
==== Front
J Biol Chem
J Biol Chem
The Journal of Biological Chemistry
0021-9258
1083-351X
American Society for Biochemistry and Molecular Biology

S0021-9258(24)02202-6
10.1016/j.jbc.2024.107701
107701
Research Article
A heterocyclic compound inhibits viral release by inducing cell surface BST2/Tetherin/CD317/HM1.24
Nyame Perpetual 1
Togami Akihiro 2
Yoshida Tomofumi 1
Masunaga Takuya 2
Begum MST Monira 3
Terasawa Hiromi 1
Monde Nami 1
Tahara Yurika 2
Tanaka Reiko 4
Tanaka Yuetsu 4
Appiah-Kubi Joyce 1
Amesimeku Wright Andrews Ofotsu 1
Hossain Md Jakir 1
Otsuka Masami 25
Yoshimura Kazuhisa 6
Ikeda Terumasa 3
Sawa Tomohiro 1
Satou Yorifumi 7
Fujita Mikako 2
Maeda Yosuke 18
Tateishi Hiroshi htateishi@kumamoto-u.ac.jp
29∗
Monde Kazuaki monde@kumamoto-u.ac.jp
110∗
1 Department of Microbiology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan
2 Medicinal and Biological Chemistry Science Farm Joint Research Laboratory, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan
3 Division of Molecular Virology and Genetics, Joint Research Center for Human Retrovirus Infection, Kumamoto University, Kumamoto, Japan
4 Laboratory of Hemato-Immunology, Graduate School of Health Sciences, University of the Ryukyus, Okinawa, Japan
5 Department of Drug Discovery, Science Farm Ltd, Kumamoto, Japan
6 Department of Microbiology, Tokyo Metropolitan Institute of Public Health, Tokyo, Japan
7 Division of Genomics and Transcriptomics, Joint Research Center for Human Retrovirus Infection, Kumamoto University, Kumamoto, Japan
8 Department of Nursing, Kibi International University, Takahashi, Japan
9 Research & Development, Hirata Corporation, Kumamoto, Japan
10 Collaboration Unit for Infection, Joint Research Center for Human Retrovirus Infection, Kumamoto University, Kumamoto, Japan
∗ For correspondence: Kazuaki Monde; Hiroshi Tateishi htateishi@kumamoto-u.ac.jpmonde@kumamoto-u.ac.jp
22 8 2024
9 2024
22 8 2024
300 9 10770131 5 2024
1 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
The introduction of combined antiretroviral therapy (cART) has greatly improved the quality of life of human immunodeficiency virus type 1 (HIV-1)-infected individuals. Nonetheless, the ever-present desire to seek out a full remedy for HIV-1 infections makes the discovery of novel antiviral medication compelling. Owing to this, a new late-stage inhibitor, Lenacapavir/Sunlenca, an HIV multi-phase suppressor, was clinically authorized in 2022. Besides unveiling cutting-edge antivirals inhibiting late-stage proteins or processes, newer therapeutics targeting host restriction factors hold promise for the curative care of HIV-1 infections. Notwithstanding, bone marrow stromal antigen 2 (BST2)/Tetherin/CD317/HM1.24, which entraps progeny virions is an appealing HIV-1 therapeutic candidate. In this study, a novel drug screening system was established, using the Jurkat/Vpr-HiBiT T cells, to identify drugs that could obstruct HIV-1 release; the candidate compounds were selected from the Ono Pharmaceutical compound library. Jurkat T cells expressing Vpr-HiBiT were infected with NL4-3, and the amount of virus release was quantified indirectly by the amount of Vpr-HiBiT incorporated into the progeny virions. Subsequently, the candidate compounds that suppressed viral release were used to synthesize the heterocyclic compound, HT-7, which reduces HIV-1 release with less cellular toxicity. Notably, HT-7 increased cell surface BST2 coupled with HIV-1 release reduction in Jurkat cells but not Jurkat/KO-BST2 cells. Seemingly, HT-7 impeded simian immunodeficiency virus (SIV) and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) release. Concisely, these results suggest that the reduction in viral release, following HT-7 treatment, resulted from the modulation of cell surface expression of BST2 by HT-7.

Keywords

BST2
tetherin
Vpu
HIV-1
SARS-CoV-2
SIVmac239
drug screening
Abbreviations

BST2 Bone marrow stromal cell antigen 2

cART combined antiretroviral therapy

Reviewed by members of the JBC Editorial Board. Edited by Craig Cameron
==== Body
pmcDespite enormous scientific efforts to eradicate the human immunodeficiency virus type 1 (HIV-1), HIV-1 is still considered a worldwide disease burden (1). Undoubtedly, the commencement of combined antiretroviral therapy (cART) in 1996 tremendously improved the living conditions of HIV-1-infected individuals by repressing viral replication, and thereby attaining undetectable viremia (2). To date, the Food and Drug Administration (FDA) has clinically approved approximately 43 HIV-1 antiretroviral drugs (3). However, until recently, protease inhibitors were the only existing cARTs to target the late stage of the viral life cycle.

While the early phase of the viral life cycle commences with the attachment of the virus to the susceptible host cells and lasts up to the integration of viral DNA into the host genome, the late stage encompasses gene expression, viral release, and maturation of progeny virions. About ten protease inhibitors (e.g., darunavir) (4, 5) and the currently approved long-acting capsid inhibitor (lenacapavir) (6) hinder the formation of mature particles. So far, several compounds targeting virus release have been discovered (7, 8, 9, 10, 11). Both early (12, 13, 14) and late-stage (15) suppression by PF-3450074 (HIV-1 Gag inhibitor) has been demonstrated. Notable among these compounds are those that occlude Gag membrane binding (compound 7) (7), assembly of Gag (capsid assembly inhibitors; CAI peptide) (8), and viral pinch-off (cyclin peptide 11) (9). Nevertheless, these compounds have not been approved for clinical use. Concurrently, the demand to enhance cART options (6) has made it necessary to develop drugs that act in the late stage of the viral life cycle.

HIV-1 Gag is predominantly associated with the release and maturation of the progeny virus at the late stage. The HIV-1 Gag consists of four major domains: matrix (MA), capsid (CA), nucleocapsid (NC), and late domain (p6) (16, 17). The MA facilitates the targeting and binding of Gag to phosphatidylinositol 4,5-bisphosphate (18, 19) through the exposure of the myristate group (20, 21, 22, 23). Following membrane binding, MA engages the enveloped glycoprotein in the growing virions (24, 25). While CA is crucial in the formation of an immature Gag lattice through Gag multimerization (26, 27), the NC packages viral genomic RNA into the virions (28). Not only does the p6 attain viral pinch-off through the cellular endosomal sorting complex required for transport machinery, but it also packages the viral accessory protein (Vpr) into the virions (29, 30). Given the role of HIV-1 Gag in the late stage of the viral life cycle, any compound that targets its functioning would undoubtedly be a major inhibitor of this phase of the life cycle.

Lately, there has been a profound interest in exploiting cellular restriction factors in the design and development of new antiviral drugs (31, 32). The most studied cellular antiviral regulator against HIV-1 replication is BST2 (Bone marrow stromal cell antigen 2)/Tetherin/CD317/HM1.24. BST2 is an interferon-inducible protein expressed by numerous cell types that exhibit its inhibitory effects on viral release (33, 34). With the help of its components sited in the plasma membrane (PM), BST2 confines progeny virions on the cell surface, thereby accomplishing its release inhibitory effect on HIV-1 replication (35). The BST2’s structural component (transmembrane, coiled-coil, and GPI anchor domain) enables it to entangle budding virions on the cell membrane (33, 36). Earlier studies illustrated that BST2 colocalizes with HIV-1 Gag on the cell surfaces as well as in endosomes, thus showcasing BST2’s release inhibitory impact on the cell surface and within cells (33). On the other hand, viral accessory proteins have perpetually evolved interfering mechanisms against host antiviral factors, invariably accelerating their replication in susceptible hosts (37). Regarding BST2, diverse viral proteins nullify its influence on viral replication. For instance, viral Vpu and Env equilibrate BST2’s impact on HIV-1 and HIV-2 replication. Conversely, the simian immunodeficiency virus (SIVcpz, SIVtan, and other SIV) neutralizes BST2 activity by Vpu, Env, and Nef proteins (34, 38). The ability of BST2 to combat enveloped viruses and its species specificity makes it a plausible candidate for HIV-1 therapy. Unquestionably, a compound with the potency of modulating BST2 may restrain HIV-1 release. To date, a compound aimed at harnessing BST2 activities against HIV-1 has not yet received clinical approval.

Here, we established the Vpr-HiBiT technique for screening viral release inhibitors. The conceptual basis of this technique relies on the ability of the HIV-1 Gag p6 domain to assemble the HIV-1 Vpr into a progeny virion. The integrated Vpr has diverse roles in the initial stages of viral replication. For instance, in the early phase of HIV-1 replication, Vpr coordinates the importation of the pre-integration complex into cell nuclear (39, 40). The small HiBiT peptide fused to Vpr forms luminescence after it binds to a corresponding protein called LgBiT (41, 42). In other words, the amounts of Vpr-HiBiT in the released HIV-1 can be evaluated as the luciferase activity generated following the addition of a substrate and LgBiT to the lysed virions.

The procedure and cost of the Jurkat/Vpr-HiBiT screening system are not laborious and costly compared to those of previous systems, such as the p24 ELISA. Using the screening system, candidate compounds obtained from the Ono Pharmaceutical compound library that restrain HIV-1 release were selected. A derivative compound HT-7 attenuated viral pinch-off by triggering the production of cell surface BST2 with negligible cytotoxic effect. In a nutshell, this study unveils a high-performance technique for exploring HIV-1 late-stage inhibitors. Through this technique, we discovered a heterocyclic compound that enhances the expression of BST2 on the surface of T-cells, resulting in the interference of the efficiency of viral release.

Results

Jurkat/Vpr-HiBiT is an established cell line for drug screening

To measure the amount of viral progeny, we established several Jurkat T cell lines expressing the reporter genes driven by HIV-1 Tat (Fig. 1A). In the nanoluciferase (NLuc; 19 kDa)-expressing T cells, NLuc was secreted in the virus-free supernatant (fractionated cell supernatant that does not contain virus) but not assembled into virions. Hence, Vpr-fused NLuc and Vpr-fused repetitive NLuc (2NLuc, 3NLuc, and 4NLuc) were transduced into Jurkat cells to accelerate the assembly of NLuc into the virions. However, the amount of all repetitive NLucs in the virus-free supernatant was almost the same as that of NLuc in the cell supernatant. The Vpr fused with smaller peptide HiBiT (Vpr-HiBiT) in the virus-free supernatant was markedly reduced compared with that of Vpr-HiBiT in the cell supernatant. Consistently, the amount of p24 Gag assembled into virions was the same as that into the cell supernatant (Fig. 1B). The efficiency of the Vpr-HiBiT and p24 Gag assembly into the virions produced from 293T/Vpr-HiBiT cells was significantly lower than that in the cell supernatants (Fig. 1, C and D). It indicates that approximately 25% of Vpr-HiBiT and p24 Gag secreted into the cell supernatant were not assembled into the virions, suggesting that Jurkat cells would be proper for drug screening. Firefly and renilla luciferase, which are large proteins (61 kDa and 36 kDa, respectively), were not assembled as HiBiT, suggesting that the smaller size of the reporter was key to the Vpr assembly into the virions (Fig. 1E). The amount of Vpr-HiBiT in the cell supernatant was evaluated by treatment with reverse transcriptase inhibitors (RT inhibitors: efavirenz 9 nM and nevirapine 840 nM) (43, 44) at pre-infection or 15 h post-infection using Jurkat/Vpr-HiBiT cells (Fig. 1F). As expected, the Vpr-HiBiT in the cell supernatant was markedly reduced by the treatment with RT inhibitors at pre-infection but not at 15 h post-infection. This result indicates that reverse transcription had been accomplished by 15 h post-infection. The inhibition of Vpr-HiBiT amounts in the cell supernatant by PF-3450074 (Gag inhibitor) at 15 h post-infection was confirmed as reported (IC50: 0.22 μM and CC50: 32.3 μM) (Fig. 1, G and H). It suggests that the 15 h post-infection period was suitable for screening drugs targeting the late phase of the viral life cycle.Figure 1 Vpr-HiBiT co-assembled with Gag into the virions.A, Jurkat cells expressing the indicated nanoluciferase (NLuc), Vpr-fused NLuc, Vpr-fused repetitive NLuc (x2, x3, x4), and Vpr-fused HiBiT were infected with VSV-G-pseudotyped-NL4-3/KFS. The NLuc activity in the cell and the cell supernatant was measured 3 days post-infection. The virus and the virus-free cells were fractionated from the cell supernatant. B, Jurkat cells were infected with VSV-G-pseudotyped-NL4-3/KFS. The amount of p24 was measured 3 days post-infection. C, 293T cells encoding the LTR-driven Vpr-fused HiBiT were transfected with pNL4-3/KFS. The NLuc activity in the cell and the cell supernatant was measured 2 days post-transfection. D, 293T cells were transfected with pNL4-3/KFS, and the amounts of p24 were measured 2 days post-transfection. E, Jurkat cells encoding the LTR-driven indicated luciferase (firefly: FLuc, renilla: RLuc) were infected with VSV-G-pseudotyped-NL4-3/KFS. The luciferase activities were measured 3 days post-infection. F, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped-NL4-3/KFS. The infected cells were treated with each 9 nM and 840 nM of the drugs (efavirenz, EFV; nevirapine, NVP) at 0 h and 15 h post-infection. The NLuc activities were measured 3 days post-infection. G, structure of PF-3450074. H, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped-NL4-3/KFS. About 15 h post-infection, the infected cells were treated with PF-3450074 at concentrations (100 μM, 50 μM, 25 μM, 12.5 μM, 6.3 μM, 3.2 μM, 1.6 μM, and 0.8 μM). The NLuc activities were measured 3 days post-infection. The error bars denote the means ± standard deviation of three independent experiments (n = 3). The One-way ANOVA by Sidak's multiple comparison test (B, C, and D) and the Two-way ANOVA using Tukey's multiple comparison test (A, E, and F) were applied to compare the data. The IC50 and CC50 values were analyzed by GraphPad Prism (Nonlinear regression) (G)∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant.

Compounds selected from the library reduce the virus release

To identify the leader compounds that would inhibit virus release, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped NL4-3 using the core library from the drug discovery initiative (9600 compounds, 5 μM) and the Ono Pharmacy compound library (3280 compounds, 5 μM). To exclusively select late-stage inhibitors, the infected cells were treated with these compounds at 15 h post-infection. None of the 9600 compounds in the core library reduced both Vpr-HiBiT and p24 Gag in the cell supernatant (Data not shown). Ninety-four of the 3280 compounds reduced Vpr-HiBiT in the cell supernatant, but 10 out of these 94 compounds did not reduce p24 Gag (Fig. 2A). These results suggest that these 10 compounds would inhibit Vpr assembly into the virions or the binding between HiBiT and LgBiT as described in the discussion. Fifty out of the 94 compounds induced obvious cell toxicity as observed by microscopy. Therefore, the remaining 34 compounds were selected from the first drug screening (red dots in Fig. 2A). In the second drug screening, 10 out of the remaining 16 reduced the nanoluciferase activity without cell toxicity (red dots in Fig. 2B). Seven out of 10 selected compounds consistently reduced the amount of p24 Gag by more than 40% (red dots in Fig. 2C). The compound ONO#05 markedly reduced the p24 Gag in the cells and the cell supernatant (Fig. 2D), a result suggesting that ONO#05 would either inhibit Gag protein synthesis or induce the death of HIV-1-infected cells through the lock-in and apoptosis pathway (45). Nonetheless, the compound ONO#08 reduced p24 Gag to about 60% in the cell supernatant without inhibiting the amount of p24 Gag in the cells.Figure 2 Ten small compounds are candidates for virus release inhibition.A–D, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped-NL4-3/KFS. The infected cells were treated with 5 μM of the compounds selected from the Ono Pharmaceutical compound library (drug discovery initiative of Tokyo University) at 15 h post-infection. The NLuc activity and the amount of p24 in the cell supernatants (A–D) and the cells (D) were measured 3 days post-infection. B and C, The uninfected cells were treated with the compounds. Two days after compound treatment, the cell viability was examined by MTT assay.

Derivative compound HT-7 reduces virus release

Three compounds (ONO#06, #07, #08), out of the 10 selected, had a benzothiophene dioxide (BTD group), as indicated by the red dotted square (Fig. 3A); we focused on ONO#08 to design the derivatives (Fig. S1). Initially, the region of disparate structures among the selected compounds (ONO#06, #07, #08) was modified to form derivative compounds (Fig. 3B). However, these derivatives exhibited high cellular toxicity (Fig. 3D). As a result, the derivative compounds (HT-5, HT-6, and HT-7) were designed by changing the BTD group on the leader compound (ONO#08) (Figs. 3C and S1). Unexpectedly, HT-1, which has the same structure as ONO#08, reduced Vpr-HiBiT in the cell supernatant only by 25% and caused cytotoxicity (Fig. 3E). It suggests that the purity of ONO#08 from Ono Pharmacy compound library might have decreased due to its prolonged storage. Importantly, the derivative HT-7 (50 μM) reduced Vpr-HiBiT in the cell supernatant by 60% and caused lower cytotoxicity (Fig. 3E). The EC50 and CC50 values for HT-1 were 1.4 μM and 4.4 μM, respectively (Fig. 3F). Compared to those for HT-1, the EC50 and CC50 values for HT-7 were 95.8 μM and 418.9 μM, respectively (Fig. 3F). Thus, 50 μM of HT-7 was repeatedly used in further experiments. The leader compound (ONO#08) did not reduce the expression of HIV-1 Gag in the cells (Fig. 2D), suggesting that these derivatives (HT-5, HT-6, and HT-7) would inhibit viral release from HIV-1-infected T cells.Figure 3 Derivatives inhibit the virus release.A–C, structures of the three candidates and nine derivative compounds. A BTD group is shown in the purple dot box. D and E, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped-NL4-3/KFS. The infected cells were treated with the indicated compounds at 15 h post-infection. The NLuc activity was measured 3 days post-infection. The uninfected cells were treated with the indicated compounds. Two days after compound treatment, the cell viability was examined by MTT assay. F, the Prism software determined EC50 and CC50.

Gag accumulation in the sites of cell polarity is disturbed by HT-7

Following the binding of HIV-1 Gag to the PM, it is assembled at the PM. To assess the impact of HT-7 on HIV-1 Gag expression and localization to the PM, Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped NL4-3-GagVenus. HT-7 significantly enhanced the mean fluorescence intensity (MFI) of GagVenus in the cells compared to that in DMSO-treated cells (DMSO; MFI = 474, HT-7; MFI = 641) (Fig. 4, A and B). These results suggest that the derivative compounds might induce Gag accumulation in the cells or accelerate Gag expression in the cells. Gag localization at the PM was approximately 40% in Jurkat/Vpr-HiBiT cells with DMSO (Fig. 4, C and D). Moreover, confocal microscopy showed approximately 20% cell polarity in DMSO condition, observed by Gag accumulation at the uropod surface (Fig. 4, C and E). Compared to DMSO, HT-7 slightly increased the Gag localization at the PM (to approximately 60%) (Fig. 4D). Nevertheless, HT-7 perturbed the cell polarity, resulting in Gag distribution all over the cell surface (Fig. 4, C and E). These results suggest that HT-7 induces Gag accumulation in infected cells by changing the cell membrane state, such as membrane fluidity and/or cytoskeleton-like actin filaments.Figure 4 Gag localization is affected by HT-7. Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped-NL4-3/GagVenus. The infected cells were treated with 50 μM HT-7 at 15 h post-infection. A and B, the cells were analyzed by Flow cytometry. C, the cells were observed using confocal microscopy. Images were acquired at the mid-section and the top-section of the cells. Gray arrows indicate Gag accumulation in the polarized area. The scale bar indicates 10 μm. D, the cells with Gag localized predominantly to the PM (green), to the intracellular compartments (gray), or in the cytosol (black) were counted. About 100 cells that showed Gag signals were examined. E, the polarized (dark green) or nonpolarized (light green) cells with Gag localized to the PM were counted. Each cell was imaged from top to bottom and the number of cells with Gag accumulated on the PM was counted.

HT-7 does not regulate the cell surface expression of PSGL-1

We postulated that HT-7 might influence the expression and localization of cell surface microdomains, such as P-selectin glycoprotein ligand-1 (PSGL-1), CD43, and CD44, due to its effects on the membrane state. However, the expression of PSGL-1 on the cell surface was not regulated by HT-7 treatment (Fig. 5A). Previous studies have proved that HIV-1 Gag co-assembles with PSGL-1 via the highly basic region (HBR) of MA (46). In pursuit of disclosing HT-7’s implications in HIV-1 Gag engagement with PSGL-1, we adopted HIV-1 constructs designated as Fyn (10), which has two palmitoyl groups for stable membrane binding. The Fyn (10)/6A2T mutant lacks an HBR in the MA domain and binds to the PM regardless of PI(4,5)P2. In these HIV-1 constructs, HT-7 did not affect the co-assembly between HIV-1 Gag and PSGL-1 (Fig. 5, B and C). Akin to the findings from a previous report (46), we detected an inverse relationship between PSGL-1 expression and HIV-1 Gag expression and a direct association between PSGL-1 expression and Fyn (10)/6A2T Gag expression (Fig. 5D). However, HT-7 did not appear to have any effect on the correlation between HIV-1 Gag and PSGL-1’s in Fyn (10)/6A2T (Fig. 5D).Figure 5 Cellular surface expression of PSGL-1 nor its interaction with HIV-1 Gag is not affected by HT-7.A, Jurkat cells were infected with VSV-G-pseudotyped-NL4-3/GagVenus for 15 h, after which infected cells were washed and then treated with 50 μM HT-7. The infected cells were incubated for 48 h, then cells were analyzed by flow cytometry. The error bars denote the means ± standard deviation of three independent experiments (n = 3). The One-way ANOVA by Sidak's multiple comparison test (B, C, and D) and the Two-way ANOVA using Tukey's multiple comparison test (A, E, and F) were applied to compare the data. ∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant. B, representative diagram of HIV-1 Gag co-clustering with PSGL-1 in the presence or absence of 50 μM HT-7. Jurkat/Vpr-HiBiT cells were infected with or without VSV-G-pseudotyped-NL4-3/GagVenus, VSV-G-pseudotyped-Fyn (10)/fullMA/GagVenus and VSV-G-pseudotyped-Fyn (10)/6A2T/GagVenus for 15 h, and the cells were observed by confocal laser microscopy. The green color indicates Gag-YFP signals and the red color indicates PSGL-1 signals. The scale bar indicates 10 μm. C, each dot denotes single cells, n = 28. Error bars indicate the mean ± standard deviation. The correlation (r) between the MFI of PSGL-1 and HIV-1 Gag in control and treated conditions was calculated by Pearson’s correlation test. p values were determined by Two-way ANOVA using Tukey’s multiple comparison test. ∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant. D, by employing Image J software, the MFI of HIV-1 GagVenus and PSGL-1 was determined. Each dot denotes an individual cell, n = 36. Error bars show the means ± standard deviation of repeated tests. The correlation (r) between the MFI of PSGL-1 and HIV-1 Gag in control and treated conditions was calculated by Pearson’s correlation test. ∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant.

Cell surface expression of BST2 is upregulated upon HT-7 treatment

Because of these findings, we re-directed our assumption to other PM-associated molecules. BST2/Tetherin/CD317/HM1.24 is a well-known restriction factor that inhibits HIV-1 release by tethering the virus onto the PM. Besides, HIV-1 Vpu counteracts the anti-release effect of BST2 (35). Given the above, we analyzed BST2 cell surface expression in Jurkat/Vpr-HiBiT cells treated with HT-7. The treatment of uninfected Jurkat/Vpr-HiBiT cells and NL4-3-infected Jurkat/Vpr-HiBiT cells with HT-7 led to a significant increase in MFI of BST2 on the cell surface (Fig. 6, A and B). Consequent to the treatment of HT-7 to cells infected with HIV-1 mutants lacking Vpu, no further decline in NLuc activity and p24 amounts was determined (Fig. 6, C and D). These results suggest that HT-7 reduces the viral release by canceling the effects of Vpu, thereby retaining BST2 on the cell surface.Figure 6 Knockout of BST2 canceled HT-7’s release inhibitory effect. The MFI of BST2 on Jurkat/Vpr-HiBiT cells (A) and infected Jurkat/Vpr-HiBiT cells (B) treated with 50 μM HT-7 was determined following analysis by flow cytometry. The NLuc activity (C) and the amount of p24 (D) in the supernatant from the infected Jurkat/Vpr-HiBiT cells were analyzed 3 days post-infection. Error bars show the mean ± standard deviation of repeated independent experiments. E, the BST2-positive cell population was analyzed by flow cytometry. (F) The sequences of BST2 in Jurkat/Vpr-HiBiT and Jurkat/Vpr-HiBiT/KO-BST2 cells were analyzed by Sanger sequencing. A guide RNA for BST2 knockout is designed as shown by the arrow. The inserted nucleotides are shown as red color. G, the MFI of BST2 on Jurkat/Vpr-HiBiT or Jurkat/Vpr-HiBiT/BST2-KO cells was determined following analysis by flow cytometry. H, the NLuc activity in the supernatant from the infected Jurkat/Vpr-HiBiT or Jurkat/Vpr-HiBiT/KO-BST2 cells was analyzed 3 days post-infection. (C, D, G, and H) The error bar illustrates the mean ± standard deviation of the repeated independent experiment. Direct comparisons between control and treated conditions were done by Two-way ANOVA using Tukey’s multiple comparison test. ∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant.

BST2 knockout abolished HT-7’s suppressive effect on virus release

To confirm whether the effect of virus release suppression is due to the induction of BST2 by HT-7 treatment, we established knockout BST2 cells using the CRISPR/Cas9 mediated genome editing technique (Fig. 6, E and F). In Jurkat Vpr-HiBiT BST2 knockout cell lines (Jurkat/Vpr-HiBiT/KO-BST2), five (5) and two (2) nucleotides were inserted into the open reading frame of the bst2 gene. HT-7 treatment did not upregulate BST2 expression in Jurkat/Vpr-HiBiT/KO-BST2 cells (Fig. 6G). Furthermore, the inhibitory effect of HT-7 was abolished in the absence of BST2 (Fig. 6H). In addition, HT-7 did not further reduce the Vpu-defective mutant in the BST2 knockout cells (Fig. 6H). Notably, we discovered a significant decline of about 50% in the release of Vpu defective mutants even in the BST2 knockout cells (Fig. 6H). Previous research has proven that HIV-1 Vpu accelerates HIV-1 release by downregulation of the extracellular expression of BST2 and CD4 (40, 47). In the absence of Vpu, CD4 may reduce viral release by interacting with the HIV envelope protein gp120 on the budding virions in the KO-BST2 cells. These data demonstrate that the attenuation of HIV-1 release by HT-7 is the sequel to its enhancement of BST2 expression on the surface of T-cell lines.

HT-7 alleviates SIVmac239 release and SARS-CoV-2 replication

Earlier studies have extensively unveiled the obstructive influence of BST2 release on other retroviruses, such as SIV, likewise distinct viral counteractive measures directed against BST2. Concomitantly, we hypothesized that HT-7 interferes with viral release in SIVmac239. To analyze SIVmac239 release from infected T cells, we measured the amounts of p27 Gag in virions (Fig. 7A). We found that HT-7 reduced p27 Gag (Fig. 7A), suggesting that HT-7 inhibits the release of SIVmac239 and SARS-CoV-2 by induction of BST2 on the cell surface.Figure 7 HT-7 alleviates SIVmac239 and SARS-CoV-2 release.A, Jurkat Vpr-HiBiT cells were infected with VSV-G-pseudotyped SIVmac239ΔEnv for 15 h. Infected cells were treated with 50 μM HT-7. After 2 days of incubation, p27 amounts in the cell supernatant were analyzed. B, VeroE6/TMPRSS2 cells were infected with SARS-CoV-2 B.1.1 and were treated with 50 μM of HT-7. At 0, 24, 48, and 72 h post-infection, RNA copy in the cell supernatant was quantified by RT-qPCR. C, the uninfected VeroE6 TMPRSS2 cells were treated with HT-7 (25 μM, 50 μM, and 100 μM). Three days after HT-7 treatment, the cell viability was examined by MTT assay. D, the MFI of VeroE6 TMPRSS2 cells was analyzed by flow cytometry. Error bars show the mean ± standard deviations of four experiments. Comparisons of control and treated conditions were evaluated by the unpaired t test (A and D), Two-way ANOVA using Tukey’s multiple comparison test (B), and one-way ANOVA using Sidak’s multiple comparison test (C). ∗, p < 0.01; ∗∗, p < 0.001; ∗∗∗, p < 0.0001; n.s., not significant.

In our quest to ascertain the efficacy of HT-7 against other enveloped viruses, we assessed its impacts on SAR-CoV-2 replication. SARS-CoV-2 harnesses its ORF3a and spike protein to counteract the effect of BST2 on its replication (48, 49). We detected a significant reduction in SARS-CoV-2 replication by HT-7 treatment at 72 h post-infection without cell toxicity (Fig. 7, B and C). Furthermore, we confirmed the increment of cellular surface BST2 by HT-7 in VeroE6/TMPRSS2 cells (Fig. 7D). These results signify that similar to HIV-1, HT-7 reduces SARS-CoV-2 release by augmenting BST2 on the cell surface.

Discussion

In this study, a novel high-performance technique (Vpr-HiBiT screening) for monitoring the efficiency of budding virions in T-cell lines was established. Using this Vpr-HiBiT screening system, we discovered 10 leader compounds from the Ono Pharmaceutical compound library. Here, we revealed that the derivative compound, HT-7, designed from selected candidate compounds, inhibited HIV-1 release in a T cell line as well as SIVmac239 release and SARS-CoV-2 replication by increasing cell surface BST2. Further, in the presence of HT-7, HIV-1 accumulated in producer cells.

In this screening system, NLuc activity based on the Vpr-HiBiT indirectly reflects the amounts of virions in the supernatant from T cell lines. However, in 293T/Vpr-HiBiT cells, Vpr-HiBiT did not reflect the amounts of virions because half of the Vpr-HiBiT was leaked into a virus-free fraction. The mechanism of cell-line-specific Vpr-assembly is not yet known precisely. Nonetheless, the small peptide HiBiT is crucial for the efficient assembly of Vpr into virions. The HiBiT peptide needs to fit into the binding pocket of LgBiT for detection of NLuc activity (50); therefore, compounds, such as DrkBiT (51), interfering with the binding between HiBiT and LgBiT may be selected as false candidates. Hence, to avoid the selection of incorrect candidates, direct quantification, which measures p24 Gag in the cell supernatant, is essential for determining candidate compounds by secondary screening.

Unexpectedly, we were unable to discover any Gag inhibitors in this study. The reason may be that since Gag is expressed in cells in large quantities and is assembled into virions (52, 53), a large number of small compounds may be necessary for blocking the Gag-Gag interaction in cells. Even representative Gag inhibitor PF-3450074, only 50% to 70% inhibits the viral release (Fig. 1G). Therefore, identifying small compounds that interfere with Gag multimerization at the PM might be challenging. It suggests that compounds that target the host molecules might be selected more predominantly through this screening system. Currently, lenacapavir, a compound that fits into the binding pocket of the Gag CA domain, is in the spotlight as an inhibitor of the post-entry step (6, 32). The structure of lenacapavir is complex and completely different from that of the small compounds in the general drug library. It suggests that we need to search for candidates from natural compounds to target the Gag protein. Alternatively, in silico molecular docking studies might be an alternative approach to identifying complex compounds.

The derivative compound, HT-7, with considerable release inhibition and inappreciable cytotoxicity, remarkably elevates the surface expression of BST2 but not PSGL-1. Since BST2 co-assembles with viral structural proteins at the viral forming regions of the PM and tethers the virions on the cell surface, it is likely that HT-7 broadly impedes viral release in enveloped viruses. Predictably, HT-7 attenuation of SIVmac239 release and SARS-CoV-2 replication suggests its broadly restraining effect against the release of other enveloped viruses. Whether the influence of HT-7 on BST2 surface expression involves indirect or direct contact with Vpu is unclear. Notwithstanding, viral restriction factors against BST2 differ among enveloped varies. Hence, the upregulation of BST2 expression by HT-7 may not be associated with a direct interaction of HT-7 with viral counteractive proteins.

As a future direction, whether HT-7 binds directly to BST2 should be investigated. Previous studies reported that BST2 can tether exosomes on the PM just as enveloped viruses (54). The potency of BST2 to influence extracellular exosome levels has also been reported (54, 55). Accordingly, it suggests that a novel therapeutic agent designed from HT-7 may be able to cure several disorders related to exosomes via its augmentation of cell surface BST2. For example, the release of exosomes, associated with neurological diseases and the progression of malignant diseases (56, 57), might also be suppressed by HT-7. Furthermore, BST2 is one of the markers of cancer cells and is a target for anticancer therapy by the induction of antibody-dependent cellular cytotoxicity. Thus, HT-7 may be an expected broad-range therapeutic agent.

Ultimately, the established high-performance screening technique, the Vpr-HiBiT system, can be employed in screening late-stage inhibitors. Moreover, it is economical and requires an unusually short processing and testing time, emphasizing its usefulness for basic research. Further studies to design alternative derivative compounds with effective inhibition ability in primary cell lines and animal models need to be undertaken.

Experimental procedures

Plasmids

The HIV-1 molecular clone pNL4-3/KFS contains a frameshift mutation that disrupts Env expression (58). pNL4-3/GagVenus, encoding Gag fused to the mVenus variant of yellow fluorescent protein (YFP), fusion at the C terminus of Gag, has been described previously (21). The pNL4-3/Fyn (10) fullMA/GagVenus and pNL4-3/Fyn (10) 6A2T/GagVenus were elucidated in earlier studies (21, 59) (a kind gift from A. Ono). The Vpr protein was tagged with an 11 amino acid peptide tag (HiBiT) using PCR amplification. The sequences for the first and second reverse primers were respectively CGGCTGGCGGCTGTTCAAGAAGATTAGCTAGGTCGACCAGCTGTG and GAAATGGAGCCAGTAGATCCGTGAGCGGCTGGCGGCTGTTCAAGA. The first reverse primer encodes the HiBiT tag and SalI restriction site (SalI). The second reverse primer also encodes the HiBiT tag in addition to HIV-1 Vpr. The PCR product (Vpr-HiBiT) was then inserted into a lentiviral vector (pRDI292) using the restriction enzymes BamHI and SalI (60, 61). The U3 region was inserted into the 5′ UTR of pRDI292 to reconstruct the intact 5′LTR, thus pRDI292/Vpr-HiBiT encodes the LTR-driven Vpr-HiBiT and SV40-driven puromycin-resistance genes. To avoid packaging the pRD292/Vpr-HiBiT genes into the HIV-1 virions, the packaging signal (SL1, SL2, and SL3 regions between 5′LTR and gag) was deleted from the pRDI292/Vpr-HiBiT construct by site-directed mutagenesis. pRDI292 was kindly provided by Dr Yasuo Ariumi (Nagasaki University).

Cells

293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma-Aldrich) supplemented with 10% fetal bovine serum (FBS) (NICHIREI). While Jurkat/Vpr-HiBiT cells (Jurkat; ATCC) were cultured in RPMI1640 medium (Gibco) with 10% FBS and 1 μg/ml puromycin (InvivoGen) (RPMI-10), VeroE6/TMPRSS2 cells (VeroE6 cells stably expressing human TMPRSS2; JCRB Cell Bank, JCRB1819) (62) were maintained in DMEM (low glucose, Wako) containing 10% FBS, G418 (1 mg/ml; Wako), and 1% penicillin/streptomycin (Wako) (DMEM-10).

Generation of Jurkat/Vpr-HiBiT and 293T/Vpr-HiBiT cell lines

pRDI292/Vpr-HiBiT was digested and linearized using the restriction enzyme HpaI. The linearized plasmid was transfected into Jurkat T cells using the AMAXA Nucleofector, with strict adherence to the manufacturer’s instructions. Similarly, following the manufacturer’s instructions, the linearized pRDI292/Vpr-HiBiT was transfected into 293T cells using Lipofectamine 3000 (Thermo Fisher Scientific). As described above, pRDI292/Vpr-HiBiT transduction using a lentiviral vector was unavailable since the packaging signal was removed. The transfected cells were cultured with puromycin for approximately 30 days, and the cells expressing the puromycin-resistance gene permanently were selected.

Measurement of NanoLuciferase luminescence

Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped NL4-3/KFS, whereas the 293T/Vpr-HiBiT cells were transfected with NL4-3/KFS. At 15 h post-incubation, the infected Jurkat/Vpr-HiBiT cells, and the transfected 293T/Vpr-HiBiT cells were similarly treated with the compounds/derivative compounds and incubated for 2 days. After 2 days of incubation, the supernatant from the infected Jurkat/Vpr-HiBiT and transfected 293T/Vpr-HiBiT cells were harvested. The virus and virus-free in supernatant were fractionated by centrifugation at 13,200g for 1 h at 4 °C. Subsequently, luminescence activity was analyzed by the Nano-Glo HiBiT Lytic Detection System (Promega). Based on the manufacturer’s instructions, the cell supernatants were lysed with Nano-Glo HiBiT Lytic Buffer. After adding LgBiT, the substrate was added to the lysed supernatants. The Luciferase activity was then measured using a GloMax Discover System (GM3000).

p24 gag ELISA

The supernatant obtained from the NL4-3-infected Jurkat/Vpr-HiBiT cells and the pNL4-3-transfected 293T/Vpr-HiBiT cells were lysed with a lysis agent in p24 ELISA (ZeptoMetrix). Following the manufacturer’s instructions, the amount of Gag proteins in the supernatant was quantified using an in-house laboratory-manufactured kit described earlier (63) and a p24 ELISA kit (ZeptoMetrix).

p27 gag ELISA

A lysis agent in p27 ELISA (ZeptoMetrix) was employed to lyse the cell supernatant harvested from the SIVmac239-infected Jurkat/Vpr-HiBiT cells (SIVmac239; AIDS Research and Reference Reagent Program). The amount of Gag proteins (p27) in the supernatant was measured (ZeptoMetrix).

Confocal microscopy

Jurkat/Vpr-HiBiT cells were infected with VSV-G-pseudotyped NL4-3/GagVenus. At 15 h post-infection, the compounds were added to the infected cells and incubated for 1 day. Later, the cells were fixed with 4% paraformaldehyde (PFA) (Wako) for 30 min at 4 °C and washed once with phosphate-buffered saline (PBS). Afterward, the cells were mixed with Fluoromount-G (Dako) and plated on the microscope slide (Matsunami). Images of 50 fields were recorded using a Zeiss LSM 700 laser-scanning confocal microscope.

Flow cytometry analysis

VSV-G-pseudotyped NL4-3/GagVenus were harvested from the transfected 293T cells with pNL4-3 GagVenus, the GagPol expression vector pCMVNLGagPolRRE, and the VSV-G expression vector pHCMV-G, as reported previously (64). Jurkat/Vpr-HiBiT cells were infected with the VSV-G-pseudotyped NL4-3/GagVenus. At 15 h post-infection, the infected cells were cultured with the compounds and incubated for 48 h. Approximately, 48 h post-infection, cells were fixed with 4% PFA for 1 h, washed twice with PBS, and then blocked for 1 h with 2% bovine serum albumin (BSA). Later, the blocked cells were washed twice with PBS and then stained with anti-mouse PSGL-1 (KPL1; Santa Cruz Biotechnology) and anti-mouse BST2 antibody (E-4; Santa Cruz Biotechnology) in a ratio of 1:100. After 1 h of incubation at 4 °C, cells were washed three times with PBS and then stained with anti-mouse Alexa Fluor 546 antibody (Invitrogen) in a proportion of antibody: 2% BSA of 1:100. An hour post-infection, stained cells were washed twice and suspended in PBS. The fluorescence signal (YFP) was analyzed using flow cytometry (FACSCalibur, BD Biosciences).

Establishment of BST2 knockout cells

A gRNA oligonucleotide (CGATTCTCACGCTTAAGACC) annealing to exon four of the ORF of the human BST2 gene was designed and cloned into lentiCRISPR v2 (Addgene). Next, the ribonucleoprotein complex, composed of the designed gRNAs and lentiCRISPR v2 was transfected into 293T cells. After 2 days of transfection, cell supernatants were pooled, filtered, and centrifuged at 13,200g for 1 h at 4 °C. Viral pellets were resuspended in RPMI-10, followed by aspiration of the cell supernatant. Jurkat/Vpr-HiBiT cells were then transduced with the harvested virus. In parallel, 2 ml fresh pre-warmed DMEM-10 was added to the transfected 293T cells and incubated for 2 days. Afterward, the BST2-deficient (Jurakt/Vpr-HiBiT/KO-BST2) cells were selected upon treatment with 1 μg/ml puromycin. Then, a day after initial drug treatment, 2 ml fresh pre-warmed RPMI-10 was added to the cells and re-treated with 1 μg/ml puromycin. At 48 h incubation, limiting dilutions were performed to achieve a monoclonal expansion of the BST2-deficient cell population. A preliminary selection of the Jurkat/Vpr-HiBiT/KO-BST2 cell clones by flow cytometry (FACSCalibur, BD Biosciences) assay was undertaken. Conclusively, the sequence information of BST2 ORF exon four in Jurkat/Vpr-HiBiT/KO-BST2 cells was analyzed by the Sanger sequencing technique.

Sequencing analysis of extracted DNA

Genomic DNA was extracted from Jurkat/Vpr-HiBiT/KO-BST2 cells using a QIAGEN kit in compliance with the manufacturer's protocol. The extracted DNA was amplified by Nested PCR using (Forward-CACAAAAGGATAACTTAGCC and Reverse-CCCCGCCCCCCTTCCCCAGC) as an outer primer pair and (Forward-CTTGGATTGGGGCGGTGCGG and Reverse-CACTGACCAGCTTCCTGGGA) as the inner primer pair. Hereinafter, PCR amplicons were purified in conformance with the QIAGEN PCR Purification Kit protocol. The purified PCR products were then ligated into pCR-Blunt II-TOPO vector (Invitrogen) and transformed into E. coli DH-5α competent cells (Takara). Ultimately, the sequence of the resulting recombinant plasmid was ascertained by Sanger sequencing techniques (Applied Biosystems 3130 Genetic Analyser), and the resulting data were decoded by ApE software (v2.0.36) created by M. Wayne Davis.

SARS-CoV-2 D614G-bearing B.1.1 variant preparation

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) D614G-bearing B.1.1 variant (strain TKYT41838, GenBank accession no. LC606020) was propagated as previously described (65, 66). Briefly, VeroE6/TMPRSS2 cells (5 × 106 cells) were seeded in a T-75 flask the day before infection. From then on, the virus was diluted in virus dilution buffer [1 M HEPES, DMEM (low glucose), non-essential amino acid (Gibco), 1% penicillin/streptomycin], and the dilution buffer containing the virus was added to the flask after removing the initial medium. After 1 h of incubation at 37 °C, the supernatant was replaced with 15 ml of 2% FBS/DMEM (low glucose), and further culture at 37 °C was conducted until a visible cytopathic effect (CPE) was observed. Upon CPE observation, the cell culture supernatant was collected, centrifuged at 300g for 10 min, and frozen at −80 °C as a working virus stock. The titer of the prepared working virus was determined as the 50% tissue culture infectious dose (TCID50) (67, 68). The day before infection, VeroE6/TMPRSS2 cells (10,000 cells) were seeded in a 96-well plate and infected with serially diluted working virus stocks. The infected cells were incubated at 37 °C for 4 days and the appearance of CPEs in the infected cells was observed by a microscope. The value of TCID50/ml was calculated by the Reed-Muench method (69).

SARS-CoV-2 B.1.1 infection

The day before infection, 1 × 104 VeroE6/TMPRSS2 cells were plated in 96 well plates. The cells were inoculated with the SARS-CoV-2 B.1.1 variant (100 TCID50) and incubated at 37 °C for 1 h. Thereafter, the supernatant was removed, cells were washed twice with fresh culture medium, and 200 μl of fresh culture medium containing HT-7 (final concentration 50 μM) was added and incubated at 37 °C. Next, 15 μl of cell culture supernatant was harvested at the indicated time points (0, 24, 48, and 72 h, respectively), and the viral RNA copy number was quantified by RT-qPCR.

RT-qPCR

RT-qPCR was performed as previously described (70, 71, 72, 73). Briefly, 5 μl of culture supernatant was mixed with 5 μl of 2 × RNA lysis buffer [2% Triton X-100 (Nacalai Tesque), 50 mM KCl, 100 mM Tris-HCl (pH 7.4), 40% glycerol, 0.8 U/μl recombinant RNase inhibitor (Takara)] and incubated at room temperature for 10 min. Next, 90 μl of RNase-free water was added and then 2.5 μl of diluted sample was used for real-time RT-PCR according to the manufacturer’s protocol with One step TB green PrimeScript PLUS RT-PCR Kit (Takara) and primers for the nucleocapsid (N) gene; Forward N, 5′-AGC CTC TTC TCG TTC CTC ATC-3′ and Reverse N, 5′-CCG CCA TTG CCA GCC ATT C-3′. The viral RNA copy number was standardized using a SARS-CoV-2 direct detection RT-qPCR kit (Takara). Fluorescent signals from resulting PCR products were acquired using a Thermal Cycler Dice Real Time System III (Takara).

Statistical analysis

GraphPad Prism9 was the program used to perform statistical analysis on all of the data collected in this study. Besides one-way ANOVA with Sidak’s multiple comparison tests, comparison between data was also assessed by employing the two-way ANOVA with Tukey’s multiple comparisons. Likewise, unpaired t-tests and Pearson’s correlation coefficient were utilized in this study. The error bars indicate the mean of the standard deviation of repetitive independent experiments.

Data availability

All data can be found in the manuscript.

Supporting information

This article contains supporting information.

Conflict of interest

The authors declare that they have no conflict of interest with the contents of this article.

Supporting information

Supporting Figure S1

Acknowledgments

The authors thank Ono Pharmaceutical Co., Ltd and the Tokyo University Drug Discovery Initiative for providing these compounds. We would like to thank Editage (www.editage.com) for English language editing, and thank Dr E. Freed for providing plasmids. The following reagent was obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH: SIVmac239 infectious Molecular Clone (SIVmac239 M5 SpX), ARP-12247, contributed by Dr Ronald C. Desrosiers. Lentiviral vector pRDI292 was kindly provided by Yasuo Ariumi.

Author contributions

K. M., K. Y., M. O., M. F., Y. S., T. S., T. I., P. N., H. T., Y. T., Y. M., and R. T. writing–review & editing; K. M., P. N., and H. T. writing–original draft; K. M., T. Y., A. T., T. I., MST M. B., and P. N. validation; K. M. supervision, K. M., M. O., M. F., Y. S., T. S., and H. T. project administration; K. M., T. Y., and P. N. methodology; K. M. and H. T. funding acquisition; K. M. and P. N. data curation, K. M., P. N., H. T., and Y. M. conceptualization; K. Y., T. M., A. T., H. T., Y. T., and R. T. resources; T. M., T. Y., M. J. H., A. T., W. A. O. A., Y. T., N. M., H. T., T. I., MST M. B., P. N., and J. A-K. investigation; T. Y., A. T., MST M. B., and P. N. formal analysis.

Funding and additional information

This research was supported by the Platform Project for Supporting Drug Discovery and Life Science Research from 10.13039/100009619 AMED under Grant Number JP20am0101086 (support number 1905 ). This work was supported by 10.13039/100009619 AMED (21fk0410026h0001 , 24fk0410065h0001 ) to K.M., JSPS KAKENHI (19K23802 ) to H.T., 10.13039/100009619 AMED (22fk0410052h0001 ) to Y.S., and Young Investigator Award at Joint Research Center for Human Retrovirus Infection, 10.13039/501100004091 Kumamoto University to K.M.
==== Refs
References

1 Diseases G.B.D. Injuries C. Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019 Lancet 396 2020 1204 1222 33069326
2 Deeks S.G. Lewin S.R. Havlir D.V. The end of AIDS: HIV infection as a chronic disease Lancet 382 2013 1525 1533 24152939
3 Pei X. Xiao J. Wei G. Zhang Y. Lin F. Xiong Z. Oenothein B inhibits human non-small cell lung cancer A549cell proliferation by ROS-mediated PI3K/Akt/NF-kappaB signaling pathway Chem. Biol. Interact 298 2019 112 120 30452899
4 Koh Y. Nakata H. Maeda K. Ogata H. Bilcer G. Devasamudram T. Novel bis-tetrahydrofuranylurethane-containing nonpeptidic protease inhibitor (PI) UIC-94017 (TMC114) with potent activity against multi-PI-resistant human immunodeficiency virus in vitro Antimicrob. Agents Chemother. 47 2003 3123 3129 14506019
5 Lv Z. Chu Y. Wang Y. HIV protease inhibitors: a review of molecular selectivity and toxicity HIV AIDS (Auckl) 7 2015 95 104
6 Burdick R.C. Li C. Munshi M. Rawson J.M.O. Nagashima K. Hu W.S. HIV-1 uncoats in the nucleus near sites of integration Proc. Natl. Acad. Sci. U. S. A. 117 2020 5486 5493 32094182
7 Zentner I. Sierra L.J. Fraser A.K. Maciunas L. Mankowski M.K. Vinnik A. Identification of a small-molecule inhibitor of HIV-1 assembly that targets the phosphatidylinositol (4,5)-bisphosphate binding site of the HIV-1 matrix protein ChemMedChem 8 2013 426 432 23361947
8 Sticht J. Humbert M. Findlow S. Bodem J. Muller B. Dietrich U. A peptide inhibitor of HIV-1 assembly in vitro Nat. Struct. Mol. Biol. 12 2005 671 677 16041387
9 Tavassoli A. Lu Q. Gam J. Pan H. Benkovic S.J. Cohen S.N. Inhibition of HIV budding by a genetically selected cyclic peptide targeting the Gag-TSG101 interaction ACS Chem. Biol. 3 2008 757 764 19053244
10 Lemke C.T. Titolo S. von Schwedler U. Goudreau N. Mercier J.F. Wardrop E. Distinct effects of two HIV-1 capsid assembly inhibitor families that bind the same site within the N-terminal domain of the viral CA protein J. Virol. 86 2012 6643 6655 22496222
11 Strickland M. Ehrlich L.S. Watanabe S. Khan M. Strub M.P. Luan C.H. Tsg101 chaperone function revealed by HIV-1 assembly inhibitors Nat. Commun. 8 2017 1391 29123089
12 Shi J. Zhou J. Shah V.B. Aiken C. Whitby K. Small-molecule inhibition of human immunodeficiency virus type 1 infection by virus capsid destabilization J. Virol. 85 2011 542 549 20962083
13 Bhattacharya A. Alam S.L. Fricke T. Zadrozny K. Sedzicki J. Taylor A.B. Structural basis of HIV-1 capsid recognition by PF74 and CPSF6 Proc. Natl. Acad. Sci. U. S. A. 111 2014 18625 18630 25518861
14 Saito A. Ferhadian D. Sowd G.A. Serrao E. Shi J. Halambage U.D. Roles of capsid-interacting host factors in multimodal inhibition of HIV-1 by PF74 J. Virol. 90 2016 5808 5823 27076642
15 Sun L. Huang T. Dick A. Meuser M.E. Zalloum W.A. Chen C.H. Design, synthesis and structure-activity relationships of 4-phenyl-1H-1,2,3-triazole phenylalanine derivatives as novel HIV-1 capsid inhibitors with promising antiviral activities Eur. J. Med. Chem. 190 2020 112085
16 Adamson C.S. Freed E.O. Human immunodeficiency virus type 1 assembly, release, and maturation Adv. Pharmacol. 55 2007 347 387 17586320
17 Freed E.O. HIV-1 assembly, release and maturation Nat. Rev. Microbiol. 13 2015 484 496 26119571
18 Llewellyn G.N. Grover J.R. Olety B. Ono A. HIV-1 Gag associates with specific uropod-directed microdomains in a manner dependent on its MA highly basic region J. Virol. 87 2013 6441 6454 23536680
19 Guerrero-Valero M. Ferrer-Orta C. Querol-Audi J. Marin-Vicente C. Fita I. Gomez-Fernandez J.C. Structural and mechanistic insights into the association of PKCalpha-C2 domain to PtdIns(4,5)P2 Proc. Natl. Acad. Sci. U. S. A. 106 2009 6603 6607 19346474
20 Tang C. Loeliger E. Luncsford P. Kinde I. Beckett D. Summers M.F. Entropic switch regulates myristate exposure in the HIV-1 matrix protein Proc. Natl. Acad. Sci. U. S. A. 101 2004 517 522 14699046
21 Chukkapalli V. Hogue I.B. Boyko V. Hu W.S. Ono A. Interaction between the human immunodeficiency virus type 1 Gag matrix domain and phosphatidylinositol-(4,5)-bisphosphate is essential for efficient gag membrane binding J. Virol. 82 2008 2405 2417 18094158
22 Monde K. Chukkapalli V. Ono A. Assembly and replication of HIV-1 in T cells with low levels of phosphatidylinositol-(4,5)-bisphosphate J. Virol. 85 2011 3584 3595 21270152
23 Hill C.P. Worthylake D. Bancroft D.P. Christensen A.M. Sundquist W.I. Crystal structures of the trimeric human immunodeficiency virus type 1 matrix protein: implications for membrane association and assembly Proc. Natl. Acad. Sci. U. S. A. 93 1996 3099 3104 8610175
24 Checkley M.A. Luttge B.G. Freed E.O. HIV-1 envelope glycoprotein biosynthesis, trafficking, and incorporation J. Mol. Biol. 410 2011 582 608 21762802
25 Tedbury P.R. Ablan S.D. Freed E.O. Global rescue of defects in HIV-1 envelope glycoprotein incorporation: implications for matrix structure Plos Pathog. 9 2013 e1003739
26 Briggs J.A. Riches J.D. Glass B. Bartonova V. Zanetti G. Krausslich H.G. Structure and assembly of immature HIV Proc. Natl. Acad. Sci. U. S. A. 106 2009 11090 11095 19549863
27 Wright E.R. Schooler J.B. Ding H.J. Kieffer C. Fillmore C. Sundquist W.I. Electron cryotomography of immature HIV-1 virions reveals the structure of the CA and SP1 Gag shells EMBO J. 26 2007 2218 2226 17396149
28 Levin J.G. Guo J. Rouzina I. Musier-Forsyth K. Nucleic acid chaperone activity of HIV-1 nucleocapsid protein: critical role in reverse transcription and molecular mechanism Prog. Nucleic Acid Res. Mol. Biol. 80 2005 217 286 16164976
29 Morita E. Sandrin V. McCullough J. Katsuyama A. Baci Hamilton I. Sundquist W.I. ESCRT-III protein requirements for HIV-1 budding Cell Host Microbe 9 2011 235 242 21396898
30 Paxton W. Connor R.I. Landau N.R. Incorporation of Vpr into human immunodeficiency virus type 1 virions: requirement for the p6 region of gag and mutational analysis J. Virol. 67 1993 7229 7237 8230445
31 Heaton S.M. Harnessing host-virus evolution in antiviral therapy and immunotherapy Clin. Transl Immunol. 8 2019 e1067
32 Badia R. Garcia-Vidal E. Ballana E. Viral-host dependency factors as therapeutic targets to overcome antiviral drug-resistance: a focus on innate immune modulation Front. Virology 2 2022 10.3389/fviro.2022.935933
33 Van Damme N. Goff D. Katsura C. Jorgenson R.L. Mitchell R. Johnson M.C. The interferon-induced protein BST-2 restricts HIV-1 release and is downregulated from the cell surface by the viral Vpu protein Cell Host Microbe 3 2008 245 252 18342597
34 Evans D.T. Serra-Moreno R. Singh R.K. Guatelli J.C. BST-2/tetherin: a new component of the innate immune response to enveloped viruses Trends Microbiol. 18 2010 388 396 20688520
35 Neil S.J. Zang T. Bieniasz P.D. Tetherin inhibits retrovirus release and is antagonized by HIV-1 Vpu Nature 451 2008 425 430 18200009
36 Hinz A. Miguet N. Natrajan G. Usami Y. Yamanaka H. Renesto P. Structural basis of HIV-1 tethering to membranes by the BST-2/tetherin ectodomain Cell Host Microbe 7 2010 314 323 20399176
37 Simon V. Bloch N. Landau N.R. Intrinsic host restrictions to HIV-1 and mechanisms of viral escape Nat. Immunol. 16 2015 546 553 25988886
38 Dubé M. Bego M.G. Paquay C. Cohen É.A. Modulation of HIV-1-host interaction: role of the Vpu accessory protein Retrovirology 7 2010 114 21176220
39 Popov S. Rexach M. Ratner L. Blobel G. Bukrinsky M. Viral protein R regulates docking of the HIV-1 preintegration complex to the nuclear pore complex J. Biol. Chem. 273 1998 13347 13352 9582382
40 Douglas J.L. Viswanathan K. McCarroll M.N. Gustin J.K. Früh K. Moses A.V. Vpu directs the degradation of the human immunodeficiency virus restriction factor BST-2/Tetherin via a {beta}TrCP-dependent mechanism J. Virol. 83 2009 7931 7947 19515779
41 Boursier M.E. Levin S. Zimmerman K. Machleidt T. Hurst R. Butler B.L. The luminescent HiBiT peptide enables selective quantitation of G protein-coupled receptor ligand engagement and internalization in living cells J. Biol. Chem. 295 2020 5124 5135 32107310
42 Ozono S. Zhang Y. Tobiume M. Kishigami S. Tokunaga K. Super-rapid quantitation of the production of HIV-1 harboring a luminescent peptide tag J. Biol. Chem. 295 2020 13023 13030 32719008
43 Young S.D. Britcher S.F. Tran L.O. Payne L.S. Lumma W.C. Lyle T.A. L-743, 726 (DMP-266): a novel, highly potent nonnucleoside inhibitor of the human immunodeficiency virus type 1 reverse transcriptase Antimicrob. Agents Chemother. 39 1995 2602 2605 8592986
44 Merluzzi V.J. Hargrave K.D. Labadia M. Grozinger K. Skoog M. Wu J.C. Inhibition of HIV-1 replication by a nonnucleoside reverse transcriptase inhibitor Science 250 1990 1411 1413 1701568
45 Tateishi H. Monde K. Anraku K. Koga R. Hayashi Y. Ciftci H.I. A clue to unprecedented strategy to HIV eradication: "Lock-in and apoptosis" Sci. Rep. 7 2017 8957 28827668
46 Grover J.R. Veatch S.L. Ono A. Basic motifs target PSGL-1, CD43, and CD44 to plasma membrane sites where HIV-1 assembles J. Virol. 89 2015 454 467 25320329
47 Iwabu Y. Fujita H. Kinomoto M. Kaneko K. Ishizaka Y. Tanaka Y. HIV-1 accessory protein Vpu internalizes cell-surface BST-2/tetherin through transmembrane interactions leading to lysosomes J. Biol. Chem. 284 2009 35060 35072 19837671
48 Martin-Sancho L. Lewinski M.K. Pache L. Stoneham C.A. Yin X. Becker M.E. Functional landscape of SARS-CoV-2 cellular restriction Mol. Cell 81 2021 2656 2668.e2658 33930332
49 Stewart H. Palmulli R. Johansen K.H. McGovern N. Shehata O.M. Carnell G.W. Tetherin antagonism by SARS-CoV-2 ORF3a and spike protein enhances virus release EMBO Rep. 24 2023 e57224 37818801
50 Liu Y.L. Guo Z.Y. The NanoBiT-based homogenous ligand-receptor binding assay methods Mol. Biol. 2525 2022 139 153
51 Yamamoto M. Du Q. Song J. Wang H. Watanabe A. Tanaka Y. Cell-cell and virus-cell fusion assay-based analyses of alanine insertion mutants in the distal alpha9 portion of the JRFL gp41 subunit from HIV-1 J. Biol. Chem. 294 2019 5677 5687 30737278
52 Briggs J.A. Simon M.N. Gross I. Krausslich H.G. Fuller S.D. Vogt V.M. The stoichiometry of Gag protein in HIV-1 Nat. Struct. Mol. Biol. 11 2004 672 675 15208690
53 Carlson L.A. Briggs J.A. Glass B. Riches J.D. Simon M.N. Johnson M.C. Three-dimensional analysis of budding sites and released virus suggests a revised model for HIV-1 morphogenesis Cell Host Microbe 4 2008 592 599 19064259
54 Edgar J.R. Manna P.T. Nishimura S. Banting G. Robinson M.S. Tetherin is an exosomal tether Elife 5 2016 e17180
55 Tiwari R. de la Torre J.C. McGavern D.B. Nayak D. Beyond tethering the viral particles: immunomodulatory functions of tetherin (BST-2) DNA Cell Biol. 38 2019 1170 1177 31502877
56 Soria F.N. Pampliega O. Bourdenx M. Meissner W.G. Bezard E. Dehay B. Exosomes, an unmasked culprit in neurodegenerative diseases Front. Neurosci. 11 2017 26 28197068
57 Tai Y.L. Chen K.C. Hsieh J.T. Shen T.L. Exosomes in cancer development and clinical applications Cancer Sci. 109 2018 2364 2374 29908100
58 Freed E.O. Englund G. Martin M.A. Role of the basic domain of human immunodeficiency virus type 1 matrix in macrophage infection J. Virol. 69 1995 3949 3954 7745752
59 Miyakawa K. Nishi M. Matsunaga S. Okayama A. Anraku M. Kudoh A. The tumour suppressor APC promotes HIV-1 assembly via interaction with Gag precursor protein Nat. Commun. 8 2017 14259
60 Bridge A.J. Pebernard S. Ducraux A. Nicoulaz A.L. Iggo R. Induction of an interferon response by RNAi vectors in mammalian cells Nat. Genet. 34 2003 263 264 12796781
61 Ariumi Y. Kuroki M. Maki M. Ikeda M. Dansako H. Wakita T. The ESCRT system is required for hepatitis C virus production PLoS One 6 2011 e14517
62 Matsuyama S. Nao N. Shirato K. Kawase M. Saito S. Takayama I. Enhanced isolation of SARS-CoV-2 by TMPRSS2-expressing cells Proc. Natl. Acad. Sci. U. S. A. 117 2020 7001 7003 32165541
63 Tanaka R. Takahashi Y. Kodama A. Saito M. Ansari A.A. Tanaka Y. Suppression of CCR5-Tropic HIV Type 1 Infection by OX40 Stimulation via Enhanced Production of B-Chemokines AIDS Res. Hum. Retroviruses 26 2010 1147 1154 20854204
64 Garbitt R.A. Albert J.A. Kessler M.D. Parent L.J. trans-acting inhibition of genomic RNA dimerization by Rous sarcoma virus matrix mutants J. Virol. 75 2001 260 268 11119596
65 Kimura I. Yamasoba D. Tamura T. Nao N. Suzuki T. Oda Y. Virological characteristics of the SARS-CoV-2 Omicron BA.2 subvariants, including BA.4 and BA.5 Cell 185 2022 3992 4007.e39 36198317
66 Islam M.S. Fukuda M. Hossain M.J. Rabin N.N. Tagawa R. Nagashima M. SARS-CoV-2 suppression depending on the pH of graphene oxide nanosheets Nanoscale Adv. 5 2023 2413 2417 37143819
67 Ito J. Suzuki R. Uriu K. Itakura Y. Zahradnik J. Kimura K.T. Convergent evolution of SARS-CoV-2 Omicron subvariants leading to the emergence of BQ.1.1 variant Nat. Commun. 14 2023 2671 37169744
68 Tamura T. Ito J. Uriu K. Zahradnik J. Kida I. Anraku Y. Virological characteristics of the SARS-CoV-2 XBB variant derived from recombination of two Omicron subvariants Nat. Commun. 14 2023 2800 37193706
69 REED L.J. MUENCH H. A simple method of estimating fifty per cent endpoints Am. J. Epidemiol. 27 1938 493 497
70 Motozono C. Toyoda M. Zahradnik J. Saito A. Nasser H. Tan T.S. SARS-CoV-2 spike L452R variant evades cellular immunity and increases infectivity Cell Host Microbe 29 2021 1124 1136.e1111 34171266
71 Saito A. Irie T. Suzuki R. Maemura T. Nasser H. Uriu K. Enhanced fusogenicity and pathogenicity of SARS-CoV-2 Delta P681R mutation Nature 602 2022 300 306 34823256
72 Yamasoba D. Kimura I. Nasser H. Morioka Y. Nao N. Ito J. Virological characteristics of the SARS-CoV-2 omicron BA.2 spike Cell 185 2022 2103 2115.e21 35568035
73 Begum M.M. Ichihara K. Takahashi O. Nasser H. Jonathan M. Tokunaga K. Virological characteristics correlating with SARS-CoV-2 spike protein fusogenicity Front. Virology 4 2024 10.3389/fviro.2024.1353661
