
==== Front
Cartilage
Cartilage
CAR
spcar
Cartilage
1947-6035
1947-6043
SAGE Publications Sage CA: Los Angeles, CA

37431854
10.1177/19476035231181094
10.1177_19476035231181094
Basic Cartilage Research
Cartilage Metabolism
PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production
https://orcid.org/0000-0002-4247-295X
Gao YuXuan 1*
Yan Wen 2*
Sun Liangye 3
Zhang XiaoLing 14
1 Department of Orthopedics, The Second Hospital of Shanxi Medical University, Taiyuan, P.R. China
2 Center of Stomatology, The Second Affiliated Hospital of Soochow University, Soochow, P.R. China
3 Department of Orthopedic Surgery, Luan Hospital, Anhui Medical University, Luan, China
4 Department of Orthopedics, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, P.R. China
XiaoLing Zhang, Department of Orthopedics, The Second Hospital of Shanxi Medical University, Taiyuan 030000, Shanxi, P.R. China. Email: xlzhang@shsmu.edu.cn
* These authors have contributed equally to this work.

The first completed unit

Shanxi Medical University

11 7 2023
9 2024
15 3 303314
© The Author(s) 2023
2023
SAGE Publications Ltd unless otherwise noted. Manuscript content on this site is licensed under Creative Commons Licenses
https://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access page(https://us.sagepub.com/en-us/nam/open-access-at-sage).
Objectives

Osteoarthritis (OA) is the most common joint disease. The occurrence and progression of OA are regulated by epigenetics. A large number of studies have shown the important regulatory role of noncoding RNAs in joint diseases. As the largest class of noncoding small RNAs, the importance of piRNAs in many diseases, especially cancer, has been increasingly recognized. However, few studies have explored the role of piRNAs in OA. Our study showed that hsa_piR_019914 decreased significantly in OA. This study aimed to demonstrate the role of hsa_piR_019914 as a potential biological target of OA in chondrocytes.

Design

The GEO database and bioinformatics analysis were used for a series of screenings, and the OA model using human articular chondrocytes (C28/I2 cells), SW1353 cells under inflammatory factor stimulation was used to determine that hsa_piR_019914 was significantly downregulated in OA. Overexpression or inhibition of hsa_piR_019914 in C28/I2 cells was achieved by transfecting mimics or inhibitors. The effect of hsa_piR_019914 on the biological function of chondrocytes was verified by qPCR, flow cytometry, and colony formation assays in vitro. The target gene of hsa_piR_019914, lactate dehydrogenase A (LDHA), was screened by small RNA sequencing and quantitative polymerase chain reaction (qPCR), LDHA was knocked out in C28/I2 cells by the transfection of siRNA LDHA, and the relationship between hsa_piR_019914, LDHA, and reactive oxygen species (ROS) production was verified by flow cytometry.

Results

The piRNA hsa-piR-019914 was significantly downregulated in osteoarthritis (OA). Hsa-piR-019914 reduced inflammation-mediated chondrocyte apoptosis and maintained cell proliferation and clone formation in vitro. Hsa-piR-019914 reduced the production of LDHA-dependent ROS through targeted regulation of LDHA expression, maintained chondrocyte-specific gene expression of ACAN and COL2, and inhibited the gene expression of MMP3 and MMP13.

Conclusions

Collectively, this study showed that hsa_piR_019914 was negatively correlated with the expression of LDHA, which mediates ROS production. Under the stimulation of inflammatory factors, overexpression of hsa_piR_019914 had a protective effect on chondrocytes in vitro, and the absence of hsa_piR_019914 exacerbated the negative effect of inflammation on chondrocytes. Studies on piRNAs provide new therapeutic interventions for OA.

piRNA
osteoarthritis
chondrocyte
ROS
LDHA
Grant for Key Research and Development Plan of Anhui Province, Special Project on the population health 202004j07020003 typesetterts1
==== Body
pmcIntroduction

Osteoarthritis (OA) is one of the most common joint diseases and the main reason for chronic pain and disability in the elderly population. 1 With the aging of the population, the incidence rate of this disease is on the rise worldwide and is characterized by cartilage degeneration, osteophyte formation, subchondral osteosclerosis, chronic synovial inflammation, and meniscus injury. At present, studies have shown that the pathogenesis of osteoarthritis is mainly affected by age, sex, obesity, abnormal activity of osteoclasts and chondrocytes, dysfunction of the extracellular matrix, and other factors. 2 At present, early diagnosis of OA is very difficult, and it is usually diagnosed during the clinical manifestation or late stage. At this time, the effect of conservative treatment is very limited, and the quality of life of patients can only be improved by joint replacement surgery. 3 However, not all patients can undergo surgery, and postoperative complications and mortality can occur. 4 At present, there is no method for the early diagnosis and etiological treatment of osteoarthritis, and there is no particularly effective intervention or treatment for patients with advanced osteoarthritis except surgery. Therefore, it is critical to explore the pathophysiology and molecular regulatory mechanism of osteoarthritis to identify biomarkers for the early diagnosis of osteoarthritis and develop new targets for etiology and treatment.

Epigenetics has become a research hotspot in the field of life science in recent years, and noncoding RNA research is an important part of this field. Studies have confirmed that ncRNAs (miRNAs, lncRNAs, and circRNAs) play important roles in the biological processes of transcription and translation. NcRNAs are involved in the regulation of inflammation, chondrocyte apoptosis, and extracellular matrix metabolism and play an important role in the occurrence and development of OA. 5 With further research on microRNAs (miRNAs) and long noncoding RNAs (lncRNAs) among noncoding RNAs, research on piwi-interacting RNAs (piRNAs), which is a new research field, has become a new hotspot in life science research.6,7 PiRNA is a kind of small noncoding RNA composed of 24 to 31 nucleotides found in bacteria and somatic cells. PiRNA can bind to the piwi protein to form the piRNA/piwi complex, thus affecting transposon silencing, spermatogenesis, genome rearrangement, epigenetic changes, and protein regulation. 8 A large portion of piRNAs come from 2 types of large genome loci called piRNA clusters. 9 Similar to coding genes, single-stranded clusters are transcribed by RNA polymerase II, and double-stranded clusters are transcribed from 2 genomic chains, which rely on nearby coding genes to promote transcriptional initiation. 10 Two types of piRNA are transcribed in the nucleus. These primitive piRNAs mainly rely on the intermediate carrying 5’ U to bind to piwi and then are methylated in the cytoplasm to form a mature piRNA-piwi complex. Piwi protein is composed of the PAZ and piwi structure. After PAZ binds to the piwi protein, the 3’ end is constructed by the Zuc ribozyme. 11 PiRNA plays an important role in physiological and pathological processes. PiRNA functions by forming piRNA-RNA complementarity through a mechanism similar to miRNA, and the targets include mRNAs, 12 lncRNAs, 13 and pseudogenes. 14

Reactive oxygen species (ROS) are the products of normal mitochondrial metabolism. 15 Under physiological conditions, the redox system in cells is balanced by ROS and reactive nitrogen (RNS). 16 Oxidative stress is the result of the loss of balance between the production of reactive oxygen species and intracellular antioxidant defense and scavenging, which may lead to cell death and promote the occurrence and development of diseases. 17 Oxidative stress is associated with many inflammatory responses. Oxidative stress not only causes the destruction of articular cartilage but also leads to inflammatory changes in articular cartilage. For example, in acute inflammation, neutrophils rapidly produce and release large amounts of ROS, which is known as oxidative eruption, and the synovial fluid of joints and the synovium of patients with OA often accumulates a large number of neutrophils, which can release a large number of free radicals. 18 During chronic inflammation, the production and clearance of ROS are imbalanced, and pathogens and host cells are in an environment of excessive ROS for a long time. 19 With further research, the relationship between oxidative stress and many diseases has been confirmed. Chronic inflammatory diseases such as diabetes, chronic obstructive pulmonary disease, tumor diseases such as colon and breast cancer, ischemia–reperfusion injury, rheumatoid arthritis and other autoimmune diseases, neurodegenerative diseases such as Alzheimer’s disease, atherosclerosis, and other cardiovascular diseases are all closely related to oxidative stress. 20 Oxidative stress is one of the main causes of cartilage tissue injury in osteoarthritis. Osteoarthritis chondrocytes can produce a large amount of ROS,21,22 and excessive ROS can lead to cartilage matrix degradation, 23 prevent the synthesis of hyaluronic acid and proteoglycan, 24 destroy the cell membrane, 25 and induce chondrocyte apoptosis. 26

LDH is a tetramer enzyme formed by the arrangement and binding of 2 subunits: LDHA and LDHB. As a key enzyme, LDHA participates in the last step of cell glycolysis, mainly catalyzing pyruvate to lactic acid and oxidizing NADH to NAD+, to provide energy for cells, which plays an important role in anaerobic glycolysis. Lactate dehydrogenase A has a higher affinity for pyruvate and a faster catalytic rate than LDHB. 27 LDHA is involved in mediating oxidative stress, 28 extracellular matrix degradation, 29 cell proliferation and migration, 30 and cell metabolism, 31 and it has been widely and deeply studied as an important target for drug development and disease treatment. LDHA is considered to be a sensor of ROS. 32 Many studies have reported that cells can be protected from oxidative stress by inhibiting LDHA-mediated ROS production.33-35 Chondrocytes under inflammatory conditions undergo a metabolic transition regulated by NF-κB activation, which leads to the reprogramming of cell metabolism to glycolysis and LDHA. Inflammation and metabolism can regulate each other to regulate the degradation of cartilage. LDHA binds with NADH to stabilize NF-κB, a key proinflammatory mediator in chondrocytes, and promotes catabolic changes induced by ROS. LDHA-mediated ROS generation in chondrocytes is a potential therapeutic target for osteoarthritis. 36

In this study, we screened the abnormal expression of piRNAs in OA, verified the biological function of hsa-piR-019914 in chondrocytes, and revealed that hsa-piR-019914 reduced the production of ROS through targeted inhibition of LDHA.

Methods

Bioinformatics Analysis

Bioinformatics analysis was carried out at https://www.omicstudio.cn/tool using OmicStudio software. Volcano maps (or other graphics) were drawn based on R on the OmicStudio platform (https://www.r-project.org/https://www.omicstudio.cn/tool). A small RNA sequencing dataset (GSE143514) including 3 OA patients and 5 normal controls was downloaded from the GEO datasets for piRNA expression analysis. The Cutadapt program was used to remove the connector sequence in the original offline data. The Trimmatic program was used to remove low-quality sequences to obtain clean data. The Fastqc program was used to count the data volume of the clean data and retain fragments larger than 15 nt for subsequent analysis. A bowtie program was used to compare clean data to the piRNA database and genome, an edger was used to analyze the difference in piRNA expression, and piRNAs with significant differences between the 2 comparison groups were selected according to P value <0.05 and FC>2 or FC<0.5.

Cell Culture

The human chondrocyte lines C28/I2 and SW1353 were purchased from the Cell Bank of the Chinese Academy of Sciences. The cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM)/F-12 (Thermo Fisher, California, USA) with 10% fetal bovine serum (FBS, BIOEXPLORER, California, USA) at 37°C in a humidified chamber with 5% CO2.

RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction

TRIzol reagent (Invitrogen, California, USA) was used to extract the total RNA from cells. For piRNA analysis, an EZB-miRT2-plus-L kit (EZBioscience, Roseville, USA) was used to reverse transcribe the piRNA into cDNA, and the relative expression level of piRNA was normalized to U6 controls. For mRNA analysis, a HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) was used to reverse transcribe the mRNA into cDNA, and the relative expression level of genes was normalized to the internal control GAPDH. Real-time quantitative polymerase chain reaction (q-PCR) was conducted in a LightCycler 480 instrument and a ChamQ Universal SYBR qPCR Master Mix kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions. Relative piRNA and mRNA expression was calculated using the 2-ΔΔCt method. All q-PCR was performed in triplicate on a LightCycler 480 System (Roche, Basel, Switzerland). The primers were obtained from Sangon Biotech (Shanghai, China) Co., Ltd. ( Table 1 ).

Table 1. The Sequence of Primers.

Name	Forward primer (5'-3')	Reverse primer (5'-3')	
hsa_piR_000794	CGGCTAGCTCAGTCGGTAGAG		
hsa_piR_014620	TGGTCGTGGTTGTAGTCCGT		
hsa_piR_016658	CCCCCCACTGCTAAATTTGACT		
hsa_piR_016659	CCCCCCACTGCTAAATTTGACTG		
hsa_piR_019914	GCTAGCTCAGTCGGTAGAGCATG		
hsa_piR_019949	AGCTCAGTTGGTAGAGCATCAGA		
hsa_piR_019951	GTAGCTCAGTCGGTAGAGCATCA		
hsa_piR_020391	GGCTCTGTTGCGCAATGGATA		
hsa_piR_021032	TAAAGTGCTGACAGTGCAGATAGTG		
hsa_piR_021462	TAAGGTGCATCTAGTGCAGATAGTG		
LDHA	TGTCTCTGGCAAAGTGGATATCTT	ACCGCTTCCAATAACACGGT	
SEC61A1	TTGCCCACAACAGTCTCCTC	AGAGTACCTTTGTGCCGAGC	
NCL	TCTGGTGCCAGACGTGTTAC	TCCATTGGGATGGGTGAAGC	
IPO5	GAGAAGCCTTTCCAGGACCC	CGCCATTGCGCTTATTGTGT	
MCFD2	CAGAACCCCCTTCCTGTGTG	CATCTCCGCCTCTGGTTTGT	
PPP1CB	TATTTTCCGTGGGTGCCTCC	CTCGGCGTTCTCTCACCTAC	
PSMD1	GCATACTGGATGCAGGTGGT	ACAGCAGTAGAAACCTTTAAGTCCT	
DYNC1H1	AGAAGACCAAGCCTGTCACG	CCTTGGCCTTTGCACACTTC	
RPS20	TTGACTTGCACAGTCCTTCTGA	ATGGTGACTTCCACCTCAAC	
NMT1	TGTGAGGCAGCCTTCTGATG	GTCCCTGTTCCCAGACATGG	
SPTAN1	TGGAGCTGCAGAAGGAACAG	CCACCATACAGGACCCATCG	
AFF3	GCCCACCTTGAAAGTTGCAG	GGGAAATGTGGGCCATCAGA	
HARS2	TGCCAAAGCCAGGGTACCAG	CTCAAATGCTGGGGTGTCCA	
LRPPRC	TGGCCGGAGGACTACTGAG	CTTTGGAATGCGGCCAGTTC	
NCKAP1	ACAACATCAAGAAGGCATGTGG	TCTGTAGTTGTGCAAGCTGTTGA	
ACAN	GAGGACGTATGGCATCCGAG	GACCTCACCCTCCATCTCCT	
COLII	CGAAAGGTCAGACGGGTGAA	GGCACCTCTCTTGCCTTCTT	
MMP3	CAGCCAACTGTGATCCTGCT	CTTCATATGCGGCATCCACG	
MMP13	GCACTTCCCACAGTGCCTAT	AGTTCTTCCCTTGATGGCCG	
GAPDH	GAAAGCCTGCCGGTGACTAA	GCATCACCCGGAGGAGAAAT	
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT	

Cell Transfection

The hsa-piR-019914 mimics, hsa-piR-019914 inhibitors, LDHA siRNA, and the negative control siRNA were purchased from General Bio-company (General Biol, Anhui, China). According to the manufacturer’s instructions, all mimics, inhibitors, and siRNA plasmids were transfected into C28/I2 cells using Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher, California, America).

Model of OA

In this study, 10 ng/ml interleukin (IL)-1β, 10 ng/ml tumor necrosis factor (TNF-α), or 1 µg/ml lipopolysaccharide (LPS) was used to stimulate C28/I2 cells or SW1353 cells to establish the model of OA in vitro for 24 h.

CCK-8 Analysis

The cells were inoculated into each well of a 96-well plate at a density of 2000 cells per well, and the cells were detected after they adhered to the well. This point was considered 0 h. Ten microliters of CCK-8 detection reagent was added at 0, 12, 24, 48, 72, and 96 h and incubated for 2 h. The absorbance at 450 nm was measured by a microplate instrument.

Clone Formation Analysis

The cells were inoculated into a 6-well cell culture plate at a density of 300 cells per well. The cells were cultured for 2 weeks, and the culture medium was changed every 3 days. After culture, the cells were fixed with 4% paraformaldehyde solution and stained with 0.1% crystal violet. After staining, the cells were washed twice with phosphate-buffered saline (PBS), and the number of clones was counted after drying.

Apoptosis Detection By Annexin V-FITC/PI and Flow Cytometry

C28/I2 cell apoptosis was determined by flow cytometry using an Annexin V-FITC Apoptosis Detection kit (Beyotime, Shanghai, China). C28/I2 cells were digested and collected with trypsin without ethylenediaminetetraacetic acid (EDTA), rinsed twice with cold PBS, and 500 μl binding buffer was added to suspend the cells according to the manufacturer’s instructions. Five microliters of Annexin V-FITC was added and mixed well, and 5 μl of propidium iodide was added, mixed well, and incubated in the dark at room temperature for 15 min. Flow cytometry was conducted on a BD Aria flow III cytometer (BD, New Jersey, USA). The results were analyzed by FlowJo software v10.

ROS Detection By H2DCFDA and Flow Cytometry

H2DCFDA staining was performed to detect the levels of ROS in C28/I2 cells. According to the manufacturer’s instructions, H2DCFDA was diluted with serum-free culture medium at 1:1000 to a final concentration of 10 μM. The cells were centrifuged, and the diluted probe was added to 1 × 106 cells/ml and incubated at 37°C in the dark for 30 min. After incubation, the analysis was performed on a BD Aria flow III flow cytometer (BD, New Jersey, USA). FlowJo software v10 was used to analyze the results.

mRNA Sequencing

The data were uploaded to the gene expression database (Gene Expression Omnibus, GEO) (numbered GSE227945). Total RNA was extracted using TRIzol reagent according to the manufacturer’s instructions. Furthermore, mRNA sequencing was performed by LianChuan Biological Company (Hangzhou, China). The samples were 3 cases of mimic NC-transfected C28/I2 cells and 3 cases of mimic hsa_piR_019914-transfected C28/I2 cells. After RNA was extracted by the TRIzol method, total RNA was purified by an RNeasy Kit (QIAGEN, Dusseldorf, Germany), and then cDNA libraries were constructed. RNA-seq was performed on an Illumina NovaSeq 6000 platform according to the manufacturer’s instructions, and reads were generated.

After sequencing, raw data (raw data) were obtained. After filtering, joints were removed, pollution was removed, and the reference genome was compared. High-quality mapped reads (MAPQ ≥ 30) were used for subsequent analysis. The Cutadapt program was used to remove the joint sequence in the original offline data. The Trimmatic program was used to remove low-quality sequences to obtain clean data. The FastQC program was used to count the data volume of clean data and the proportions of q20 and q30. The HISAT2 program was used to compare clean data to the reference genome. StringTie was used to splice reads into transcripts and analyze gene expression levels. Edger or DEGseq was used for differential gene expression analysis. Cluster Profiler was used to analyze the GO/KEGG pathways of differentially expressed genes.

Statistical Analysis

All tests in this study were repeated at least 3 times with similar results. Data were expressed as the mean ± standard deviation (SD). Unpaired 2-tailed Student’s t-test was carried out for the comparison between 2 groups and one-way analysis of variance (ANOVA) or 2-way ANOVA was used for multiple group comparisons with Tukey post hoc test. P < 0.05 was considered as statistically significant. GraphPad Prism software (Version 6.01) was used for statistical analysis. 37 According to the results of bioinformatics analysis and mRNA sequencing, differentially expressed genes were screened by fold change ≥2 and P ≤ 0.05 as the standard.

Result

Decreased Expression of piRNA-019914 in Chondrocytes Stimulated By Inflammation

To screen piRNAs that play an important role in OA, we analyzed the miRNA expression profiles of OA patients and normal controls in the GEO database (GSE143514). Bioinformatics analysis showed that there were 11 significantly downregulated piRNAs (P < 0.05 and fold change > 2) in OA compared with normal controls ( Fig. 1A and B ). To screen piRNAs closely related to OA, we used complete medium containing IL-1β (10 ng/ml), TNF-α (10 ng/ml), or LPS (1 µg/ml) to stimulate C28/I2 cells ( Fig. 1C ), SW1353 cells ( Fig. 1D ) for 24 h to construct OA cell models. qPCR was used to detect the expression of candidate piRNAs. The results showed that hsa-piR-019914 was significantly downregulated in each group. Then, we used qPCR to detect the mRNA expression level of piR in normal control and OA samples. The results showed that the expression of hsa-piR-019914 in OA was significantly lower than that in the control ( Fig. 1C and D ). These results showed the correlation between hsa-piR-019914 and OA. Hsa-piR-019914 has the potential to become a biomarker of OA.

Figure 1. Decreased expression of piRNA-019914 in chondrocytes stimulated by inflammation. (A) The heatmap shows the differentially expressed piRNAs in OA and normal cartilage. (B) The volcano map shows the differentially expressed piRNAs in OA and normal osteoarthritis cartilage. (C) The expression of differentially expressed piRNAs in C28/I2 cells stimulated with IL-1β, TNF-α, and LPS was detected by qPCR. (D) The expression of differentially expressed piRNAs in SW1353 cells stimulated with IL-1β, TNF-α, and LPS was detected by qPCR. Statistically significant differences are indicated by *P < 0.05, **P < 0.01. n = 3/group; piRNA = piwi-interacting RNAs; OA = osteoarthritis; NC = Negative Control; LPS = Lipopolysaccharide; qPCR = Quantitative Real-time PCR.

piRNA hsa_piR_019914 Overexpression Promotes the Anabolic Metabolism of Chondrocyte

To study the role of hsa-piR-019914 in chondrocyte function, C28/I2 cells were transfected with hsa-piR-019914 mimics, and the expression of hsa-piR-019914 in C28/I2 cells was significantly increased after transfection ( Fig. 2A ). We used complete medium containing TNF-α (10 ng/ml) to stimulate the transfected C28/I2 cells for 24 h. The CCK-8 results showed that overexpression of hsa-piR-019914 promoted the proliferation of chondrocytes ( Fig. 2B ), and similar results were observed in the colony formation experiment ( Fig. 2C ). Chondrocyte apoptosis is the main manifestation in the pathological process of OA. We used flow cytometry to detect the effect of hsa-piR-019914 on chondrocyte apoptosis. Q2 and Q3 represent the proportions of late apoptotic cells and early apoptotic cells, respectively. The results showed that overexpression of hsa-piR-019914 reduced chondrocyte apoptosis ( Fig. 2E and F and Suppl. Fig. S1A). ACAN and COL2 are specific chondrocyte genes. Overexpression of hsa-piR-019914 could protect the expression of ACAN and COL2 in C28/I2 cells ( Fig. 2G and H ). Matrix metalloproteinases play an important role in the development of OA and the destruction of the cartilage matrix. Overexpression of hsa-piR-019914 can reduce the production of MMP3 and MMP13 ( Fig. 2I and J ).

Figure 2. piRNA hsa_piR_019914 overexpression promotes the anabolic metabolism of chondrocytes. (A) The expression of hsa_piR_019914 in chondrocytes transfected with hsa_piR_019914 mimics. (B) The proliferation of chondrocytes transfected with hsa_piR_019914 mimics was detected by CCK-8 assays. (C) The clone formation ability of chondrocytes transfected with hsa_piR_019914 mimics was detected using crystal violet staining. (D) Quantitative analysis of the clone formation number of chondrocytes. (E) The apoptosis of chondrocytes transfected with hsa_piR_019914 mimics was detected by flow cytometry. (F) Quantitative analysis of the normal cells of chondrocyte detected by flow cytometry. The mRNA expression of collagen II (G), ACAN (H), MMP3 (I), and MMP13 (J) in chondrocytes transfected with hsa_piR_019914 mimics was detected with qPCR. Statistically significant differences are indicated by *P < 0.05, **P < 0.01. n = 3/group; piRNA = piwi-interacting RNAs; NC = Negative Control; PI= Propidium Iodide.

piRNA hsa_piR_019914 Suppression Promoted the Catabolic Metabolism of Chondrocyte

To study the role of hsa-piR-019914 in chondrocyte function, C28/I2 cells were transfected with hsa-piR-019914 inhibitors, and the expression of hsa-piR-019914 in C28/I2 cells was significantly inhibited after transfection ( Fig. 3A ). We used complete medium containing TNF-α (10 ng/ml) to stimulate the transfected C28/I2 cells for 24 h. The CCK-8 results showed that inhibition of hsa-piR-019914 inhibited the proliferation of chondrocytes ( Fig. 3B ), and similar results were observed in the colony formation experiment ( Fig. 3C ). Chondrocyte apoptosis is the main manifestation in the pathological process of OA. We used flow cytometry to detect the effect of hsa-piR-019914 on chondrocyte apoptosis. Q2 and Q3 represent the proportions of late apoptotic cells and early apoptotic cells, respectively. The results showed that inhibition of hsa-piR-019914 aggravated chondrocyte apoptosis ( Fig. 3E and F and Suppl. Fig. S1B). ACAN and COL2 are specific chondrocyte genes. Inhibition of hsa-piR-019914 could downregulate the expression of ACAN and COL2 in C28/I2 cells ( Fig. 3G and H ). Matrix metalloproteinases play an important role in the development of OA and the destruction of the cartilage matrix. Inhibiting hsa-piR-019914 can increase the production of MMP3 and MMP13 ( Fig. 3I and J ).

Figure 3. piRNA hsa_piR_019914 suppression promotes the catabolic metabolism of chondrocytes. (A) The expression of hsa_piR_019914 in chondrocytes transfected with hsa_piR_019914 inhibitors. (B) The proliferation of chondrocytes transfected with hsa_piR_019914 inhibitors was detected by CCK-8 assays. (C) The clone formation ability of chondrocytes transfected with hsa_piR_019914 inhibitors was detected using crystal violet staining. (D) Quantitative analysis of the clone formation number of chondrocytes. (E) The apoptosis of chondrocytes transfected with hsa_piR_019914 inhibitors was detected by flow cytometry. (F) Quantitative analysis of the normal cells of chondrocyte detected by flow cytometry. The mRNA expression of Collagen II (G), ACAN (H), MMP3 (I), and MMP13 (J) in chondrocytes transfected with hsa_piR_019914 inhibitors was detected with qPCR. Statistically significant differences are indicated by *P < 0.05, **P < 0.01. n = 3/group; piRNA = piwi-interacting RNA; NC = Negative Control; PI= Propidium Iodide.

piRNA hsa_piR_019914 Regulated the Expression of LDHA

To identify the target gene of hsa-piR-019914, we performed mRNA sequencing. The samples were 3 groups of C28/I2 cells transfected with mimics NC and 3 groups of C28/I2 cells transfected with hsa-piR-019914 mimics. The sequencing data were uploaded to the GEO database [GSE227945]. The heatmap ( Fig. 4A ) and volcano map ( Fig. 4B ) show the differentially expressed mRNAs in C28/I2 cells overexpressing hsa_piR_019914. KEGG enrichment analysis revealed a strong correlation between hsa_piR_019914 and signaling pathways related to apoptosis, oxidative stress, and inflammation ( Fig. 4C ). Combined with the mRNA sequencing data and bioinformatics analysis, 15 potential target genes were screened. The mRNA expression level of target genes was verified by qPCR. We found that LDHA expression was significantly downregulated when hsa-piR-019914 was overexpressed ( Fig. 4D ). By inhibiting hsa-piR-019914, it was confirmed that the expression of hsa-piR-019914 was negatively correlated with that of LDHA ( Fig. 4E ). There is a negative correlation between the expression of hsa-piR-019914 and LDHA mRNA in articular cartilage (Suppl. Fig. S3). Previous studies have shown that LDHA-mediated ROS production affects the progression of OA. 36 Combined with our results, we selected LDHA as the potential direct target gene of hsa-piR-019914.

Figure 4. The piRNA hsa_piR_019914 regulated LDHA expression. (A) The heatmap shows the differentially expressed mRNAs in chondrocytes transfected with piRNA mimics NC or hsa_piR_019914 mimics. (B) The volcano map shows the differentially expressed mRNAs in chondrocytes transfected with piRNA mimics NC or hsa_piR_019914 mimics. (C) KEGG enrichment of differentially expressed mRNAs. (D) The differentially expressed mRNAs in chondrocytes transfected with piRNA mimics NC or hsa_piR_019914 mimics were detected by qPCR. (E) The expression of LDHA mRNA in chondrocytes treated with inhibitor NC or hsa_piR_019914 inhibitors was detected by qPCR. Statistically significant differences are indicated by **P < 0.01. n = 3/group; piRNA = piwi-interacting RNA; LDHA = Lactate dehydrogenase A; NC = Negative Control; KEGG = Kyoto Encyclopedia of Genes and Genomes; qPCR = Quantitative Real-time PCR.

piRNA hsa_piR_019914 Regulated the Oxidative Stress in Chondrocyte

Lactate dehydrogenase A–mediated ROS production plays an important role in OA. 36 Flow cytometry showed that overexpression of hsa-piR-019914 decreased ROS production in C28/I2 cells, while inhibition of hsa-piR-019914 led to an increase in ROS production in C28/I2 cells ( Fig. 5A ). Quantitative analysis showed the proportion of ROS (+) cells in each group of C28/I2 ( Fig. 5B ). This may be related to our previous conclusion that hsa-piR-019914 regulates the expression of LDHA. siRNA LDHA was used to knock out the LDHA gene. In the control group, inhibition of hsa-piR-019914 led to an increase in the production of ROS, and in the siRNA LDHA group, inhibition of hsa-piR-019914 significantly decreased the production of ROS ( Fig. 5C and Suppl. Fig. S2). Quantitative analysis showed the proportion of ROS (+) cells in each group of C28/I2 cells ( Fig. 5D ).

Figure 5. The piRNA hsa_piR_019914 regulated oxidative stress in chondrocytes. (A) ROS-positive chondrocyte cells were detected by flow cytometry. (B) Quantitative analysis of ROS-positive chondrocyte cells. (C) ROS-positive chondrocytes transfected with LDHA knockdown were detected by flow cytometry. (D) Quantitative analysis of ROS-positive chondrocyte cells with LDHA knockdown. Statistically significant differences are indicated by **P < 0.01. n = 3/group; piRNA = piwi-interacting RNA; ROS = reactive oxygen species; LDHA = Lactate dehydrogenase A; NC = Negative Control.

Discussion

The etiology and pathogenesis of osteoarthritis are complex, and the exact molecular mechanism is not clear. As the number of high-throughput profiling studies and mechanistic investigations of noncoding RNAs in OA has increased, it has been confirmed that noncoding RNAs play an important role in the pathogenesis and are potential therapeutic targets of OA. 38 As a recently discovered non-small coding RNA, piRNA has been widely studied in the field of cancer, and its great research value and potential have been verified. With the development of high-throughput sequencing and other advanced detection techniques, it is easy to detect the abnormal expression of piRNA/piwi protein in diseases. Several databases, such as piRbase and piRNA Bank, can be used for piRNA functional analysis, target RNA prediction and homologous piRNA searches. The mechanism of piRNA in osteogenic differentiation has been studied, 39 and it has been found that piRNA is a potential target in osteoporosis. 40 However, no research has explored the role of piRNAs in OA.

In this study, we screened the abnormal expression of piRNAs in OA through the GEO database and bioinformatics analysis. Next, to verify the correlation between candidate piRNAs and the pathogenesis of OA, we constructed an in vitro model of OA chondrocytes and detected the expression of candidate piRNAs in OA chondrocytes. According to the results, we eliminated the piRNAs with no significant difference. We found that hsa_piR_019914 was significantly downregulated in OA.

To study the biological function of hsa_piR_019914 in chondrocytes, overexpression or inhibition of hsa_piR_019914 in C28/I2 cells was performed by transfection of hsa_piR_019914 mimics and hsa_piR_019914 inhibitors, and the transfection efficiency was verified by qPCR. Many studies have confirmed the important role of piRNAs in regulating cell proliferation and apoptosis.41-45 The normal function and activity of chondrocytes is an important condition for maintaining cartilage homeostasis. 46 Degenerative lesions of articular cartilage are the main feature of OA, and there is obvious apoptosis in OA cartilage. 47 Many studies have blocked chondrocyte apoptosis and regulated chondrocyte activity to treat OA. In this study, the CCK-8 assay results showed that overexpression of hsa_piR_019914 increased the proliferation of C28/I2 cells and inhibition of hsa_piR_019914 inhibited the proliferation of C28/I2 cells, and similar results were observed in the colony formation assay. Then, to determine whether hsa_piR_019914 can regulate the apoptosis of C28/I2 cells, we detected apoptosis by flow cytometry. The apoptosis level of cells overexpressing hsa_piR_019914 decreased, and inhibition of hsa_piR_019914 increased apoptosis. These results showed that hsa_piR_019914 maintained the proliferation of OA chondrocytes and reduced the apoptosis level of OA chondrocytes.

Further studies are needed to determine the potential target genes of hsa_piR_019914. We examined the hsa_piR_019914 overexpression group and negative control group of C28/I2 cells by small RNA sequencing. We uploaded the sequencing results to the GEO database [GSE227945]. KEGG pathway analysis showed that the differentially expressed miRNAs were mainly related to apoptosis, oxidative stress and the inflammatory signaling pathway. Here, our results demonstrated that the expression of hsa_piR_019914 was negatively correlated with the expression of LDHA. Lactate dehydrogenase A has been thoroughly studied as an important therapeutic target in many diseases, such as cancer. Arra et al. 36 showed that LDHA-mediated ROS generation in chondrocytes was a potential therapeutic target for osteoarthritis.

To further investigate whether the biological function of hsa_piR_019914 was mediated by LDHA, we transfected C28/I2 cells with the hsa_piR_019914 inhibitor and siLDHA and then used flow cytometry to detect ROS(+) cells. Our results showed that overexpression of hsa_piR_019914 reduced the production of ROS, and inhibition of hsa_piR_019914 increased the production of ROS. When the expression of hsa_piR_019914 was inhibited and the expression of LDHA was knocked down, the production of ROS decreased significantly. These results indicate that hsa_piR_019914 is involved in regulating the production of ROS, and hsa_piR_019914 inhibits the expression of LDHA and LDHA can mediate the production of ROS, 36 suggesting that hsa_piR_019914 is a potential target for the treatment of OA that can reduce the production of ROS in chondrocytes by targeting hsa_piR_019914 to inhibit the expression of LDHA.

Chondrocytes can produce a large amount of ROS under the pathological conditions of OA.20,21 Excessive ROS induce oxidative stress, increase the expression of matrix metalloproteinases, lead to degradation of the cartilage matrix, and block the synthesis of ACAN and COL2.24,48 Acan and Col2a1 are specific genes in chondrocytes, and MMP3 and MMP13 are matrix metalloproteinases that mediate the degradation of cartilage matrix. Our results show that the overexpression of hsa_piR_019914 can protect the expression of ACAN and COL2 in chondrocytes and reduce the expression of MMP3 and MMP13, and inhibiting hsa_piR_019914 can increase the expression of MMP3 and MMP13 in OA and decrease the expression of ACAN and COL2.

In this work, the following findings were highlighted: (1) piRNA hsa-piR-019914 was downregulated in OA, (2) the piRNA hsa_PiR_019914 can promote the proliferation of chondrocytes and reduce apoptosis, and (3) the piRNA hsa_piR_019914 can reduce the production of LDHA-dependent ROS by inhibiting the expression of LDHA, which has anti-inflammatory and anticatabolic effects.

Supplemental Material

sj-tif-1-car-10.1177_19476035231181094 – Supplemental material for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production

Supplemental material, sj-tif-1-car-10.1177_19476035231181094 for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production by YuXuan Gao, Wen Yan, Liangye Sun and XiaoLing Zhang in CARTILAGE

sj-tif-2-car-10.1177_19476035231181094 – Supplemental material for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production

Supplemental material, sj-tif-2-car-10.1177_19476035231181094 for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production by YuXuan Gao, Wen Yan, Liangye Sun and XiaoLing Zhang in CARTILAGE

sj-tif-3-car-10.1177_19476035231181094 – Supplemental material for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production

Supplemental material, sj-tif-3-car-10.1177_19476035231181094 for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production by YuXuan Gao, Wen Yan, Liangye Sun and XiaoLing Zhang in CARTILAGE

sj-xlsx-4-car-10.1177_19476035231181094 – Supplemental material for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production

Supplemental material, sj-xlsx-4-car-10.1177_19476035231181094 for PiRNA hsa_piR_019914 Promoted Chondrocyte Anabolic Metabolism By Inhibiting LDHA-Dependent ROS Production by YuXuan Gao, Wen Yan, Liangye Sun and XiaoLing Zhang in CARTILAGE

Acknowledgments and Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: The study was supported by a Grant for Key Research and Development Plan of Anhui Province, a Special Project on population health (202004j07020003).

Author Contributions: Conceptualization: Y.X. Gao, W Yan, L.Y. Sun, and X.L. Zhang; methodology and formal analysis: Y.X. Gao, W. Yan; drafting of the article: Y.X. Gao, W. Yan; review and editing: all authors; supervision: X.L. Zhang; acquisition of funding: Y.X. Gao, L.Y. Sun, and X.L. Zhang. All authors have read and agreed to the published version of the manuscript.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Ethical Approval: The Medical Research Ethics Committee of the Second Hospital of Shanxi Medical University.

ORCID iD: YuXuan Gao https://orcid.org/0000-0002-4247-295X

Availability of Data and Materials: The datasets used and/or analyzed during the present study are available from the corresponding author upon reasonable request.

Supplementary material for this article is available on the Cartilage website at http://cart.sagepub.com/supplemental.
==== Refs
References

1 Katz JN Arant KR Loeser RF . Diagnosis and treatment of hip and knee osteoarthritis: a review. JAMA. 2021;325 :568-78. doi:10.1001/jama.2020.22171.
2 Sharma L . Osteoarthritis of the Knee. N Engl J Med. 2021;384 :51-9. doi:10.1056/NEJMcp1903768.
3 Madry H . Surgical therapy in osteoarthritis. Osteoarthritis Cartilage. 2022;30 :1019-34. doi:10.1016/j.joca.2022.01.012.
4 Klausing A Martini M Wimmer MD Gravius S Wirtz DC Randau TM . Postoperative medical complications and intermediate care unit/intensive care unit admission in joint replacement surgery: a prospective risk model. J Arthroplasty. 2019;34 (4 ):717-22. doi:10.1016/j.arth.2018.12.034.
5 Ali SA Peffers MJ Ormseth MJ Jurisica I Kapoor M . The non-coding RNA interactome in joint health and disease. Nat Rev Rheumatol. 2021;17 (11 ):692-705. doi:10.1038/s41584-021-00687-y. 34588660
6 Sun H Peng G Ning X Wang J Yang H Deng J . Emerging roles of long noncoding RNA in chondrogenesis, osteogenesis, and osteoarthritis. Am J Transl Res. 2019;11 (1 ):16-30.30787967
7 Wu Y Lu X Shen B Zeng Y . The therapeutic potential and role of miRNA, lncRNA, and circRNA in osteoarthritis. Curr Gene Ther. 2019;19 (4 ):255-63. doi:10.2174/1566523219666190716092203.
8 Liu P Dong Y Gu J Puthiyakunnon S Wu Y Chen XG . Developmental piRNA profiles of the invasive vector mosquito Aedes albopictus. Parasites Vectors. 2016;9 :524. doi:10.1186/s13071-016-1815-8. 27686069
9 Han BW Zamore PD . piRNAs. Curr Biol. 2014;24 :R730-3. doi:10.1016/j.cub.2014.07.037.
10 Czech B Hannon GJ . One loop to rule them all: the ping-pong cycle and piRNA-guided silencing. Trends Biochem Sci. 2016;41 (4 ):324-37. doi:10.1016/j.tibs.2015.12.008.
11 Bornelov S Czech B Hannon GJ . An evolutionarily conserved stop codon enrichment at the 5’ ends of mammalian piRNAs. Nat Commun. 2022;13 :2118. doi:10.1038/s41467-022-29787-3. 35440552
12 Peng L Song L Liu C Lv X Li X Jie J , et al . piR-55490 inhibits the growth of lung carcinoma by suppressing mTOR signaling. Tumour Biol. 2016;37 (2 ):2749-56. doi:10.1007/s13277-015-4056-0.
13 Tuo Y Zhang J Li A Liu Z He Z Yuan X , et al . Prediction of cancer-associated piRNA–mRNA and piRNA–lncRNA interactions by integrated analysis of expression and sequence data. Tsinghua Sci Technol. 2018;23 :115-25.
14 Tan L Mai D Zhang B Jiang X Zhang J Bai R , et al . PIWI-interacting RNA-36712 restrains breast cancer progression and chemoresistance by interaction with SEPW1 pseudogene SEPW1P RNA. Molecular Cancer. 2019;18 :9. doi:10.1186/s12943-019-0940-3. 30636640
15 Zorov DB Juhaszova M Sollott SJ . Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiological Reviews. 2014;94 :909-50. doi:10.1152/physrev.00026.2013.
16 Ansari MY Ahmad N Haqqi TM . Oxidative stress and inflammation in osteoarthritis pathogenesis: role of polyphenols. Biomed Pharmacother. 2020;129 :110452. doi:10.1016/j.biopha.2020.110452. 32768946
17 Trachootham D Lu W Ogasawara MA Nilsa RD Huang P . Redox regulation of cell survival. Antioxid Redox Signal. 2008;10 :1343-74. doi:10.1089/ars.2007.1957.
18 Chaney S Vergara R Qiryaqoz Z Suggs K Akkouch A . The involvement of neutrophils in the pathophysiology and treatment of osteoarthritis. Biomedicines. 2022;10 :1604. doi:10.3390/biomedicines10071604. 35884909
19 El-Benna J Hurtado-Nedelec M Marzaioli V Marie JC Gougerot-Pocidalo MA Dang PM . Priming of the neutrophil respiratory burst: role in host defense and inflammation. Immunol Rev. 2016;273 (1 ):180-93. doi:10.1111/imr.12447.
20 Huang X He D Pan Z Luo G Deng J . Reactive-oxygen-species-scavenging nanomaterials for resolving inflammation. Materials today. Bio. 2021;11 :100124. doi:10.1016/j.mtbio.2021.100124.
21 Shen C Gao M Chen H Zhan Y Lan Q Li Z , et al . Reactive oxygen species (ROS)-responsive nanoprobe for bioimaging and targeting therapy of osteoarthritis. J Nanobiotechnol. 2021;19 :395. doi:10.1186/s12951-021-01136-4.
22 Lepetsos P Papavassiliou KA Papavassiliou AG . Redox and NF-kappaB signaling in osteoarthritis. Free Radic Biol Med. 2019;132 :90-100. doi:10.1016/j.freeradbiomed.2018.09.025. 30236789
23 Yi N Mi Y Xu X Li N Chen B Yan K , et al . Nodakenin attenuates cartilage degradation and inflammatory responses in a mice model of knee osteoarthritis by regulating mitochondrial Drp1/ROS/NLRP3 axis. Int Immunopharmacol. 2022;113 (pt A ):109349. doi:10.1016/j.intimp.2022.109349. 36302323
24 Bertram C Hass R . Cellular responses to reactive oxygen species-induced DNA damage and aging. Biol Chem. 2008;389 (3 ):211-20. doi:10.1515/BC.2008.031.
25 Arts IS Gennaris A Collet JF . Reducing systems protecting the bacterial cell envelope from oxidative damage. FEBS Lett. 2015;589 :1559-68. doi:10.1016/j.febslet.2015.04.057.
26 Li D Ni S Miao KS Zhuang C . PI3K/Akt and caspase pathways mediate oxidative stress-induced chondrocyte apoptosis. Cell Stress Chaperones. 2019;24 (1 ):195-202. doi:10.1007/s12192-018-0956-4. 30543056
27 Ding J Karp JE Emadi A . Elevated lactate dehydrogenase (LDH) can be a marker of immune suppression in cancer: interplay between hematologic and solid neoplastic clones and their microenvironments. Cancer Biomark. 2017;19 :353-63. doi:10.3233/CBM-160336.
28 Le A Cooper CR Gouw AM Dinavahi R Maitra A Deck LM , et al . Inhibition of lactate dehydrogenase A induces oxidative stress and inhibits tumor progression. Proc Natl Acad Sci U S A. 2010;107 :2037-42. doi:10.1073/pnas.0914433107.
29 Wu X Ye J Cai W Yang X Zou Q Lin J , et al . LDHA mediated degradation of extracellular matrix is a potential target for the treatment of aortic dissection. Pharmacol Res. 2022;176 :106051. doi:10.1016/j.phrs.2021.106051. 34973467
30 Du P Liao Y Zhao H Zhang J Mu K . ANXA2P2/miR-9/LDHA axis regulates Warburg effect and affects glioblastoma proliferation and apoptosis. Cell Signal. 2020;74 :109718. doi:10.1016/j.cellsig.2020.109718. 32707073
31 Sharma D Singh M Rani R . Role of LDH in tumor glycolysis: regulation of LDHA by small molecules for cancer therapeutics. Semin Cancer Biol. 2022;87 :184-95. doi:10.1016/j.semcancer.2022.11.007.
32 Lin Y Wang Y Li PF . Mutual regulation of lactate dehydrogenase and redox robustness. Front Physiol. 2022;13 :1038421. doi:10.3389/fphys.2022.1038421. 36407005
33 Wu H Wang Y Ying M Jin C Li J Hu X . Lactate dehydrogenases amplify reactive oxygen species in cancer cells in response to oxidative stimuli. Signal Transduct Target Ther. 2021;6 :242. doi:10.1038/s41392-021-00595-3. 34176927
34 Zhang H Li L Chen Q Li M Feng J Sun Y , et al . PGC1beta regulates multiple myeloma tumor growth through LDHA-mediated glycolytic metabolism. Mol Oncol. 2018;12 :1579-95. doi:10.1002/1878-0261.12363.
35 Yu H Yin Y Yi Y Cheng Z Kuang W Li R , et al . Targeting lactate dehydrogenase A (LDHA) exerts antileukemic effects on T-cell acute lymphoblastic leukemia. Cancer Commun (Lond). 2020;40 (10 ):501-17. doi:10.1002/cac2.12080.
36 Arra M Swarnkar G Ke K Otero JE Ying J Duan X , et al . LDHA-mediated ROS generation in chondrocytes is a potential therapeutic target for osteoarthritis. Nat Commun. 2020;11 :3427. doi:10.1038/s41467-020-17242-0. 32647171
37 Tong W Zeng Y Chow DHK Yeung W Xu J Deng Y , et al . Wnt16 attenuates osteoarthritis progression through a PCP/JNK-mTORC1-PTHrP cascade. Ann Rheum Dis. 2019;78 (4 ):551-61. doi:10.1136/annrheumdis-2018-214200.
38 Zhang QY Zhou H Zhou XX Yu FB Liu YY Chen ZY , et al . Small non-coding RNAome changes during human chondrocyte senescence as potential epigenetic targets in age-related osteoarthritis. Genomics. 2023;115 (2 ):110574. doi:10.1016/j.ygeno.2023.110574. 36758878
39 Liu J Chen M Ma L Dang X Du G . piRNA-36741 regulates BMP2-mediated osteoblast differentiation via METTL3 controlled m6A modification. Aging. 2021;13 :23361-75. doi:10.18632/aging.203630.
40 Chen G Wang S Long C Wang Z Chen X Tang W , et al . PiRNA-63049 inhibits bone formation through Wnt/beta-catenin signaling pathway. Int J Biol Sci. 2021;17 :4409-25. doi:10.7150/ijbs.64533.
41 Wang Y Gable T Ma MZ Clark D Zhao J Zhang Y , et al . A piRNA-like small RNA induces chemoresistance to cisplatin-based therapy by inhibiting apoptosis in lung squamous cell carcinoma. Mol Ther Nucleic Acids. 2017;6 :269-78. doi:10.1016/j.omtn.2017.01.003.
42 Liu T Wang J Sun L Li M He X Jiang J , et al . Piwi-interacting RNA-651 promotes cell proliferation and migration and inhibits apoptosis in breast cancer by facilitating DNMT1-mediated PTEN promoter methylation. Cell Cycle. 2021;20 (16 ):1603-16. doi:10.1080/15384101.2021.1956090.
43 Zeng Q Wan H Zhao S Xu H Tang T Oware KA , et al . Role of PIWI-interacting RNAs on cell survival: proliferation, apoptosis, and cycle. IUBMB Life. 2020;72 (9 ):1870-8. doi:10.1002/iub.2332.
44 Tan Y Qin JN Wan HQ Zhao SM Zeng Q Zhang C , et al . PIWI/piRNA-mediated regulation of signaling pathways in cell apoptosis. Eur Rev Med Pharmacol Sci. 2022;26 (16 ):5689-97. doi:10.26355/eurrev_202208_29503.
45 Fu A Jacobs DI Hoffman AE Zheng T Zhu Y . PIWI-interacting RNA 021285 is involved in breast tumorigenesis possibly by remodeling the cancer epigenome. Carcinogenesis. 2015;36 (10 ):1094-102. doi:10.1093/carcin/bgv105.
46 Mow VC Ratcliffe A Poole AR . Cartilage and diarthrodial joints as paradigms for hierarchical materials and structures. Biomaterials. 1992;13 (2 ):67-97. doi:10.1016/0142-9612(92)90001-5. 1550898
47 Takacs-Buia L Iordachel C Efimov N Caloianu M Montreuil J Bratosin D . Pathogenesis of osteoarthritis: chondrocyte replicative senescence or apoptosis? Cytometry B Clin Cytom. 2008;74 :356-62. doi:10.1002/cyto.b.20428.
48 Bertram C Hass R . Matrix metalloproteinase-7 and the 20S proteasome contribute to cellular senescence. Science Signaling. 2008;1 :pt1. doi:10.1126/stke.112pt1.
