
==== Front
Cartilage
Cartilage
CAR
spcar
Cartilage
1947-6035
1947-6043
SAGE Publications Sage CA: Los Angeles, CA

37491820
10.1177/19476035231181446
10.1177_19476035231181446
Basic Cartilage Research
Cartilage Apotosis
PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways
Lu Jinfeng 1*
Yu Miao 1*
https://orcid.org/0000-0001-7397-1367
Li Jia 1*
1 Department of Pathology, The First Affiliated Hospital of Guangxi Medical University, Nanning, China
Jia Li, Department of Pathology, The First Affiliated Hospital of Guangxi Medical University, Nanning 530021, China. Email: jialee2005@126.com
* These authors contributed equally to this work.

25 7 2023
9 2024
15 3 315327
26 11 2022
17 3 2023
26 5 2023
© The Author(s) 2023
2023
SAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons Licenses
https://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page (https://us.sagepub.com/en-us/nam/open-access-at-sage).
Objective

Protein kinase C-delta (PKC-δ) is involved in apoptosis. This study aimed to establish whether PKC-δ can further promote IL-1β-induced chondrocyte apoptosis by mediating the phosphorylation of the JNK and p38 mitogen-activated protein kinase (MAPK) signaling pathways In osteoarthritis (OA).

Methods

We employed chondrocyte staining to determine the extent of cartilage degeneration. PKC-δ and p38 signal expressions were used in the immunohistochemical (IHC) test and apoptosis was assayed at the TUNEL test in human osteoarthritic and controls. We stimulated rat cartilage cells using IL-1β (10 ng/ml)/rottlerin (10 μM) or lentivirus. To determine the apoptosis rate, we employed flow cytometry. The mRNA of both BCL2-related X (BAX) and cysteine aspartate protease 3 (caspase-3) could be measured via qRT-PCR. Western blot measured the protein levels of BAX, caspase-3, PKC-δ, p-JNK/JNK and p-p38/p38.

Results

The positive rate of PKC-δ and the apoptotic rate of chondrocytes in OA were higher than controls. The manifestation of PKC-δ was positively related to the degree of cartilage degeneration, p38 protein expression, and apoptosis rate. IL-1β exposure upregulated PKC-δ expression in chondrocytes in a dose-dependent manner. Decreasing PKC-δ expression and its phosphorylation in OA can inhibit MAPK signaling pathway activation (phosphorylation) by downregulating JNK and p38 protein phosphorylation and expression. This inhibition decreases caspase-3 and BAX levels, consequently lowering the apoptosis rate in chondrocytes.

Conclusion

PKC-δ activation by IL-1β in OA promotes chondrocyte apoptosis via activation of the JNK and p38 MAPK signal pathways, thereby promoting the OA progression.

PKC-δ
osteoarthritis
chondrocytes
apoptosis
JNK
p38 MAPK
National Natural Science Foundation of China https://doi.org/10.13039/501100001809 81760402 typesetterts1
==== Body
pmcIntroduction

In orthopedic clinics, osteoarthritis (OA) is as a frequent chronic refractory joint injury. The function and life quality of OA patients are seriously threatened due to the high rate of handicap. 1 Articular cartilage damage and degeneration are the main features of OA. The resident cells of joint cartilage consist only of chondrocytes. Chondrocyte apoptosis is an effective pathological change in OA. As OA is intimately linked to chondrocyte apoptosis, this process is expected to be a novel target for OA manipulation and alleviating cartilage damage and degeneration. 2 In response to a variety of stimuli, chondrocytes undergo phenotypic changes and express a series of factors, from which a vicious cycle begins to destroy cartilage and trigger an inflammatory process. 3 In addition, pro-inflammatory factors (PIC) are essential mediators in the inflammatory response; interleukins (IL), the tumor necrosis factor (TNF), as well as matrix metalloproteinases (MMP) also lead to the occurrence and development of OA.4,5 To date, however, the specific mechanisms of OA pathogenesis are not fully understood, and OA treatment is still slow and ineffective. As a result, it is critical to continue researching new treatment targets of OA to further explore more effectual healing strategies.

Protein kinase C (PKC) refers to a family of protein kinases that depend on phospholipids and calcium ions. PKC plays a role in a wide range of biological actions including cell growth, cell differentiation, programmed cell death, autophagy, and the metabolism of multiple cells, including chondrocytes, via its own signaling pathway or in conjunction with other signaling pathways.6,7 It can also modulate the synthesis and degradation of cartilage extracellular matrix and the metabolic loop of inorganic pyrophosphate in cartilage, being one of the key signal transduction molecules affecting cartilage growth, development, and degeneration.8,9 PKC-β1, PKC-α, and PKC-ζ are the PKC isoforms closely related to cartilage, along with PKC-δ. PKC-δ and PKC-ζ were found to be expressed in articular cartilage tissue of OA patients in tissue microarray data. 10 PKC-δ, one of the elements of the novel PKC network, can activate and regulate cell signal transduction pathways through specific phosphorylation sites, thereby achieving a variety of biological effects.11,12 IL-1, a classical pro-inflammatory factor, also participates in the enablement of PKC-δ, and the expression levels of PKC-δ have a dose-dependent effect on IL-1. 13 These findings suggest a correlation between the severity of inflammatory response and the expression and activation of PKC-δ in OA. Activated PKC-δ acts as an essential mediator of the apoptosis signal, mediating apoptosis through the pathways of mitogen-activated protein kinase (MAPK), NF-κB, p53, and ROS-activated transcription factor and the mitochondrial and nuclear translocation of PKC-δ. The expression and activation of PKC-δ and its relationship with apoptosis are more widely studied in tumors, such as prostate cancer, 12 non-small cell carcinoma, 14 chondrosarcoma, 15 and adult T-cell leukemia. 16 OA research remains minimal locally and internationally. Currently, the signal transduction pathways of chondrocyte apoptosis are multiple and sophisticated, among which the MAPK pathway is the main upstream signal transduction pathway causing chondrocyte apoptosis. 17 The MAPK pathway involves the MAP kinase (MPK), MAPK kinase (MEK, MKK or MAPK kinase), and MEK kinase (MEKK, MKKKK or MAPK kinase). Upon stimulation by growth factors, inflammation, hormones, as well as endogenous stress and environmental signals, MAPKs receive activation signals from MKKs and MKKKs, are activated in response, and manifest as cascading phosphorylation. 18 MAPKs are traditionally classified into 2 major categories: mitogenic and stress-activated MAPKs. The classical representatives of mitogenic responses are ERK MAPKs which have notable effects in tumor multiplication, transfer, and aggression; tumor extracellular matrix degradation; and tumor angiogenesis. In addition, JNK and p38 MAPKs are response elements to stressful stimuli, and the JNK & p38 MAPK signal pathways play vital roles in responses to stress, such as inflammation and apoptosis.19-21 The c-Jun amino-terminal kinases (JNK) consist of JNK1, JNK2, and JNK3. In neoplasms, JNK is affected by chemoresistance to positively regulate autophagy to counteract apoptosis; in joint diseases, however, JNK and its downstream cascades function in chondrocyte apoptosis by facilitating inflammation, with JNK as a pro-apoptotic signal under endoplasmic reticulum stress conditions.22-24 p38-α, p38-β, p38-γ, and p38-δ are the 4 isomers of p38 MAPK. The p38 MAPK pathway is not only a classical inflammatory pathway but is also one of the upstream pathways by which activated cysteine aspartate proteases (caspases) induce cell apoptosis. p38 affects the stability of BCL2 members by phosphorylation cascades and targeting related factor pathways at the transcriptional level, resulting in its pro- or anti-apoptotic function.25,26 BAX, a pro-apoptotic gene, is ubiquitous in the cytoplasm. With enhanced expression of BAX and activation of the mitochondrial pathway, cytochrome c is liberated and initiates apoptosis of chondrocytes in OA in a caspase-3/-7-dependent manner. BAX inhibition abrogates chondrocyte apoptosis due to lysosomal dysfunction, and OA chondrocyte apoptosis exhibits a robust correlation with BAX.27,28 Activated caspases are one of the molecular hallmarks of apoptosis. 29 Caspase-3 was overexpressed in cartilage from patients with OA during immunohistochemistry and TUNEL assays, demonstrating that caspase-3 is associated with the progression of OA. 30 Caspase-3 may cleave dead substrates and lead to apoptosis resulting in the destruction of chondrocytes, ultimately contributing to the progression of OA. 31 Both in chondrocytes from human OA patients and in IL-1β-induced OA in rat articular chondrocytes, the pro-apoptotic effect was found to be related to increased BAX protein levels and caspase-3 activation, suggesting that Bax and caspase-3 inhibition may be an approach to delaying articular cartilage degeneration.32,33 JNK and p38 MAPK signaling pathways regulate cellular processes comprising cell differentiation, proliferation, survival, apoptosis, and inflammation. 34 The JNK and p38 MAPK signal pathways have a dual function during apoptosis and act as activators or inhibitors according to the cell type, stimulus, environment, tissue, and organism involve.17,35 The specific roles of their pro- or anti-apoptotic mechanisms are complex, and more investigations are needed to resolve those conflicts. In OA, phosphorylation of the JNK and p38 MAPK signaling pathways and their downstream transcriptional progenitor sets activate and function in chondrocyte apoptosis, providing clues to the substrates that act upon PKC-δ expression and activation in OA. 36

In this study, the expression and apoptosis of PKC-δ and p38 proteins of the MAPK signaling pathway in human osteoarthritic cartilage tissues and normal articular cartilage tissues were investigated. We used the lentiviral knockdown of PKC-δ and PKC-δ inhibitor rottlerin to assess their effects on chondrocyte apoptosis. We discovered that IL-1β activation of PKC-δ in OA can promote chondrocyte apoptosis through the JNK and p38 MAPK signaling pathways and thus promote OA progression, a finding that offers a fresh idea and theory foundation for the clinical treatment of OA.

Materials and Methods

Antibodies and Reagents

Peprotech (Rocky Hill, NJ, USA) supplied us with recombinant rat IL-1β. PKC-δ inhibitor rottlerin was obtained from MedChemExpress (Monmouth Junction, NJ). Abcam (Cambridge, MA, USA) offers PKC-δ (ab182126), JNK (ab124956), and p38 (ab32142) antibodies. The Cell Signaling Technology (Beverly, MA, USA) provided antibodies against p-PKC-δ (2055S) and p-p38 (4511S). Proteintech (ProteinTech Group, Chicago, IL, USA) provided antibodies against p-JNK (80024-1-RR), BAX(50599-2-Ig), caspase-3(66470-2-IG), and GAPDH (10494-1-AP).

Collection and Assessment of Human Articular Cartilage Samples

All donors have provided verbal informed consent for the use of cartilage samples of human origin. The Ethics Committee of the First Affiliated Hospital of Guangxi Medical University has endorsed the study (2016-KY-114). Cartilage tissue from 30 OA cases (7 mild, 9 moderate, and 14 severe) and 11 normal articular cartilages were collected and stained hematoxylin–eosin (H&E), Saffron-O/fast green, and Masson cartilage stain (Solarbio, Beijing, China). Then, the degree of cartilage degeneration was quantified using a modified Mankin score. The expression of the key genes of the PKC-δ and MAPK signaling pathways and chondrocyte apoptosis in human osteoarthritic cartilage and normal articular cartilage were assessed by immunohistochemistry and TUNEL assay.

Rat Primary Chondrocyte Culture

Four 3- to 7-day-old SD rats were killed by cervical dislocation. After death, the rats were immersed in 75% alcohol for 5 minutes, and then their articular cartilages were dissected under aseptic conditions. The articular cartilages were collected and minced by microscopy, digested with trypsin-EDTA digest (0.25%) (Solarbio, Beijing, China) at 37°C, and then instilled with collagenase type II at a concentration of 0.2% for 4–6 hours. The digested cartilage was resuspended and inoculated with Dulbecco’s Minimum Essential Medium (which contains 10% fetal bovine serum and 1% penicillin mix) in Petri dishes. The cells were allowed to grow in a humid environment at 37°C with 5% CO2. Thereafter, the substrate was replaced every 2 to 3 days. The cells were observed to increase to around 80% density when digested using a 0.25% trypsin-EDTA digest, then were passaged in culture at a particular density. The morphology of P0 to P2 cells did not change significantly. Therefore, second-generation chondrocytes were used in all in vitro experiments.

Chondrocyte Intervention

To investigate the expression levels of PKC-δ signaling, the chondrocytes were subjected to IL-1β (0, 2.5, 5, 10, and 20 ng/ml) for 48 hours at differing concentrations, and the optimal action concentration was selected. In an in vitro functional study of PKC-δ, chondrocytes were pretreated with IL-1β (10 ng/ml) for 48 hours to simulate an inflammatory environment and then infected with lentiviral LV-shRNA-NC and LV-shRNA-PKC-δ for 24 hours; by contrast, chondrocytes were treated with rottlerin (10 μM), an inhibitor of PKC-δ, for 24 hours.

Lentiviral Transfection

GeneChem (Shanghai, China) supplied us with the lentiviral LV-shRNA-PKC-δ and LV-shRNA-NC. The lentiviral transfection of chondrocytes was added at a cell confluence with 30%–50%. After 24 hours, the medium was changed when the survival rate was > 95%. The cells were observed to be > 90% transfected under fluorescence microscopy after 3 days. The cells were passaged and cultured for subsequent experiments, and the effect of transfection was measured by qRT-PCR and Western blot.

Immunohistochemistry (IHC), TUNEL Test, and Histological Staining

Cartilage tissue specimens were immobilized in 4% paraformaldehyde for over 48 hours, followed by decalcification via 10% ethylenediaminetetraacetic acid in paraffin wax for 4 to 6 weeks. Individual tissue samples were sliced into 4 μm sections and then individually stained with H&E, Saffron-O/fast green, and Masson cartilage cell staining solution. The extent of cartilage degeneration was quantified by 2 observers using a modified Mankin score. After paraffin sections had been dewaxed, EDTA high pressure antigen repair, 3% hydrogen peroxide incubated at 37 °C for 10 min to eliminate endogenous peroxidase activity, followed by soaking overnight at 4°C with primary antibody (PKC-δ diluted 1:200, p38 diluted 1:200). Primary antibody substituted with PBS as a negative control. The following day, incubation was performed by immersion with secondary antibodies and concluded with DAB staining and hematoxylin staining. The sections were dehydrated, fixed with neutral adhesive, visualized, and recorded under a microscope. All image results were interpreted according to staining intensity and percentage of positivity. TUNEL Apoptosis Detection Reagent Box (Roche) was used to detect the apoptosis level of bone tissue.

Western Blot Assessment

Total chondrocyte protein was isolated by mixing high efficiency RIPA lysate (tissue/cell) (Solarbio, Beijing, China), PMSF (Solarbio, Beijing, China), phosphatase inhibitor (ComWin Biotech Co., Ltd. Beijing, China), and protease inhibitor (MedChemExpress, Monmouth Junction, NJ) to form a protein lysis buffer. The protein lysis buffer was added to the cells and then placed on ice for at least 30 minutes before centrifuged for 30 minutes at 4°C and 12,000×g. Protein density was determined with the Omnieasy™ Instant BCA Protein Assay Kit (Shanghai, China). The proteins were separated by electrophoresis, transferred, encapsulated in nitrocellulose filter membranes (Merck KGaA, Darmstadt, Germany), and closed with protein-free fast blocking buffer (Shanghai, China) for 30 minutes. The membranes were soaked and hatched in primary antibody overnight at 4°C. The next day, the membranes were incubated with secondary antibodies under room temperature for 1 hour. Washings were performed thrice at 10 minutes each using Tris-Buffered Saline with Tween 20. The proteins were visualized using chemiluminescence reagents (Invitrogen, Carlsbad, CA, USA) and the Wes system from ProteinSimple. The gray scale values of the immunoblots were measured for quantitative analysis with the Image 3.0 software (BioRad).

Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)

RNA was obtained in rat chondrocytes with the RNAeasy™ Animal RNA Isolation Kit (Beyotime Biotechnology, Shanghai, China). Reversal transcription of 1,000 ng RNA was achieved with the PrimeScript™ RT Master Mix (Takara, Beijing, China). Then, qRT-PCR assay was undertaken with cDNA as a template. The Biosystems™ Power SYBR™ Green (ABI, Los Angeles, CA, USA) probe was used, together with a specific primer sequence synthesized by Biotech Engineering Services (Shanghai, China). For the endogenous control, GAPDH was selected to normalize the PKC-δ exposure, and the comparative exposure of PKC-δ was computed by the 2−ΔΔ Ct method. The primer pair of the target gene is shown in Table 1 .

Table 1. Primer Sequences Used in This Study.

Gene name	Forward primer (5'to 3')	Reverse primer (5' to 3')	
GAPDH	AGTGCCAGCCTCGTCTCATA	GGTAACCAGGCGTCCGATAC	
PKC-δ	AACCAGGAGGAGGGCGAGTATTAC	TGGAGAAGGAATGGGAGAGGAAGAG	
BAX	AGACACCTGAGCTGACCTTGGAG	TTCATCGCCAATTCGCCTGAGAC	
CASP-3	GCGGTATTGAGACAGACAGTGGAAC	AACCATGACCCGTCCCTTGAATTTC	

Flow Cytometry

Cell apoptosis was assessed with the Annexin V-APC/7-AAD apoptosis reagent box (Kogan Biotechnology, Jiangsu, China). Initially, 2 x 106 cells were placed in centrifugal tubes and washed with pre-cooled PBS as specified. The cells were then resuspended by adding 500 μl of 1 x binding buffer. Following 30 minutes incubation on cold ice, 5 μl/tube of annexin V-APC and 10 μl/tube of 7-AAD were added to the suspended cells for approximately 5 minutes under light-proof conditions. The last flow cytometry (Becton, New Jersey, USA) was performed, and the results were assessed via FlowJo_V10.

Analysis of Statistics

All analyses were completed using SPSS software program 25.0 (IBM, Armonk, NY, US). The data were presented as mean ± standard deviation, with independent samples t test for 2 group comparisons and 1-way ANOVA for multigroup comparisons. The expressions of PKC-δ and P38 proteins in OA tissue and normal cartilage tissue were analyzed with the chi-square test or the Fisher precise probability method. Spearman’s rank correlation analysis was applied to evaluate the relationship between the (1) PKC-δ protein expression levels and the degree of OA cartilage degeneration and (2) p38 protein expression levels and correlation with TUNEL staining scores. Data were regarded as statistically significant if P < 0.05.

Results

PKC-δ and P38 Proteins are Hyper-Expressed in Human Osteoarthritic Cartilage Tissue

Articular cartilage specimens from normal and OA patients were taken for histological analysis. Immunohistochemical analysis revealed significantly higher positive rates for PKC-δ and p38 proteins in the MAPK pathway in human osteoarthritic cartilage than in normal articular cartilage ( Fig. 1A-C ) (Suppl. Tables S1 and S2). The TUNEL test conducted on articular cartilage specimens from both normal and osteoarthritic patients revealed apoptotic cartilage tissue rates of 11.9443% ± 7.35562% and 2.8364% ± 1.06703% in the OA and normal groups, respectively. The apoptosis rate of human osteoarthritic chondrocytes was obviously higher than that of the normal group ( Fig. 1D and E ).

Figure 1. Staining evaluations of PKC-δ and P38 in human OA cartilage and normal articular cartilage and staining of chondrocyte apoptosis. (A) IHC staining of PKC-δ and P38 (scale bar, 200 μm). (B and C) Quantitative analysis of immune-positive cells. (D) TUNEL staining of the cartilage in each group (scale bar, 100 μm). (E) Quantitative analysis of TUNEL-positive cells. (F) OA and normal cartilage tissue were stained using H&E, Saffron-O/fast green, and Masson (scale bar, 500 μm). Values are presented as mean ± standard deviation (n>3). OA = osteoarthritis; IHC = immunohistochemical; PKC-δ = protein kinase C-delta; TUNEL = terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labelling; H&E = hematoxylin–eosin. Statistically significant differences are indicated by ****P < 0.0001.

Saffron-O/fast green, H&E, and Masson dyeing showed degeneration of articular cartilage in OA ( Fig. 1F ). Spearmen correlation analysis confirmed that PKC-δ expression was positively correlated with the degree of OA cartilage degeneration, P38 protein expression, and chondrocyte apoptosis rate (Suppl. Tables S3–S5). These outcomes revealed that PKC-δ expression was raised in OA and may contribute to OA progression by promoting apoptosis via activation of the MAPK signaling pathway.

Effects of IL-1β and PKC-δ Inhibitor Rottlerin on Chondrocytes

The CCK8 detection indicated that different concentrations of IL-1β (0, 0.625, 1.25, 2.5, 5, 10, 20, 40, 80, and 160 ng/ml) were not cytotoxic to SD rat chondrocytes ( Fig. 2A ). The PKC-δ inhibitor rottlerin was also used to intervene in chondrocytes to test the cytotoxicity of rottlerin at different concentrations (0, 0.625, 1.25, 2.5, 5, 10, 20, 40, 80, 160 μM). No cytotoxicity occurred in chondrocytes at rottlerin concentrations below 10 μM ( Fig. 2B ). Consequently, 10 μM rottlerin was used to intervene with chondrocytes for subsequent experiments.

Figure 2. PKC-δ and p-PKC-δ expressions are increased in IL-1β-triggered chondrocytes. (A) The cytotoxicity of IL-1β (0, 0.625, 1.25, 2.5, 5, 10, 20, 40, 80, and 160 ng/ml) to chondrocytes was determined by CCK8 assay. (B) CCK8 assay was applied to detect the cytotoxicity of rottlerin (0, 0.625, 1.25, 2.5, 5, 10, 20, 40, 80, and 160 μM) on chondrocytes. (C) qRT-PCR was employed to detect PKC-δ mRNA expression in chondrocytes with different IL-1β concentrations (0, 2.5, 5, 10, and 20 ng/ml). (D-F) PKC-δ and p-PKC-δ protein expressions in chondrocytes treated with different IL-1-β concentrations (0, 2.5, 5, 10, and 20 ng/ml) were detected by Western blot and quantified by ImageJ. Values are presented as mean ± standard deviation (n = 3). PKC-δ = protein kinase C-delta; qRT-PCR = quantitative real-time reverse transcription polymerase chain reaction; GAPDH = glyceraldehyde-3-phosphate dehydrogenase, GAPDH was used as a reference protein for loading to correct for uneven loading and transfer in Western blot. Statistically significant differences are indicated by *P < 0.05, **P < 0.01, ****P < 0.0001.

Effect of IL-1β-Induced Inflammatory Response on PKC-δ

qRT-PCR assessment showed that IL-1β exposure upregulated PKC-δ expression in chondrocytes in a dose-dependent pattern ( Fig. 2C ). Western blot analysis confirmed the increased protein exposure of PKC-δ and p-PKC -δ at gradient concentrations of IL-1β (0, 2.5, 5, 10, 20 ng/ml) and a dose-dependent correlation with IL-1β ( Fig. 2D-F ). The above results implied that (1) IL-1β induced the chondrocyte PKC-δ signal expression and activation and (2) the phosphorylation of PKC-δ signal can be significantly affected by IL-1β at the concentration of 10 ng/ml. We therefore used 10 ng/ml IL-1β to construct an in vitro OA model using chondrocytes to further explore the effect mechanism of PKC-δ on chondrocytes in OA.

Involvement of PKC-δ in Chondrocyte Apoptosis in OA

To probe the influence of PKC-δ on apoptosis in OA chondrocytes, we used lentivirus (LV-shRNA-PKC-δ) to silence PKC-δ in chondrocytes and subsequently observed green fluorescence expression in more than 90% of the cells under inverted fluorescence microscopy ( Fig. 3A ). Chondrocytes from SD rats were preconditioned by being exposed to IL-1β (10 ng/ mL) to mimic the OA situation and subsequently divided into the blank, LV-shRNA-NC, LV-shRNA-PKC-δ, and PKC-δ inhibitor rottlerin groups. Flow cytometry measurements were applied to assay apoptosis in all groups. The apoptosis rates in the LV-shRNA-PKC-δ, rottlerin, and blank groups were clearly below those in the LV-shRNA-NC counterpart ( Fig. 3B and C ). The impact of PKC-δ on the exposure of the genes associated with apoptosis (BCL2-related X [BAX] and caspase-3) was examined via qRT-PCR and Western Blot. The caspase-3 and BAX expression in the blank, LV-shRNA-PKC-δ, and rottlerin groups were significantly below those in the LV-shRNA-NC group ( Fig. 3D-F ). IL-1β markedly deteriorated the activation of BAX and caspase-3 in chondrocytes. Moreover, the inhibition of PKC-δ expression and phosphorylation reduced the expression of pro-apoptosis-related genes in chondrocytes in response to the inflammatory effects of IL-1β. These results implied that (1) activation of PKC-δ by IL-1β could promote chondrocyte cell apoptosis and (2) either knockdown of PKC-δ expression using lentivirus or inhibition of PKC-δ phosphorylation by rottlerin protected IL-1β-exposed chondrocytes from apoptosis.

Figure 3. Apoptosis of chondrocytes in different groups of SD rats. (A) Fluorescence microscopy was used to observe the fluorescence expression after lentivirus transfection. (B and C) The results of flow cytometry analysis. (D and E) qRT-PCR was used to detect caspase-3 and BAX mRNA in the chondrocytes of SD rats. (F) Expression of caspase-3 and BAX proteins in different groups of SD rat chondrocytes, with ImageJ used for quantification. Values are presented as mean ± standard deviation (n = 3). qRT-PCR = quantitative real-time reverse transcription polymerase chain reaction; PKC-δ = protein kinase C-delta; BAX = BCL2-related X; LV = lentivirus; SD = Sprague Dawley; GAPDH = glyceraldehyde-3-phosphate dehydrogenase, GAPDH was used as a reference protein for loading to correct for uneven loading and transfer in Western blot. Statistically significant differences are indicated by *P < 0.05, **P < 0.01, ****P < 0.0001.

Influence of PKC-δ on the JNK and P38 MAPK Signaling Pathway and Its Mechanism of Action

We assayed the mRNA exposure levels of PKC-δ in the chondrocytes of SD rats, a model of OA, after stimulation with IL-1β (10 ng/ml) via qRT-PCR. The mRNA exposure of PKC-δ was noticeably lower in the blank, LV-shRNA-PKC-δ, and rottlerin groups in comparison with the LV-shRNA-NC counterpart ( Fig. 4A ). The protein levels of PKC-δ and p-PKC-δ in SD rat chondrocytes were measured via Western blot following stimulation with IL-1β (10 ng/ml) to simulate the OA model. The protein levels of PKC-δ and p-PKC-δ were reduced in the blank, LV-shRNA-PKC-δ, and rottlerin groups in comparison with those in the LV-shRNA-NC group ( Fig. 4B-D ). To further investigate the precise mechanism of the apoptotic role of PKC-δ in OA, we examined the MAPK signaling pathway, a key pathway of apoptosis. Western Blot analysis to determine the impact of PKC-δ on the MAPK signaling pathway-related protein expression demonstrated that phosphorylation of JNK and p38 were increased following activation of PKC-δ by IL-1β; moreover, upon silencing of PKC-δ or addition of rottlerin, phospho-p38 and JNK were visibly inhibited ( Fig. 4E ). These outcomes indicated that the inflammatory effects of IL-1β present as a condition of JNK and p38 MAPK signal pathway activation in chondrocytes can be suppressed by decreasing PKC-δ expression and phosphorylation.

Figure 4. Effect of PKC-δ on the JNK and p38 MAPK signaling pathways and the mechanism involved. (A) qRT-PCR was used to detect the expression of PKC-δ mRNA in SD rat chondrocytes under different treatments. (B-D) PKC-δ and p-PKC-δ protein expression in chondrocytes of SD rats in each group were detected by Western blot and quantified by ImageJ. (E) Expression of p-p38, p38, p-JNK, and JNK proteins in the MAPK pathway in different groups of SD rat chondrocytes, with ImageJ used for quantification. Values are presented as mean ± standard deviation (n = 3). PKC-δ = protein kinase C-delta; JNK = Jun amino-terminal kinases; MAPK = mitogen-activated protein kinase; qRT-PCR = quantitative real-time reverse transcription polymerase chain reaction; LV = lentivirus. Statistically significant differences are indicated by *P < 0.05, **P < 0.01, ****P < 0.0001.

In summary, IL-1β induces PKC-δ expression and activation in chondrocytes, and the activated PKC-δ can promote the performance of BAX and caspase-3 apoptosis-related genes through regulation of JNK and p38 MAPK signaling cascades, thereby causing chondrocyte apoptosis and promoting OA progression.

Discussion

OA is the most prevalent chronic articular disorder in the elderly population and can lead to progressive destruction of articular cartilage, ultimately resulting in irreversible disability. The sole resident cell in articular cartilage, the chondrocyte, undergoes changes in proliferation, viability, secretion, and metabolism as OA develops, so damage to the function and survival of chondrocytes will lead to degeneration of articular cartilage. 37 Several studies confirmed that OA chondrocyte death has the morphological and molecular characteristics of apoptosis. 38 Apoptotic mechanisms play a critical role in cartilage degeneration, and apoptosis inhibition has been suggested as a means of protecting articular chondrocytes from OA.27,39,40 Although multiple proteins are involved in apoptosis, PKC-δ is pivotal as a signaling molecule within the apoptotic pathway; moreover, activated PKC-δ is a crucial mediator of apoptotic signaling. 41 PKC-δ has been reported to be a pro-apoptotic protein. In systemic lupus erythematosus and lymphoproliferative diseases, PKC-δ shows pro-apoptotic activity. 42 It also promotes apoptosis of renal cells in acute kidney injury. 43 Finally, activated PKC-δ promotes apoptosis in prostate cancer cells. 12 Nevertheless, the expression and activation of PKC-δ in OA and its relationship with chondrocyte apoptosis appear to be unexplored in domestic and international studies. In this research, immunohistochemical analysis indicated that the human osteoarthritic cartilage showed higher expression of PKC-δ and p38 proteins relative to normal cartilage. Moreover, TUNEL assays revealed a higher rate of apoptosis of cells from chondrocytes from osteoarthritic rather than from normal cartilage. Taken together, these findings confirm the ring-breaking function of PKC-δ in human OA. Thus, we recommend PKC-δ as a strategic potential target in OA therapy.

PKC-δ is broadly distributed in cells and tissues but is controlled by different molecular mechanisms. Activated by distinct mechanisms, PKC-δ plays diverse functions and critical positions in cellular processes such as apoptosis, polarization, and growth control. 44 Whether tested in vivo or in vitro, IL-1β, being one of the essential pro-inflammatory cytokines, leads to cartilage cell apoptosis, cartilage matrix degradation, and joint inflammation, thereby promoting OA progression.45,46 For this reason, a model of in vitro OA simulated by IL-1β was used in this study. Our present leads indicate that the mRNA of PKC-δ increases following IL-1β application to rat chondrocytes and the protein levels of both PKC-δ and p-PKC -δ increase in dose-dependent ways. Thus, the pro-inflammatory factor IL-1β can activate PKC-δ and play a role in its phosphorylation, a finding in line with those of previous studies. 13 In addition, we utilized flow cytometry to measure whether lentiviral silencing or the use of inhibitors followed by PKC-δ reduced chondrocyte apoptosis. The outcomes revealed that the proportion of chondrocytes in both early and late stages of apoptosis were markedly lower in the LV-shRNA-PKC-δ, rottlerin, and the blank groups in comparison with the LV-shRNA-NC counterpart. These findings indicate that chondrocyte apoptosis increases after PKC-δ activation by IL-1β, and that both silencing PKC-δ expression and adding rottlerin to inhibit phosphorylation of PKC-δ reduce chondrocyte apoptosis. This result is in line with that of Wang et al. 27 who found that chondroprotective effects on OA chondrocytes could be produced by suppressing apoptosis in chondrocytes cultivated with IL-1β. A growing body of research has also shown that members of the BCL-2 series (1) regulate chondrocyte viability and apoptosis and (2) initiate the activity of caspases in a cascade reaction. The activation of caspases is a core event in apoptosis in which the family causes cell destruction. 47 A corresponding increase in BAX levels and caspase-3 cleavage can promote apoptosis, and inhibition of BAX and caspase-3 activation may be critical for reducing chondrocyte apoptosis. 48 In ischemic stroke, chlorpromazine and promethazine exert neuroprotective effects by inhibiting the NOX/Akt/PKC pathway, reducing BAX and caspase-3, and upregulating BCL-XL, which are involved in the neuronal apoptosis mechanism. 49 The activation of PKC-δ and downregulation of some proto-oncogenes may lead to caspase-3 protein activation to induce apoptosis. 50 Consistent with previous studies, our work used qRT-PCR and Western Blot to detect these mediators of apoptosis. We found that silencing or inhibiting PKC-δ diminished the expression of BAX and caspase-3 in IL-1β-induced cells in chondrocytes. The present findings further suggest that PKC-δ exerts a pro-apoptotic effect upon chondrocytes by modulating critical mediators, including BAX and caspase-3.

Triggering the MAPK pathway can lead to the induction of apoptosis, and the MAPK pathway is one of the major upstream signaling pathways that cause apoptosis in chondrocytes.17,51 PKs perform tactical regulation by phosphorylating other target proteins and thus functionally regulate intracellular signal transduction pathways; consequently, any interference with their function may potentially lead to major downstream effects. 52 After cells are stimulated by other factors such as growth factors and inflammation, MAPK is activated by receiving activation signals and exhibits cascading phosphorylation. In mammals, the JNK and p38 MAPK signal pathways function critically during stress responses involving inflammation and apoptosis, as shown by Gonçalves et al. 53 who confirmed that activation of the PKC-δ/P38 MAPK pathway mediates podocyte apoptosis. Piao et al. 54 established that phosphorylation of JNK and PKC-δ participated in this upstream effect of inducing the apoptosis of U937 cells. It has not been explained, however, whether PKC-δ activation exerts its effect on regulating chondrocyte apoptosis in OA through phosphorylation of the JNK and p38 MAPK pathways. The p38 and JNK MAPK phosphorylation pathways were demonstrated to play critical parts in vascular dementia, with the anti-apoptotic protein BCL-2 being down-regulated and the pro-apoptotic genes BAX, caspase-3, and cleaved-parp being upregulated. 55 Single exercise triggers upregulation of p53 and caspase-3 as well as increased phosphorylation of p38 MAPK and JNK during neutrophil apoptosis. 56 Such studies imply that MAPK activation leads to phosphorylation of JNK and p38 MAPK, which, in turn, triggers transcription factors and stimulates apoptosis.

In this work, the mechanism and signaling pathway by which PKC-δ promotes apoptosis was further investigated by detecting the exposure levels for JNK and p38 and their phosphorylated proteins (p-JNK and p-p38) in IL-1β-induced osteoarthritic chondrocytes in vitro through Western blot. The outcomes revealed that both JNK and p38 protein presentation and phosphorylation levels in the MAPK pathway were decreased after silencing PKC-δ or inhibiting PKC-δ phosphorylation. We suggest that IL-1β activates PKC-δ, an event which then promotes apoptosis in OA chondrocytes by regulating phosphorylation along the JNK and p38 MAPK signal pathways, with upregulation of BAX and caspase-3 activity.

In summary, we demonstrated in an in vitro OA model that (1) IL-1β-induced PKC-δ expression and activation in chondrocytes and (2) activated PKC-δ can promote BAX and caspase-3 expression via regulation of the JNK and p38 MAPK signaling cascades, thereby causing chondrocyte apoptosis and promoting OA progression. Accordingly, both the PKC-δ signaling and the JNK and p38 MAPK pathways could be targets for the treatment of inflammation-induced OA. This study is anchored on the pro-chondrocyte apoptotic properties of PKC-δ under IL-1β induction ex vivo, which suggested to us that apoptosis inhibitors may become a new therapeutic option for OA patients. The damaging effects of PKC-δ in OA have not been tested in animals, and whether PKC-δ inhibitors can attenuate OA pathology still needs further validation. In the meantime, PKC-δ activators should also be tested in OA studies.

Supplemental Material

sj-pdf-1-car-10.1177_19476035231181446 – Supplemental material for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways

Supplemental material, sj-pdf-1-car-10.1177_19476035231181446 for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways by Jinfeng Lu, Miao Yu and Jia Li in CARTILAGE

sj-tif-3-car-10.1177_19476035231181446 – Supplemental material for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways

Supplemental material, sj-tif-3-car-10.1177_19476035231181446 for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways by Jinfeng Lu, Miao Yu and Jia Li in CARTILAGE

sj-xls-2-car-10.1177_19476035231181446 – Supplemental material for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways

Supplemental material, sj-xls-2-car-10.1177_19476035231181446 for PKC-δ Promotes IL-1β-Induced Apoptosis of Rat Chondrocytes and Via Activating JNK and P38 MAPK Pathways by Jinfeng Lu, Miao Yu and Jia Li in CARTILAGE

Acknowledgments and Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This study was supported by the National Natural Science Foundation of China (grant no.: 81760402) and “Medical Excellence Award” Funded by the Creative Research Development Grant from the First Affiliated Hospital of Guangxi Medical University.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval: The Medical Ethics Committee of the First Affiliated Hospital of Guangxi Medical University approved this study (Approval number: 2016-KY-114).

Trial Registration: Not applicable.

ORCID iD: Jia Li https://orcid.org/0000-0001-7397-1367

Supplementary material for this article is available on the Cartilage website at http://cart.sagepub.com/supplemental.
==== Refs
References

1 Deng J Zong Z Su Z Chen H Huang J Niu Y , et al . Recent advances in pharmacological intervention of osteoarthritis: a biological aspect. Front Pharmacol. 2021;12 :772678.34887766
2 Bao J Chen Z Xu L Wu L Xiong Y . Rapamycin protects chondrocytes against IL-18-induced apoptosis and ameliorates rat osteoarthritis. Aging (Albany NY). 2020;12 (6 ):5152-67.
3 Jang S Lee K Ju JH . Recent updates of diagnosis, pathophysiology, and treatment on osteoarthritis of the knee. Int J Mol Sci. 2021;22 (5 ):2619.33807695
4 Wang T He C . Pro-inflammatory cytokines: the link between obesity and osteoarthritis. Cytokine Growth Factor Rev. 2018;44 :38-50.30340925
5 Chen YL Yan DY Wu CY Xuan JW Jin CQ Hu XL , et al . Maslinic acid prevents IL-1β-induced inflammatory response in osteoarthritis via PI3K/AKT/NF-κB pathways. J Cell Physiol. 2021;236 (3 ):1939-49.
6 Chen JL Lin HH Kim KJ Lin A Ou JH Ann DK . PKC delta signaling: a dual role in regulating hypoxic stress-induced autophagy and apoptosis. Autophagy. 2009;5 (2 ):244-6.
7 Mochly-Rosen D Das K Grimes KV . Protein kinase C, an elusive therapeutic target? Nat Rev Drug Discov. 2012;11 (12 ):937-57.
8 Baker J Falconer AMD Wilkinson DJ Europe-Finner GN Litherland GJ Rowan AD . Protein kinase D3 modulates MMP1 and MMP13 expression in human chondrocytes. PLoS ONE. 2018;13 (4 ):e0195864.
9 Matta C Mobasheri A . Regulation of chondrogenesis by protein kinase C: emerging new roles in calcium signalling. Cell Signal. 2014;26 (5 ):979-1000.24440668
10 LaVallie ER Chockalingam PS Collins-Racie LA Freeman BA Keohan CC Leitges M , et al . Protein kinase Czeta is up-regulated in osteoarthritic cartilage and is required for activation of NF-kappaB by tumor necrosis factor and interleukin-1 in articular chondrocytes. J Biol Chem. 2006;281 (34 ):24124-37.
11 Gan X Wang J Wang C Sommer E Kozasa T Srinivasula S , et al . PRR5L degradation promotes mTORC2-mediated PKC-δ phosphorylation and cell migration downstream of Gα12. Nat Cell Biol. 2012;14 (7 ):686-96.
12 Yoon JS Lee HJ Sim DY Im E Park JE Park WY , et al . Moracin D induces apoptosis in prostate cancer cells via activation of PPAR gamma/PKC delta and inhibition of PKC alpha. Phytother Res. 2021;35 (12 ):6944-53.
13 Ge J Cheng X Yan Q Wu C Wang Y Yu H , et al . Calcitonin inhibits intervertebral disc degeneration by regulating protein kinase C. J Cell Mol Med. 2020;24 (15 ):8650-61.
14 Yueh PF Lee YH Chiang IT Chen WT Lan KL Chen CH , et al . Suppression of EGFR/PKC-δ/NF-κB signaling associated with imipramine-inhibited progression of non-small cell lung cancer. Front Oncol. 2021;11 :735183.34765548
15 Wu CM Li TM Tan TW Fong YC Tang CH . Berberine reduces the metastasis of chondrosarcoma by modulating the α v β 3 integrin and the PKC δ, c-Src, and AP-1 signaling pathways. Evid Based Complement Alternat Med. 2013;2013 :423164.24027594
16 Mori N Ishikawa C Senba M . Activation of PKC-δ in HTLV-1-infected T cells. Int J Oncol. 2015;46 (4 ):1609-18.
17 Yue J López JM . Understanding MAPK signaling pathways in apoptosis. Int J Mol Sci. 2020;21 (7 ):2346.32231094
18 Yang XD Hou ZS Liu MQ Zeng C Zhao HK Xin YR , et al . Identification and characterization of mkk genes and their expression profiles in rainbow trout (Oncorhynchus mykiss) symptomatically or asymptomatically infected with Vibrio anguillarum. Fish Shellfish Immunol. 2022;121 :1-11.34974153
19 Zhou F Mei J Han X Li H Yang S Wang M , et al . Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-κB/MAPK signaling and protecting chondrocytes. Acta Pharm Sin B. 2019;9 (5 ):973-85.
20 Lee S Rauch J Kolch W . Targeting MAPK signaling in cancer: mechanisms of drug resistance and sensitivity. Int J Mol Sci. 2020;21 (3 ):1102.32046099
21 Guo YJ Pan WW Liu SB Shen ZF Xu Y Hu LL . ERK/MAPK signalling pathway and tumorigenesis. Exp Ther Med. 2020;19 (3 ):1997-2007.32104259
22 Hammouda MB Ford AE Liu Y Zhang JY . The JNK signaling pathway in inflammatory skin disorders and cancer. Cells. 2020;9 (4 ):857.32252279
23 Wu Q Wu W Fu B Shi L Wang X Kuca K . JNK signaling in cancer cell survival. Med Res Rev. 2019;39 (6 ):2082-104.
24 Zhang Z Li M Ma X Zhou SL Ren ZW Qiu YS . GADD45β-I attenuates oxidative stress and apoptosis via Sirt3-mediated inhibition of ER stress in osteoarthritis chondrocytes. Chem Biol Interact. 2018;296 :76-82.30237062
25 Yeung YT Aziz F Guerrero-Castilla A Arguelles S . Signaling pathways in inflammation and anti-inflammatory therapies. Curr Pharm Des. 2018;24 (14 ):1449-84.
26 Whitaker RH Cook JG . Stress relief techniques: p38 MAPK determines the balance of cell cycle and apoptosis pathways. Biomolecules. 2021;11 (10 ):1444.34680077
27 Wang BW Jiang Y Yao ZL Chen PS Yu B Wang SN . Aucubin protects chondrocytes against IL-1β-induced apoptosis in vitro and inhibits osteoarthritis in mice model. Drug Des Devel Ther. 2019;13 :3529-38.
28 Ansari MY Ball HC Wase SJ Novak K Haqqi TM . Lysosomal dysfunction in osteoarthritis and aged cartilage triggers apoptosis in chondrocytes through BAX mediated release of Cytochrome c. Osteoarthritis Cartilage. 2021;29 (1 ):100-12.
29 Sun XM MacFarlane M Zhuang J Wolf BB Green DR Cohen GM . Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J Biol Chem. 1999;274 (8 ):5053-60.
30 Musumeci G Loreto C Carnazza ML Martinez G . Characterization of apoptosis in articular cartilage derived from the knee joints of patients with osteoarthritis. Knee Surg Sports Traumatol Arthrosc. 2011;19 (2 ):307-13.
31 Zhang H Zheng W Li D Zheng J . miR-146a-5p promotes chondrocyte apoptosis and inhibits autophagy of osteoarthritis by targeting NUMB. Cartilage. 2021;13 (suppl 2 ):1467S-77.
32 Zhang Y Cai W Han G Zhou S Li J Chen M Li H . Panax notoginseng saponins prevent senescence and inhibit apoptosis by regulating the PI3K-AKT-mTOR pathway in osteoarthritic chondrocytes. Int J Mol Med. 2020;45 (4 ):1225-36.
33 Hu PF Chen WP Bao JP Wu LD . Paeoniflorin inhibits IL-1β-induced chondrocyte apoptosis by regulating the Bax/Bcl-2/caspase-3 signaling pathway. Mol Med Rep. 2018;17 (4 ):6194-200.
34 Sui X Kong N Ye L Han W Zhou J Zhang Q , et al . p38 and JNK MAPK pathways control the balance of apoptosis and autophagy in response to chemotherapeutic agents. Cancer Lett. 2014;344 (2 ):174-9.
35 Martínez-Limón A Joaquin M Caballero M Posas F de Nadal E . The p38 pathway: from biology to cancer therapy. Int J Mol Sci. 2020;21 (6 ):1913.32168915
36 Zhou Y Ming J Li Y Deng M Chen Q Ma Y , et al . Ligustilide attenuates nitric oxide-induced apoptosis in rat chondrocytes and cartilage degradation via inhibiting JNK and p38 MAPK pathways. J Cell Mol Med. 2019;23 (5 ):3357-68.
37 Charlier E Deroyer C Ciregia F Malaise O Neuville S Plener Z , et al . Chondrocyte dedifferentiation and osteoarthritis (OA). Biochem Pharmacol. 2019;165 :49-65.30853397
38 Musumeci G Castrogiovanni P Trovato FM Weinberg AM Al-Wasiyah MK Alqahtani MH , et al . Biomarkers of chondrocyte apoptosis and autophagy in osteoarthritis. Int J Mol Sci. 2015;16 (9 ):20560-75.
39 Varela-Eirin M Loureiro J Fonseca E Corrochano S Caeiro JR Collado M , et al . Cartilage regeneration and ageing: targeting cellular plasticity in osteoarthritis. Ageing Res Rev. 2018;42 :56-71.29258883
40 Kang D Shin J Cho Y Kim HS Gu YR Kim H , et al . Stress-activated miR-204 governs senescent phenotypes of chondrocytes to promote osteoarthritis development. Sci Transl Med. 2019;11 (486 ):eaar6659.
41 Silva RD Saraiva L Coutinho I Gonçalves J Côrte-Real M . Yeast as a powerful model system for the study of apoptosis regulation by protein kinase C isoforms. Curr Pharm Des. 2012;18 (17 ):2492-500.
42 Omarjee O Picard C Frachette C Moreews M Rieux-Laucat F Soulas-Sprauel P , et al . Monogenic lupus: dissecting heterogeneity. Autoimmun Rev. 2019;18 (10 ):102361.31401343
43 Wu D Pan J Zhang D . Inhibition of PKC-δ reduce rhabdomyolysis-induced acute kidney injury. J Cell Mol Med. 2022;26 (11 ):3243-53.
44 Steinberg SF . Distinctive activation mechanisms and functions for protein kinase Cdelta. Biochem J. 2004;384 (pt 3 ):449-59.
45 Hwang HS Kim HA . Chondrocyte apoptosis in the pathogenesis of osteoarthritis. Int J Mol Sci. 2015;16 (11 ):26035-54.
46 Dong W Wang S Qian W Li S Wang P . Cedrol alleviates the apoptosis and inflammatory response of IL-1β-treated chondrocytes by promoting miR-542-5p expression. In Vitro Cell Dev Biol Anim. 2021;57 (10 ):962-72.
47 Van Opdenbosch N Lamkanfi M . Caspases in cell death, inflammation, and disease. Immunity. 2019;50 (6 ):1352-64.
48 Rogers C Fernandes-Alnemri T Mayes L Alnemri D Cingolani G Alnemri ES . Cleavage of DFNA5 by caspase-3 during apoptosis mediates progression to secondary necrotic/pyroptotic cell death. Nat Commun. 2017;8 :14128.28045099
49 Tong Y Elkin KB Peng C Shen J Li F Guan L , et al . Reduced apoptotic injury by phenothiazine in ischemic stroke through the NOX-Akt/PKC pathway. Brain Sci. 2019;9 (12 ):378.31847503
50 Oskoueian E Abdullah N Ahmad S . Phorbol esters from Jatropha meal triggered apoptosis, activated PKC-δ, caspase-3 proteins and down-regulated the proto-oncogenes in MCF-7 and HeLa cancer cell lines. Molecules. 2012;17 (9 ):10816-30.
51 Lee SE Lim JW Kim JM Kim H . Anti-inflammatory mechanism of polyunsaturated fatty acids in Helicobacter pylori-infected gastric epithelial cells. Mediators Inflamm. 2014;2014 :128919.24987192
52 Hafeez A Elmadhoun O Peng C Ding JY Geng X Guthikonda M , et al . Reduced apoptosis by ethanol and its association with PKC-δ and Akt signaling in ischemic stroke. Aging Dis. 2014;5 (6 ):366-72.
53 Gonçalves GL Costa-Pessoa JM Thieme K Lins BB Oliveira-Souza M . Intracellular albumin overload elicits endoplasmic reticulum stress and PKC-delta/p38 MAPK pathway activation to induce podocyte apoptosis. Sci Rep. 2018;8 (1 ):18012.30573754
54 Piao JL Jin YJ Li ML Zakki SA Sun L Feng QW , et al . Excessive oxidative stress in the synergistic effects of shikonin on the hyperthermia-induced apoptosis. Curr Mol Med. 2018;18 (5 ):322-34.
55 Wang XX Zhang B Xia R Jia QY . Inflammation, apoptosis and autophagy as critical players in vascular dementia. Eur Rev Med Pharmacol Sci. 2020;24 (18 ):9601-14.
56 Lagranha CJ Hirabara SM Curi R Pithon-Curi TC . Glutamine supplementation prevents exercise-induced neutrophil apoptosis and reduces p38 MAPK and JNK phosphorylation and p53 and caspase 3 expression. Cell Biochem Funct. 2007;25 (5 ):563-9.
