2003 39 49 10.1038/nrg977 12509752
3 Baes M. Denef C. Evidence that stimulation of growth hormone release by epinephrine and vasoactive intestinal peptide is based on cell-to-cell communication in the pituitary Endocrinology 120 1987 280 290 10.1210/endo-120-1-280 3023029
4 Balthasar N. Coppari R. McMinn J. Liu S.M. Lee C.E. Tang V. Kenny C.D. McGovern R.A. Chua S.C. Jr. Elmquist J.K. Lowell B.B. Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis Neuron 42 2004 983 991 10.1016/j.neuron.2004.06.004 15207242
5 Sallusto F. Mackay C.R. Lanzavecchia A. The role of chemokine receptors in primary, effector, and memory immune responses Annu. Rev. Immunol. 18 2000 593 620 10.1146/annurev.immunol.18.1.593 10837070
6 Chong Z.S. Ohnishi S. Yusa K. Wright G.J. Pooled extracellular receptor-ligand interaction screening using CRISPR activation Genome Biol. 19 2018 205 10.1186/s13059-018-1581-3 30477585
7 Doench J.G. Hartenian E. Graham D.B. Tothova Z. Hegde M. Smith I. Sullender M. Ebert B.L. Xavier R.J. Root D.E. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation Nat. Biotechnol. 32 2014 1262 1267 10.1038/nbt.3026 25184501
8 Su C.J. Murugan A. Linton J.M. Yeluri A. Bois J. Klumpe H. Langley M.A. Antebi Y.E. Elowitz M.B. Ligand-receptor promiscuity enables cellular addressing Cell Syst. 13 2022 408 425.e12 10.1016/j.cels.2022.03.001 35421362
9 Kirkbride K.C. Ray B.N. Blobe G.C. Cell-surface co-receptors: emerging roles in signaling and human disease Trends Biochem. Sci. 30 2005 611 621 10.1016/j.tibs.2005.09.003 16185874
