
==== Front
Nucleic Acids Res
Nucleic Acids Res
nar
Nucleic Acids Research
0305-1048
1362-4962
Oxford University Press

39126317
10.1093/nar/gkae663
gkae663
AcademicSubjects/SCI00010
Genome Integrity, Repair and Replication
DNA damage-induced phosphorylation of a replicative DNA helicase results in inhibition of DNA replication through attenuation of helicase function
Homiski Caleb Departments of Microbiology & Immunology and Biochemistry, and the Witebsky Center for Microbial Pathogenesis & Immunology, Jacobs School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York at Buffalo, Buffalo, NY 14203, USA

Dey-Rao Rama Departments of Microbiology & Immunology and Biochemistry, and the Witebsky Center for Microbial Pathogenesis & Immunology, Jacobs School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York at Buffalo, Buffalo, NY 14203, USA

Shen Shichen Department of Pharmaceutical Sciences, University at Buffalo, State University of New York at Buffalo, Buffalo, NY 14203, USA; NYS Center of Excellence in Bioinformatics and Life Sciences, University at Buffalo, Buffalo, NY 14203, USA

Qu Jun Department of Pharmaceutical Sciences, University at Buffalo, State University of New York at Buffalo, Buffalo, NY 14203, USA; NYS Center of Excellence in Bioinformatics and Life Sciences, University at Buffalo, Buffalo, NY 14203, USA

https://orcid.org/0000-0003-1558-6262
Melendy Thomas Departments of Microbiology & Immunology and Biochemistry, and the Witebsky Center for Microbial Pathogenesis & Immunology, Jacobs School of Medicine and Biomedical Sciences, University at Buffalo, State University of New York at Buffalo, Buffalo, NY 14203, USA

To whom correspondence should be addressed. Tel: +1 716 829 3789; Email: TMelendy@buffalo.edu
The first two authors should be regarded as Joint First Authors.

23 9 2024
10 8 2024
10 8 2024
52 17 1031110328
18 7 2024
14 6 2024
06 1 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of Nucleic Acids Research.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.com

Abstract

A major function of the DNA damage responses (DDRs) that act during the replicative phase of the cell cycle is to inhibit initiation and elongation of DNA replication. It has been shown that DNA replication of the polyomavirus, SV40, is inhibited and its replication fork is slowed by cellular DDR responses. The inhibition of SV40 DNA replication is associated with enhanced DDR kinase phosphorylation of SV40 Large T-antigen (LT), the viral DNA helicase. Mass spectroscopy was used to identify a novel highly conserved DDR kinase site, T518, on LT. In cell-based assays expression of a phosphomimetic form of LT at T518 (T518D) resulted in dramatically decreased levels of SV40 DNA replication, but LT-dependent transcriptional activation was unaffected. Purified WT and LT T518D were analyzed in vitro. In concordance with the cell-based data, reactions using SV40 LT-T518D, but not T518A, showed dramatic inhibition of SV40 DNA replication. A myriad of LT protein-protein interactions and LT’s biochemical functions were unaffected by the LT T518D mutation; however, LT’s DNA helicase activity was dramatically decreased on long, but not very short, DNA templates. These results suggest that DDR phosphorylation at T518 inhibits SV40 DNA replication by suppressing LT helicase activity.

Graphical Abstract

Graphical Abstract

National Institutes of Health 10.13039/100000002 AI16408101 AI095632 National Institutes of Health Training Grant in Microbial Pathogenesis T32 AI007614
==== Body
pmcIntroduction

Cellular DNA damage response (DDR) pathways play important roles in genome maintenance, including upregulating DNA repair pathways and inhibiting DNA replication so as not to exacerbate damage to the DNA during genome duplication (1–4). While many studies on DDR inhibition of DNA replication have focused on the inhibition of replication origin firing, it has also been shown that there is a nearly 10-fold decrease in replication fork elongation rate following activation of DDR in systems as diverse as yeast to human cells (5–7), as well as fork remodeling that allows for reversal of replication forks (8). Slowing of replication fork progression has been shown to be dependent on the apical DDR kinases, ATM, ATR and DNA-PK, and works on forks distal to the sites of damage (Figure 1) (9–12). Recently one mechanism of replication fork slowing has been shown to be due to increased replication fork reversal (9); however, there have been some indications that modification of DNA replication fork proteins may also participate in replication fork slowing (13–17).

Figure 1. DNA damage inhibits both firing of origins and progression of existing replication forks in trans. DNA damage at distal sites, or even on separate DNA molecules (dark lines), can activate cellular DDR pathways (dashed gray lines) which can then inhibit the firing of late or subsequent DNA origins. DDR activation can also act to slow the progression of existing DNA replication forks by as much as 90%, even at replication forks that do not encounter DNA lesions. Both processes serve to slow DNA replication presumably to allow cellular DNA repair pathways opportunity to resolve the DNA damage prior to forks arriving at DNA lesions.

SV40 is a member of the polyomaviruses (PyVs), a family of non-enveloped viruses that have small circular double-stranded DNA (dsDNA) genomes, a single origin of replication (ori), and rely predominantly on the host cell DNA replication machinery to duplicate their genomes (18–20). SV40 has been used as a model system to investigate many human cellular processes, including the function and mechanism of several DNA replication factors (18–20). SV40 Large Tumor Antigen (LT) is the only viral protein required for replication of the SV40 genome. LT binds to the SV40 origin of replication (ori) and forms a double hexameric DNA helicase to initiate bidirectional replication from the ori (18–20). The LT hexamers directly recruit host DNA replication factors including Replication Protein A (RPA), Topoisomerase I (TopoI), and Polymerase-α/Primase (Pol-Prim) to initiate synthesis of RNA/DNA primers (21–23). Replication Factor C (RFC), Proliferation Cell Nuclear Antigen (PCNA), DNA polymerase delta, primer processing enzymes, and DNA Ligase I are recruited through interactions with the nucleic acid structures synthesized by LT/Pol-Prim/RPA/TopoI to synthesize the majority of the genome, remove RNA primers, and generate the covalently closed replicated episomes (23–28).

In addition to SV40 utilizing cellular DNA replication proteins, SV40 also recruits and utilizes many cellular DNA repair factors/pathways, including: Msh2, Msh3, Mlh1, Rad52, FancD1, Parp1 and many others (29–34). Much like cellular DNA replication, SV40 DNA replication is dramatically inhibited following treatment of cells with various types of DNA damaging agents (35), allowing additional time for DNA repair to occur. This PyV replication checkpoint response is dependent on cellular DDR pathways. This inhibition can be observed on replicating SV40 DNA in living cells, as well as through decreased viral DNA replication in extracts from cells that had been subjected to DNA damage prior to preparation of cell extracts (13,14,36–45). Like inhibition of cellular DNA replication upon DDR, inhibition of SV40 DNA replication occurs through the action of trans-acting factors (12,14,17,18) at both the initiation (14,17) and elongation (11,12,46) stages of replication (Figure 1). This makes SV40 a valuable model system for investigating the mechanisms of human DDR and DNA replication checkpoints. Treatment of SV40 LT-expressing HEK293T cells with etoposide (ETO), a chemotherapeutic agent that inhibits cellular topoisomerase II and causes dsDNA breaks (DSBs), leads to dramatic inhibition of SV40 DNA replication through trans-acting mechanisms, and increased phosphorylation of LT by human ATR, ATM or DNA-PK kinases (DDR kinases) on one or more SQ/TQ sites (13). Conversely, viral DNA replication and helicase phosphorylation of a very similar viral DNA replication system, HPV16, which relies on many of the same host DNA replication proteins as SV40 (47,48), were both unaffected by ETO treatment (13). These findings suggested that DDR kinase phosphorylation of LT could play a unique role in the inhibition of SV40 DNA replication, and as various SV40 LT functions in viral DNA replication have previously been shown to be affected by phosphorylation (33,34,40,49–52), it was reasonable to speculate that DDR kinase phosphorylation might be mediating DDR-dependent slowing of viral replication. The apical regulatory kinases of cellular DDR pathways directly phosphorylate hundreds of effector proteins, preferentially on SQ or TQ amino acid (aa) motifs, to facilitate maintenance of genome integrity following DNA damage (53,54). ATM and ATR are also known to directly phosphorylate components of host DNA replication machinery, including the human replicative helicase proteins, MCM2-7, which play roles in cellular replication analogous to those of LT in SV40 DNA replication (55–58). It is known that various CMG DNA replication fork components can be phosphorylated by other checkpoint kinases (15,16), and it has even been shown that the S. cerevisiae ATR homolog, Rad53, can slow DNA unwinding at replication forks (59). However, the precise targets of these DDR-dependent phosphorylation events and the effects on the functions of the cellular replication proteins remain largely un-elucidated. Investigation of the effect of DDR kinase phosphorylation of PyV LT on viral DNA replication may provide insights into how DDR kinase phosphorylation of the MCM or other CMG helicase proteins might affect DNA replication fork function in host cell DNA replication during DDR-dependent fork slowing.

LT samples immunoprecipitated from LT-expressing human cells, both treated with ETO as well as mock-treated, were analyzed using tandem mass spectrometry (MS) to identify sites of LT phosphorylation. One of the SQ/TQ phosphorylation sites on LT occurred within its DNA helicase domain at threonine 518 (T518). Alignment of sixteen mammalian PyV LT aa sequences showed SV40 LT T518 to be highly conserved, being a TQ or SQ on all LT sequences aligned. We evaluated the DNA replication functions of phospho-T518 LT using a phosphomimetic aspartic acid mutant, T518D, in both cell-based and in vitro analyses. The vast majority of LT functions evaluated remain unaffected by this phosphomimetic mutation. However, the T518D phosphomimetic mutation dramatically inhibited the DNA helicase activity of LT, which would explain how DNA replication forks can be slowed following DDR.

Materials and methods

Plasmids, mutagenesis, DNA substrates

WT LT-encoding baculovirus transfer vector p941-WT was a gift from Dr Dan Simmons (University of Delaware). Mutant LT T518D-encoding transfer vector p941-T518D was created by site-directed mutagenesis using the primers: 5′-GAAACACCTAAATAAAAGAGATCAAATATTTCCCCCTGGAATAGTCACC-3′ and 5′-GGTGACTATTCCAGGGGGAAATATTTGATCTCTTTTATTTAGGTGTTTC-3′ (Integrated DNA Technologies) and verified by DNA sequencing. An aspartic acid was used instead of a glutamic acid as the phosphomimetic residue for threonine because many LTs in our alignment (Figure 2F) showed a serine at this site rather than a threonine, so we surmised that the charge change upon phosphorylation was the more important aspect than the side chain length, and using a slightly shorter side-chain length would be less likely to create unanticipated steric issues due to the differences in bond angles between the atoms of the glutamic acid and phospho-threonine side chains.

Figure 2. DDR-induced SQ/TQ phosphorylation sites on SV40 LT include the highly conserved T518. (A) Extracts from etoposide (ETO) treated or mock-treated HEK293T cells were subjected to immunoprecipitation of SV40 LT using monoclonal antibody Ab 419. SDS-PAGE was performed and immunoblotted with antibodies against LT (Ab 101) and a commercial antibody enriched for recognition of phospho- serine-glutamine and threonine-glutamine residues (anti-pSQ/TQ) as described in Methods. (B) Immunoblot with anti-pSQ/TQ of extracts of mock and ETO-treated HEK293T cells, both prior and after LT immuno-depletion (lanes 1 and 2, 3 and 4), and of LT immunoprecipitations (as in panel A) (lanes 5 and 6). (C) Immunoblot with anti-LT (Ab 101) of the same sample as panel B lane 6, to verify SDS-PAGE migration of LT (note only the LT area of the gel is shown due to signal from the heavy and light chains of the antibody used in the IP). (D) protein stain (silver stain) of the samples in panel B lane 5 (lanes 1 & 2), and panel B lane 6 (lanes 3 & 4), which were excised from the gel for phospho-MS analysis. The un-labeled lane on the left shows the commercial molecular weight markers (indicated to the left of panel B). (E) A schematic of the 708aa SV40 LT sequence indicating the three major domains of LT (in red) and all SQ and TQ di-peptide sequences, the preferred DDR-induced ATM/ATR/DNA-PK substrate, that exist in the SV40 LT protein sequence. (F) LT aa sequences from 12 human polyomaviruses (SV40, BKPyV, JCPyV, KIPyV, MWPyV, NJPyV, STLPyV, WUPyV, TSPyV, HPyV6, HPyV7 and HPyV10), bovine polyomavirus (BPyV), hamster polyomavirus (HaPyV), murine polyomavirus (MPyV), and murine pneumotropic virus (MPtV) (indicated on the left) that surround the T518 aa residue of SV40 LT (top line). The highly conserved SQ/TQ di-peptide sequence is boxed in red, identical residues are indicated by the asterisk and conserved residues are indicated by a colon. (G) One example of the dozens of MS/MS spectra demonstrating phosphorylated T518. This spectrum (Xcorr = 1.76), of the peptide shown produces ions generated from the HCD fragmentation of the peptide backbone as shown. Notably, both b4 and b13 ions with neutral loss of the phosphate group have been detected (highlighted), indicating with high probability that the phosphorylated residue on this peptide is T518.

pSV011 contains an SV40 origin fragment (nucleotides 5171–128) in pUC18 (60). pSV011(–) is the same SV40 origin plasmid with a 4nt deletion in LT binding site II (SV40 nt 5239–5242), rendering this plasmid deficient for DNA replication (61).

SV40 origin-containing Firefly luciferase plasmid (pFLORI40) and pCMV expression vector for WT SV40 LT (pCMV-sWT) as well as a Renilla luciferase plasmid (pRL)) were gifts from Dr. Amelie Fradet-Turcotte (University of Laval) and Jacques Archambault (McGill University) (62). The JC virus PyV (JCPyV) origin-containing Firefly luciferase plasmid (pFLORIjc) and pCMV expression vector for WT JCPyV LT (pCMV-jWT) were also provided as gifts from Dr. Jacques Archambault (McGill University) and Dr. Peter Bullock (Tufts University) (63).

Mutant pCMV-sT518D was created by site directed mutagenesis with a pCMV-sWT template using the same primers used to generate p941-T518D. Mutant SV40 and JCPyV pCMV plasmids were created using site directed mutagenesis with respective WT plasmids for templates using the following primer pairs: pCMV-sT518A (5′-GAAACACCTAAATAAAAGAGCTCAAATAATTCCCCCTGGAATAGTCACC-3′ and 5′-GGTGACTATTCCAGGGGGAAATATTTGAGCTCTTTTATTTAGGTGTTTC-3′), pCMV-jT519D (5′-CCAAAACAAAAGAGATCAGGTGTTTCCACC-3′ and 5′-GGTGGAAACACCTGATCTCTTTTGTTTTGG-3′. All mutations were verified by DNA sequencing.

pRLSV40-Late was created as follows: the region of pSV010(-) (pUC18 containing the entire SV40 genome with a 4nt deletion at SV40 genome positions 5239–5242 in LT binding site II, rendering this plasmid inactive for SV40 DNA replication) corresponding to SV40 origin and promoter sequences nt 5097–272 was amplified using the following primers: 5′-TCACATGGCTCGACACCTTTCAAGACCTAGAAGGTCCATTAGCTG-3′ and 5′-GCACTGACTGCGTTACTGTGGAATGTGTGTCAGTTAGGGTGTGG-3′ (61,64). Site directed mutagenesis was then used to generate an NsiI restriction site at the 3′ end of the CMV promoter sequence of pRL using the following primer pair: 5′-GGTAGTTTATCACAGTTAAATGCATAACGCAGTCAGTGCTTCTG-3′ and 5′-CAGAAGCACTGACTGCGTTATGCATTTAACTGTGATAAACTACC-3′. This clone was digested with NsiI and BglII to remove the CMV promoter sequence and was combined with the pSV010(-) SV40 promoter fragment using the Infusion® HD Cloning kit (Clontech) such that the pSV010(–) late promoter sequence was cloned upstream of an intron (comprised of the 5′-region of a β-globin gene and 3′-region of an intron upstream of a heavy chain immunoglobulin gene included to promote splicing efficiency) and the Renilla luciferase gene both present in pRL (https://www.promega.com/-/media/files/resources/protocols/technical-bulletins/101/prl-renilla-luciferase-reporter-vectors-protocol.pdf). Clones were verified by DNA sequencing. Map of pRLSV40-Late generated by the Scalable Vector Graphics Plasmid Map tool found at Bioinformatics.org/savvy/.

γP32ATP-labelled 100mer helicase substrate was created as follows: 0.05 nanomoles of helicase substrate top strand (5′-AGTCAGAGACCCATAGAGACACACTTGCACAGTAACGCTTAGTCTCGTCAGATAGCAAGCCCAATAGGAACCCATGTACCGTAACACTGAGTTTCGTCACTTTTTTTTTTTTTTTTTTTT-3′) were labelled with γP32ATP using T4 Polynucleotide Kinase according to the manufacturer's protocol (Fermentas). End-labelled top strand was mixed with equimolar amount of bottom strand (5′-CCCCCCCCGTGACGAAACTCAGTGTTACGGTACATGGGTTCCTATTGGGCTTGCTATCTGACGAGACTAAGCGTTACTGTGCAAGTGTGTCTCTATGGGTCTCTGACT-3′), placed at 95°C for 5 min, and the heating block was removed to room temperature to allow substrate to anneal slowly overnight. This creates a substrate with a 21nt unpaired polyT 3′ tail on the labeled strand and an 8nt unpaired polyC 5′ tail on the unlabeled strand. End-labelled, annealed substrate was purified with illustra ProbeQuant G-50 Micro Column (GE Healthcare). γ32P ATP-labelled 17mer helicase substrate was created by end labelling 0.05 nanomoles of a short oligo (5′-GTAAAACGACGGCCAGT-3′) with γP32ATP using T4 Polynucleotide Kinase according to the manufacturer's protocol (Fermentas). End-labelled oligo was then mixed with equimolar amount of unlabeled, circular M13mp18 ssDNA (NEB), placed at 95°C for 5 min, and the heat block was removed to room temperature to allow substrate to anneal slowly overnight. End-labelled, annealed substrate was purified with illustra ProbeQuant G-50 Micro Column (GE Healthcare).

Poly dA/oligo dT substrate for Pol-Prim stimulation assays was created by mixing 100 nmol of poly [dA] (average length 250–500nt) (Roche) with 5 nmol of oligo [dT] (average length 18nt) (Roche) in TE (10 mM Tris–HCl pH 8, 1 mM EDTA) with 100mM NaCl in a 50 μl volume. Mixture was placed at 95°C for 5 min and the heat block was removed to room temperature to allow substrate to anneal slowly overnight.

Cell culture

C33a, HEK293 and HEK293T cells were grown at 37°C with 5% CO2 in Dulbecco's modified Eagle's medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (Atlanta Biologicals) and 1% penicillin-streptomycin (Gibco). Sf9 insect cells were grown at 27°C in Grace's Insect Cell Culture Medium (Gibco) supplemented with 4.175 mM sodium bicarbonate, 10% fetal bovine serum, and 1% penicillin-streptomycin. High Five insect cells were grown at 27°C in Express Five Serum Fee Media supplemented with 16 mM l-glutamine (Gibco) and 1% penicillin–streptomycin.

Immuno-blots

One million C33a cells in a 10cm tissue culture dish were transfected with 1 μg of pCMV-LT expression vectors for SV40 (WT, T518A, T518D) or JCPyV (WT, T519D) were lysed in 500 μl of 1% Triton X-100 in PBS 48 h post transfection. Lysate protein concentrations were normalized using a bicinchoninic acid BCA assay (Thermo Fisher) and run on 12.5% SDS-PAGE gels in sample buffer (50mM Tris–HCl pH 6.8, 100mM DTT, 2% SDS, 0.1% bromophenol blue, 10% glycerol) for 1.5 h at 180 V. Gels were transferred to a nitrocellulose membrane (GE) using a Novablot semi-dry transfer apparatus (Pharmacia Biotech) at 50 mA for 1 h in transfer buffer (25 mM Tris–HCl, 190 mM glycine, 0.1% SDS, 20% methanol). Membranes were blocked for 1 h at room temperature with 5% milk in TBST (50 mM Tris–HCl, 150 mM NaCl, 0.1% Triton-X100), washed 3 × 5 min with TBST and placed in Ab101 (for SV40 LT, produced in house from pAB101 hybridoma cell culture and purified on protein A Sepharose (GE)) or Ab416 (for JCPyV LT, EMD Millipore) primary antibody diluted to 0.2 μg/ml in TBST for 4h at RT. Membranes were washed 3 × 5 min with TBST and placed in HrP-linked rabbit anti-mouse secondary antibody (Abcam) (Ab diluted to 0.5 μg/ml in TBST for 2 h at RT). Membranes were washed 3 × 5 min with TBST and developed using chemiluminescent substrate (Thermo Scientific SuperSignal West) and imaged using a BioRad Chemidoc.

Computational prediction of phosphorylation sites on LT

NetPhos 3.1 Server was used to predict Ser, Thr, Tyr phosphorylation sites in the SV40 LT protein (65). The server uses the consensus phosphorylation sites of 17 protein kinases, including ATM (but not ATR), upon which the predictions are based. Similarities between the consensus sequences between ATM and ATR make ATM a reasonable exemplar for ATR.

Immunoprecipitation of LT and mass spectrometry (MS)

HEK293T cells were grown to 70–90% confluence in complete DMEM with 10% FBS as described above. Cells were treated with 50 μM etoposide solution (Calbiochem) in DMSO (ETO) or only DMSO (Mock) for 2 h at 37°C. Cell lysates were prepared using NP40 lysis buffer (ThermoFisher) containing 1% NP40, 250 mM NaCl, 50 mM Tris–Cl (pH 7.4) with protease and phosphatase inhibitors (Thermo Fisher #78440, 78420, Sigma # 45-P5726, 45-P0044), on ice, subjected to centrifugation in a microfuge for 15 min at 4°C at 15.9 K rcf. Protein levels were standardized using BCA assay (Thermo Fisher), flash frozen in liquid nitrogen and stored at –80°C. A 50 μl slurry of Dynabeads Protein G (Invitrogen, Carlsbad, CA) was used to immunoprecipitate LT using monoclonal Ab419 from ∼500 μl ETO and DMSO extracts (1.3 mg/ml protein concentration). The proteins were eluted from the beads using NuPAGE LDS reducing sample buffer (ThermoFisher), boiled, resolved on 4–20% Novex Tris-glycine gels (ThermoFisher), and used for immuno-blotting (via iBlot 2 gel transfer using transfer template program P0) following standard procedures detailed above. Primary antibodies used were Ab101 (against large T-antigen) and Phospho-(Ser-Glu/Thr-Glu) ATM/ATR substrate antibody (pSQ/TQ) (Cell signaling Technology # 2851). ImageJ (NIH) was used to quantify protein bands.

LT-specific monoclonal antibody (100 ug of either Ab101 or Ab419 as designated, produced from hybridoma cell line supernatants and purified using protein A Sepharose) were bound to 5mg of M-280 Tosylactivated Dynabeads (Invitrogen # 14203) O/N at 37°C on a rotating wheel, washed in PBS and prepared according to manufacturer's instructions. Subsequent binding reactions were assembled with 1mg beads in PBS mixed with 1.3mg mock or ETO-treated extracts at 3.0 mg/ml final concentration for 4 h at 4°C with tumbling. Beads were washed with PBS three times and eluted with 0.2% formic acid 4× at RT. The elution was flash frozen in liquid N2 and dried in a speed-vac. Other immuno-precipitations were boiled in reducing SDS loading buffer at 95°C for 5 min, the bound proteins resolved using 4–20% Novex Tris-glycine gels, and silver-stained with MS-compatible Pierce Silver Stain for Mass Spectrometry (Thermo Scientific # 24600). The LT protein bands were excised from the gel, destained, and partially dried in 25 mM ammonium bicarbonate in 50% acetonitrile. Trypsin digestions of both the solvent-elution and destained gel slices were used for mass spectrometric analysis at the Proteomics and Bioanalysis Core (PBC) Facility, New York State Center of Excellence in Bioinformatics and Life Sciences (NYS CoEBLS), Buffalo, NY.

Liquid chromatography–mass spectrometry (LC–MS) was carried out on a Dionex Ultimate 3000 nano LC system, a Dionex Ultimate 3000 gradient micro-LC system with an WPS-3000 autosampler, and an Orbitrap Fusion Lumos mass spectrometer (ThermoFisher Scientific, San Jose, CA). (MS method details are included in the legend to Supplementary Figure S2 and in (30).) Data Analysis: LC–MS raw files were searched by Sequent HT (embedded in Proteome Discoverer v1.4.1.14, Thermo Scientific) against SV40 LT sequence. The search parameters included (i) precursor ion mass tolerance: 20 ppm; (ii) fragment ion mass tolerance: 0.02 Da (OT)/0.8 Da (IT); (iii) maximal missed cleavages: 2; (iv) fixed modification: cysteine carbamidomethylation; (v) dynamic modification: methionine oxidation, peptide N-terminal acetylation (spontaneously occurring protein modifications, labeled as A in the protein PTM map; serine/threonine/tyrosine (S/T/Y) phosphorylation (labeled as P in the protein PTM map); (6) maximal modifications per peptide: 4. The acetylation of free amine groups is on any aa, including Lys (K) and Arg (R) termini and occur spontaneously during experimental steps and may not be biologically meaningful unless validated. Abbreviations: P = phosphorylated residues, A = acetylated residues. LT sequence coverage and peptide list was exported from Proteome Discoverer.

Dual luciferase, cell-based transient viral DNA replication assays

SV40 and JCPyV cell-based DNA replication assays were performed as previously detailed (62,63). C33a cells were plated at a density of 25 000 cells/well in white, flat bottom, 96-well plates (Corning) 20 h prior to transfection. The transfection mixture for each well contained 100 μl Opti-MEM (Gibco), 0.2 μl lipofectamine (Invitrogen), 2.5 ng of corresponding SV40 or JCPyV-origin containing Firefly Luciferase plasmid (pFLORI40 or pFLORIjc), 0.5 ng of Renilla Luciferase plasmid lacking a viral origin (pRL) and increasing amounts of pCMV WT or mutant LT expression plasmid for SV40 or JCPyV. Transfection mixtures were replaced with fresh culture media 4h post-transfection. 72 h post-transfection, Firefly and Renilla luciferase levels in cells were measured sequentially according to the Dual-Glo Luciferase assay protocol (Promega).

Cell-based SV40 transcription activation assay

C33a cells were plated at a density of 25 000 cells/well in white, flat bottom, 96-well plates 20 h prior to transfection. Increasing amounts of pCMV-sWT or pCMV-sT518D were co-transfected into cells with 10ng plasmid pRLSV40-Late. 72 h post transfection, Renilla luciferase levels were measured according to the Dual-Glo Luciferase assay protocol (Promega).

Baculoviruses

p941-WT (a kind gift from Dr Dan Simmons, University of Delaware) and p941T518D transfer vectors were combined with Sapphire Baculovirus DNA in sf9 insect cells according to the kit protocol (Allele Biotechnology) to generate WT LT and LT T518D-encoding baculoviruses, which were then further amplified according to the kit protocol.

Infection, expression and purification of WT and LT T518D

Protocol adapted from Dr Dan Simmons (66): T150 flasks with High Five insect cells at 90% confluency were infected with either WT LT or LT T518D baculoviruses at an MOI of three for 48 h at 27°C. Infection media was removed by aspiration and 10 ml of wash buffer TD (25 mM Tris–HCl, 136 mM NaCl, 5.7 mM KCl, 0.7 mM Na2HPO4, pH 7.4) was added to each flask, followed by cell scraping. Cells were pelleted in buffer TD at 570 RCF for 10 min at 4°C in a Beckman Coulter JS-4.2 rotor. Buffer TD was removed, and cells were lysed on ice for 30 min in 5ml Buffer B (150 mM Tris–HCl, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP40, 1 mM PMSF, pH 8) per flask of cells. Lysates were centrifuged at 17,500 RCF for 20 min at 4°C in a Beckman Coulter JA-20 rotor. Supernatants were incubated with 1 ml of Protein A Sepharose (GE) saturated with and cross-linked to anti-LT antibody pAb101, for 2 h on a shaker at 4°C. Beads were centrifuged for 2 min at 600 RCF at room temperature and the supernatant was removed. Beads were washed 5 times in 10 ml buffer C (50 mM Tris–HCl, 500 mM LiCl2, 1 mM EDTA, 10% glycerol, pH 8) followed by five washes in buffer D (10mM PIPES, 5mM NaCl, 1mM EDTA, 10% glycerol, pH 7.4). Beads were transferred to a small column at 4°C in buffer D. LT was eluted from beads 5 times with 0.5 ml buffer E (20 mM triethylamine, 10% glycerol, pH 10.8). Protein-containing fractions were pooled and dialyzed against buffer F (10 mM PIPES, 5 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 10% glycerol, pH 7) for 16 h at 4°C. Infection of 25 T150 flasks yields approximately 1 mg of purified LT.

In vitro SV40 DNA replication assays

SV40 in vitro DNA replication assays were performed as previously detailed (13). 60 ng of SV40-origin template pSV011 (or pSV011(–), a template with a 4nt deletion that renders the SV40 origin non-functional) was incubated with increasing amounts of purified WT or T518D SV40 LT, in replication buffer (30 mM Tris–HCl pH7.5, 40 mM creatine phosphate, 7 mM MgCl2, 4 mM ATP, 200 μM CTP, 200 μM GTP, 200 μM UTP, 100 μM dCTP, 100 μM dGTP, 100 μM dTTP, 25 μM dATP, 0.5 M DTT), 0.1 mg/ml acetylated BSA, 1 μCi αP32dATP and 40 ug of HEK293 cyto/nucleosolic extract in 10 μl volume. Reactions were incubated at 37°C for 90 min and terminated by addition of 10μl stop buffer (20 mM Tris–HCl pH 7.5, 10 mM EDTA, 0.1% SDS, 1 μg/μl proteinase K) for 20 min at 37°C. Reactions were quantified by spotting on DE81 filter paper (Whatman), washing away the unincorporated nucleotides with 0.5 M NH4PO4, and scintillation counting. DNA products were extracted using phenol:chloroform, precipitated using ammonium acetate and ethanol, and resolved on 0.8% agarose, Tris/borate/EDTA gels. Gels were fixed for 10 min in 15% methanol/15% acetic acid, rinsed in ddH2O, dried, and analyzed by phosphorimager autoradiography using a Molecular Dynamics Typhoon system.

Purification of human Topoisomerase I, RPA and Pol-Prim

Full length human Topoisomerase I (Topo I) was purified from extracts of baculovirus-infected Hi-5 cells using Mono Q, Mono S, and POROS columns as described previously (67). Full-length recombinant human RPA was expressed in Escherichia coli and purified as described previously (68). Human Pol-Prim was purified from human 293 cell extracts using immuno-affinity chromatography using an anti-Pol-Prim antibody mAB1645 Sepharose column as described previously (69).

Enzyme linked immunosorbent assays (ELISAs)

For RPA and TopoI: Dilutions of RPA or TopoI were prepared in 50 μl TBS (25mM Tris–HCl pH 7.5, 150 mM NaCl) were immobilized in each experimental well of vinyl, 96-well ELISA plate (GIBCO) by rocking for 1 h at RT. Wells were washed 3× with TBST (TBS with 0.1% Triton X100), blocked with 200 μl TBST + 1% dry milk/1% BSA for 1 h at RT with rocking, and washed three more times with TBST. Dilutions of increasing amounts of WT or LT T518D were prepared in 50 μl TBS, added to the appropriate wells, and incubated for 1 h at RT with rocking. For block controls, the highest amount of WT LT was added to blocked wells to determine non-specific interaction background. All wells were washed 3× with TBST. 50 μl of SV40 LT pAb101 primary antibody, diluted to 0.2 μg/ml in TBST, was added to each well and incubated at RT for 1 h with rocking. Wells were washed 3× with TBST. 50 μl of horseradish peroxidase (HrP)-linked anti-mouse secondary antibody, diluted 1:5000 in TBST, was added to each well followed by incubation for 1 h at RT with rocking. Wells were washed 7× with TBST, followed by 3× with TBS. Wells were incubated with 50 μl HrP substrate solution (for 1ml of fresh solution, combine 100 μl 1.1 M sodium acetate pH5.5, 16.7 μl of 25 mM 33′55’tetramethylbenzidine, 0.3 μl 30% H2O2 and 883μl ddH2O) for 10 min at RT. 50 μl of stop solution (2 M sulfuric acid) was added to each well and plate was read on microplate reader at absorbance 450.

For Pol-Prim: protein incubation order was reversed; 50 ng of either WT or T518D was immobilized as first protein, dilutions containing increasing amounts of Pol-Prim were added as second protein, primary antibody was 0.2 μg/ml anti-Pol-Prim pAB1645 (produced from pAB1645 hybridoma cell culture), and secondary antibody was 0.2 μg/ml HrP-linked rabbit anti-mouse antibody (Abcam). Wash and development steps were the same as for the RPA and TopoI ELISAs. The highest amount of Pol-Prim was added to blocked wells to determine non-specific background.

Poly dA/oligo dT Pol-Prim stimulation assays

Increasing amounts of purified WT or LT T518D was incubated with 50 ng purified Pol-Prim, 1 μCi αP32dTTP, reaction buffer (40 mM Tris–HCl pH 6.9, 6 mM MgCl2, 40 μM dTTP, 10% glycerol, 1 mM DTT, 40 μg/ml BSA) and 0.04 nmol of poly[dA]/oligo[dT] substrate in 10 μl reactions for 45 min at 37°C. Reactions were terminated by addition of 10 μl stop buffer (0.5M NaOH, 7 mM EDTA, 4% Ficoll) and 2 μl 0.2% Bromophenol Blue. Reactions were quantified by spotting on DE81 filter paper (Whatman), washing away unincorporated nucleotides with NH4PO4, followed by scintillation counting. DNA replication products were resolved on agarose gels poured at 1% agarose/1mM EDTA/30 mM NaCl (first equilibrated in alkaline-denaturing buffer for 2 h) and run in alkaline-denaturing buffer (50 mM NaOH, 1 mM EDTA) at 6 V/cm for 4h at RT. Gels were fixed for 10 min in 2 volumes 15% methanol/15% acetic acid, rinsed in ddH2O, dried and analyzed using a Molecular Dynamics Typhoon system.

ATPase assays

250 ng purified WT or LT T518D was combined with 1 μCi γP32ATP in reaction buffer (30 mM Tris–HCl pH 7.8, 7 mM MgCl2, 0.1 mM ATP pH 7.5 and 0.5 mM DTT) in 10 μl. Time course reactions were carried out at 37°C as indicated. Increasing amounts of poly(dT) (average length 221 bp) (Bioline) or additional unlabeled ATP (NEB) were added to each reaction as indicated. Poly(dT) and cold ATP titration reactions were incubated at 37°C for 30 min. All ATPase reactions were stopped by addition of 0.5 μl of 0.5 M EDTA. 1 μl of each reaction was spotted 2 cm from the bottom of a thin layer polyethyleneimine chromatography (TLC) plate (Sigma Aldrich). TLC plate was developed in 0.5 M LiCl2/1M formic acid until buffer front was 2 cm from top of plate. TLC plates were dried and analyzed using a Molecular Dynamics Typhoon system. Density of spots containing γPO43- hydrolyzed during the ATPase reactions were quantified using ImageJ software.

DNA helicase assays

250ng purified WT or LT T518D was incubated with 50 fmol of γP32ATP-labelled 17mer or 100mer helicase substrate and reaction buffer (30 mM HEPES pH 7.5, 7 mM MgCl2, 0.5 mM DTT, 4 mM ATP, 0.1 mg/ml BSA) in 10 μl volumes at different points over a time course. Reactions were terminated by addition of 3 μl of stop buffer (5% SDS, 50 mM EDTA, 0.5 mg/ml proteinase K, 12.5% glycerol, 0.25% bromophenol blue) at 37°C for 10 min. 10μl of each reaction was loaded on a 12% native TBE PAGE gel and run at 100 V for 1.5 h (until dye front reaches bottom of the gel). Gel was fixed in 15% methanol/15% acetic acid, rinsed in ddH2O, dried, and analyzed by phosphorimager autoradiography using a Molecular Dynamics Typhoon system. Images were quantified with ImageJ software.

Results

Identification of novel SQ/TQ phosphorylation sites on SV40 large T-antigen (LT)

Phosphorylation is known to modulate various functions of many DNA replication factors including SV40 LT. With regard to SV40 DNA replication, phosphorylation of threonine 124 (T124) on LT by the cell-cycle kinases, cdc2 or cdk2, is known to be important for LT’s binding to SV40 ori and assembly into a helicase (49–52); indeed this is a likely target for inhibition of the initiation of SV40 DNA replication through the well-established pathway from ATR to Chk1 to Cdc25 that inhibits cdc2/cdk2 activity (1,2,39,42,70). Phosphorylation of residues S106, S123, S639, S677, S679 and T701 have been observed, but appear to have little effect on LT’s DNA replication function (52); phosphorylation of S111/112 by CK2 or S120 by ATM have been shown to have some positive effect on SV40 DNA replication by increasing the efficiency of the adjacent LT nuclear localization sequence (NLS) (71–73). Since we previously showed DDR-enhanced phosphorylation of SQ/TQ residues on LT are associated with inhibition of SV40 DNA replication function (13) while the only previously demonstrated effects of SQ/TQ phosphorylation of LT were shown to have positive effects on SV40 DNA replication (71–73), we hypothesized that a hitherto unidentified DDR SQ/TQ phosphorylation site on LT might be mediating the DDR-inhibition of SV40 DNA replication. The SV40 LT protein sequence was submitted to NetPhos 3.1a which predicts the likelihood of in vivo aa residue phosphorylation by a large panel of well-studied human protein kinases based on aa sequence and protein structure (65). The results from the NetPhos prediction are shown in Supplementary Figure S1A with the S and T residues within SQ/TQ motifs clearly identified (Supplementary Figure S1B). Note that all S and T residues within SQ/TQ motifs clearly identified (S120, T518, S639, S665, S667 and S677) in the six conserved SQ/TQ sites (residues S120, T518, S639, S665, S667 and S677) fall above the NetPhos Phosphorylation threshold Score of 0.500, indicating that all six are predicted likely to be phosphorylated in vivo (Supplementary Figure S1A asterisks).

Of the six SQ/TQ sites on LT that are all predicted by NetPhos to be phosphorylated, to date only three, S120, S639 and S677, have been demonstrated to be phosphorylated (40,52). To test the NetPhos prediction that all six SQ/TQ sites are phosphorylated in vivo we utilized a highly sensitive liquid chromatography–tandem mass spectroscopy (LC–MS/MS) approach to map phosphorylation sites on SV40 LT immunoprecipitated (IPed) from HEK293T cells. Because of the previously reported enhancement of LT SQ/TQ sites following DNA damage, LT was IPed from both mock- and etoposide (ETO)-treated HEK293T cells and immunoblotted using a commercial phospho-SQ/TQ preferential antibody (pSQ/TQ). Our results showed that slightly higher levels of LT were IPed from mock-treated cells, but that LT IPed from ETO-treated cells show ∼2× (as per Figure 2A quantified using ImageJ) higher levels of signal with the pSQ/TQ antibody normalized for the LT signal (Figure 2A). These results were consistent with the antibody specifications that show substantial pSQ/TQ signal in normal cycling cells with enhanced reactivity following DDR. Figure 2B shows this enhancement of pSQ/TQ detection of global proteins in crude HEK293T extracts from treated cells (mock versus ETO, lanes 1 versus 3). Detection of the IPed LT using both anti pSQ/TQ and anti-LT antibodies is shown (Figure 2B, C). These results confirm the previously published DDR-enhanced SQ/TQ phosphorylation of LT (13). (Note that LT-associated proteins can be observed both by silver staining and pSQ/TQ immunoblotting, showing that some LT-associated proteins are SQ/TQ phosphorylated (Figures 2B and D)). Tandem MS (MS2) was used to evaluate LT samples from both mock- and ETO-treated HEK293T cells. LT was isolated by IP and subjected to trypsin digestion from either solvent (0.2% formic acid)-eluted IP pellets, or following SDS-PAGE and gel isolation. These analyses provided high coverage of the LT protein in all three samples analyzed (88.1% for OT, 91.4% for IT) with the identification of many phosphorylated S/T/Y residues. Shown here are the identified pSQ/TQ sites identified on LT (Supplementary Figure S2). One example of a MS2 spectrum of one phospho-peptide is shown (Figure 2G), demonstrating phosphorylation of the LT T518 aa residue. Similar MS analyses of peptides from both IPed and gel-isolated LT detected phosphorylation at five of the six SQ/TQ sites, T518, S639, S665, S667 and S677 (Figure 2E). The peptide that contains S120, which was previously shown to be phosphorylated by ATM and to have a positive effect on nuclear translocation (40,73), was not detected in our MS analyses, so the phosphorylation of S120 could not be evaluated in this study.

The large number of phosphorylation sites identified on LT (Supplementary Figure S2) is consistent with the wealth of unexpected phospho-sites identified on many proteins using advanced mass spectrometric techniques in recent years (74,75). It has been estimated that only about a third of phospho-sites appear to have functional consequences (76). Our MS2 analyses showed five of the six of the SQ/TQ sites on LT to be phosphorylated in cells, with the remaining site having previously been shown to be phosphorylated and functional in enhancing LT nuclear translocation (40,52). It has been shown that evolutionary conservation of phospho-sites can be a useful approach to help identify which sites have functional significance (77). If arrest of DNA replication in response to DDR is important for SV40 and is mediated at least in part by phosphorylation of a specific SQ/TQ residue on LT, this aa residue is likely conserved in other PyV LT proteins. The Clustal Omega Multiple Sequence Alignment tool (The European Bioinformatics Institute (78)) was used to align sixteen mammalian PyV LT aa sequences, including: SV40, four other mammalian PyVs, and 11 human PyVs, focusing on conservation of the six SV40 LT SQ/TQ DDR kinase phosphorylation sites. These sites mapped to three distinct regions of the protein: to just upstream of the nuclear localization sequence (NLS) (S120) (Supplementary Figure S3A), to within the C-terminal region (S639, S665, S667 and S677) (Supplementary Figure S3B), and to the AAA + ATPase/helicase domain (T518) (Figure 2F). Our alignments revealed that the previously described S120 PIKK phosphorylation site in SV40 LT is highly conserved if one anchors alignment of this region to the predicted NLS of each of the LT sequences (see underlined aa residues, Supplementary Figure S3A). One or more SQ motifs exist four to ten aa residues upstream of all the NLS motifs (except for the human MWPyV which has two SQ motifs 24 and 28 aa residues upstream) (Supplementary Figure S3A). Hence the enhanced nuclear localization of LT due to phosphorylation of SV40 LT at S120 may be a common characteristic of the LTs of these other PyVs. The cluster of four SQ/TQ sites within the C terminus of SV40 LT is not well-conserved amongst these LTs. Many LTs, from both human and other mammalian PyVs, have few, or no SQ/TQ sites within this region (Supplementary Figure S3B). Studies of the SV40 LT C-terminal host range domain (aa 635–708) indicate that a C-terminal truncation of LT, to aa 635, are still viable for SV40 DNA replication (79). Together, these suggest that phosphorylation of one or more of the four C terminal SQ sites on SV40 LT would be unlikely to mediate inhibition of viral DNA replication, and may represent examples of the approximately two-thirds of phospho-sites that are phosphorylated without apparent functional consequences (76,79). Alignment of the PyV LT helicase domains showed that the SV40 LT phosphorylated TQ site, T518, is highly conserved, being an SQ or a TQ in the aligned PyV LT helicase domains (red box, Figure 2F). The MS2 peptide spectrum of one of the phospho-peptides containing T518, TQIFPPGIVTMNEYSVPK, is shown (Figure 2G). This spectrum shows multiple product ions generated from HCD fragmentation of the peptide backbone. Notably, detection of both the b4 and b13 ions with neutral loss of the phosphate group indicate with very high probability that the phosphorylated residue on this phospho-peptide was T518. Forty events of T518 phosphorylation of this same peptide were detected, as well as dozens of events of phosphorylation of this site detected on larger peptides covering the T518 residue. With this LT phosphorylation data, the high degree of conservation of this PIKK phosphorylation site, the computational prediction by NetPhos, and the fact that T518 is the only SQ/TQ phosphorylation site within the enzymatic domain of SV40 LT, we hypothesized that phosphorylation of T518 on SV40 LT might affect LT’s ability to support viral DNA replication.

Phosphomimetic mutant SV40 LT T518D is unable to support efficient viral DNA replication in human cells

To investigate whether phosphorylation at T518 could affect the ability of SV40 LT to support SV40 DNA replication, a phosphomimetic mutation at T518 was created by changing the threonine to an aspartic acid residue. This SV40 LT T518D mutation was evaluated for SV40 DNA replication function in human cells using a transient-transfection, luciferase-based SV40 viral DNA replication assay previously described by Fradet-Turcotte et al. (62). Briefly, human cervical cancer cells (C33a) are co-transfected with a SV40 LT expression plasmid (pCMV-sWT) and a SV40 ori-containing plasmid that also contains a firefly luciferase (Fluc) reporter gene (pFLORI40). Successful co-transfection results in expression of the LT protein which then binds to the SV40 ori on pFLORI40, driving replication of the plasmid. Higher levels of pFLORI40 template lead to higher levels of the Fluc reporter gene, resulting in higher expression of luciferase and higher Fluc activity. Mutant LT proteins compromised in SV40 DNA replication function result in lower levels of luciferase and lower Fluc activity. A third plasmid, pRL, drives expression of Renilla luciferase (Rluc); pRL does not contain the SV40 DNA replication origin. pRL is also co-transfected and serves as an internal standard for transfection efficiency and luciferase expression from a plasmid that is not replicated. SV40 DNA replication results in a dramatic increase in the ratio of Fluc to Rluc activities, and this Fluc:Rluc ratio has been shown to be a robust and sensitive assay for viral DNA replication (62). Plasmids expressing WT LT (pCMV-sWT) or a phosphomimetic mutant, T518D, (pCMV-sT518D) were evaluated thusly (Figure 3A). We observed that phosphomimetic LT mutant pCMV-sT518D is severely deficient in supporting SV40 DNA replication (∼8–18% of WT LT DNA replication levels), while mutation of T518 to a non-phosphorylatable aa at that residue (alanine, T518A encoded by pCMV-sT518A) replicates at WT or slightly higher levels (Figure 3A). Immunoblotting was used to verify that all three vectors expressed LT at comparable levels (Figure 3B). These data show that an acidic substitution, but not a small uncharged substitution, at T518 inhibits the ability of LT to support efficient SV40 DNA replication in human cells, consistent with phosphorylation of this residue inhibiting SV40 DNA replication.

Figure 3. Mutant LT T518D is unable to support efficient SV40 DNA replication in human cells. (A) Increasing amounts (2.5, 5 and 10ng, as indicated by triangles on x axis) of pCMV-sWT, pCMV-sT518D or pCMV-sT518A SV40 LT expression vectors were co-transfected into C33a cells along with a SV40-origin containing plasmid linked to firefly luciferase (pFLORI40) and a control plasmid lacking a viral origin linked to Renilla luciferase (pRL). After 72 h, cells were harvested and assayed for the ratio of Firefly to Renilla luciferases to obtain relative SV40 DNA replication values for each triplicate LT construct well as described in the Methods (28). No LT controls show reliance of Firefly luciferase expression on LT. All values are reported as a percentage of the average values obtained with 10 ng pCMV-sWT, which was tested in triplicate in each experiment. Results are an average of four separate experiments; error bars represent standard deviations. (B) Western blot confirms comparable expression of SV40 WT, T518D and T518A constructs in C33a cells. Error bars represent standard deviations.

Phosphomimetic mutant SV40 LT T518D is fully functional as a transcriptional transactivator in human cells

To begin to determine whether the DNA replication deficiency of mutant LT T518D was specific, or due to an overall loss of structure/conformation, the ability of LT T518D to support LT’s transcriptional activation functions was investigated. The fact that the T518D mutant was expressed stably and not degraded was consistent with maintenance of the overall structure of LT T518D (Figure 3B). If LT T518D could act as a transcriptional activator this would verify that LT T518D adopts a generally functional protein conformation. A vector was created that positions the SV40 late promoter (which requires LT binding for transcriptional activation) to drive expression of Renilla luciferase. The CMV promoter was removed from the pRL plasmid and replaced with nt 5097–272 of the SV40 genome from plasmid pSV010(-), so that the SV40 late promoter is oriented to control transcription of the Renilla luciferase gene. The resulting plasmid is referred to as pRLSV40-Late (Figure 4A). To circumvent an apparent decrease in transcription due to a loss in DNA replication function by LT T518D, this construct has a defective SV40 DNA replication origin due to a 4nt deletion in a critical LT binding site within LT binding domain II of the SV40 core origin which does not affect late promoter transcription (61). Human C33a cells were co-transfected with pRLSV40-Late along with increasing amounts of the WT or LT T518D expression vectors used in Figure 3. Cells were harvested after 72 h and Renilla luciferase levels were evaluated to determine LT activation of SV40 late promoter transcription. Consistent with the known requirement of LT for SV40 late promoter activation, there was a substantial increase in transcription when increasing levels of the WT LT expression vector were co-transfected with the reporter construct (Figure 4B, WT). Increasing levels of the expression vector for T518D mutant LT resulted in essentially identical levels of transcriptional activation from the SV40 late promoter (Figure 4B, T518D). No appreciable difference in Renilla luciferase levels between WT and LT T518D in these assays indicates that the T518D mutant LT can still activate transcription from the SV40 late promoter, demonstrating that the T518D mutation does not adversely affect LT’s transcriptional activation functions.

Figure 4. Mutant LT T518D is not deficient for activating transcription from the SV40 late promoter in human cells. (A) Plasmid map of pRLSV40-Late, highlighting SV40 origin/promoter sequence (SV40 genome nt 5097–272) oriented with the LT-dependent late promoter side driving expression of a Renilla luciferase gene. Note the small triangle within the SV40 sequence that indicates a 4-nt deletion that renders the SV40 origin inactive, allowing this construct to be used to monitor SV40 LT transcriptional activity in this cell-based assay without confounding effects due to SV40 DNA replication (27,30). Ampicillin resistance gene and an intron that increases splicing efficiency are also noted. (B) C33a cells were transfected with pRLSV40-Late, containing a Renilla luciferase gene driven by the late SV40 late promoter, and increasing amounts (25, 50 or 100ng) of expression plasmids for WT or T518D SV40 LT (as indicated by triangles on the x axis). Cells were harvested 72 h post transfection and assayed for Renilla luciferase expression. No-LT controls demonstrate reliance of Rluc expression on presence of LT. All values are reported as a percentage of values obtained with 100ng pCMV-sWT expression vector, which was tested in triplicate in each experiment. Results are an average of three separate experiments; error bars represent standard deviation.

Mutant SV40 LT T518D is unable to support efficient viral DNA replication in vitro

To evaluate the biochemical activities of LT required to support SV40 DNA replication and determine which function of LT is compromised by the T518D mutation, WT and LT T518D proteins were expressed and purified for biochemical analyses. LT requires phosphorylation at CDK site threonine 124 for SV40 DNA replication function. This phosphorylation does not occur if LT is produced in bacterial cells (49), therefore WT and LT T518D were expressed and purified from insect cells as described in the Methods (see Figure 5A). The abilities of WT and LT T518D to support SV40 DNA replication in vitro are shown (Figure 5B, C). Increasing amounts of purified WT or LT T518D were combined with the SV40 origin-containing plasmid, pSV011, HEK293 human cell extracts (which contain all the other DNA replication proteins necessary to support SV40 DNA replication) and nucleotides as described in the Materials and Methods (and (79)). Addition of WT LT resulted in an increase in both fully replicated labeled plasmids (Figure 5B, Forms I, II and topoisomers, lanes 4–7), as well as in the episome multimers and the Cairns or ‘bubble structure’ intermediates commonly seen with SV40 episomes replicated in vitro (Figure 5B, Replication Intermediates, lanes 4–7), as compared to control reactions containing either no LT (lane 3) or with the highest level of WT LT but with a plasmid template containing the mutated SV40 origin described above (lane 2) (61). Conversely, in parallel reactions with the same levels of LT T518D, synthesis of SV40 DNA replication products was severely deficient as compared to the WT LT (Figure 5B, lanes 8–11). To quantify the difference in SV40 DNA replication, P32dAMP incorporation was quantified as described in the Methods. Consistent with the cell-based results, mutant LT T518D (open circles) was severely compromised in supporting SV40 DNA replication in vitro, showing maximum SV40 DNA replication levels of ∼20% of those synthesized with WT LT (open triangles) across a range of LT concentrations (Figure 5C). The control reaction using the SV40 replication origin mutant plasmid pSV011(-) at the highest level of WT LT, confirmed the dependence of this assay on a functional SV40 origin of replication (open square). These results were highly consistent with the cell-based SV40 DNA replication reactions, showing similar decreases in synthesis by the phosphomimetic mutant LT as compared to WT LT.

Figure 5. Mutant LT T518D protein is unable to support efficient SV40 DNA Replication in vitro. (A) Coomassie stain of WT and T518D SV40 LT expressed in and purified from insect cells through baculovirus expression, used for subsequent in vitro analyses in this study. (B) In vitro DNA replication assays were performed as described in Methods with increasing amounts (250, 500, 750, or 1000ng as indicated by increasing triangles) of purified WT or T518D LT, and replicated products subjected to gel separation and phosphorimage analysis. No SV40 plasmid DNA was added in ‘No DNA’ controls. pSV011(-) mutant SV40-origin plasmid was combined with the highest level of WT LT (as in lane 7) for ‘Ori-’ control (lane 2). ‘No LT’ control (lane 3) shows background incorporation of αP32-dATP into pSV011 SV40-origin plasmid by host DNA repair machinery in the absence of LT. Replication intermediates signify ongoing DNA replication. Form I/II DNA and topoisomers signify fully replicated plasmid DNA, and replication intermediates indicate Cairns intermediates and interlocked not-yet-resolved episomes. (C) Incorporation of P32dAMP into newly synthesized SV40 DNA was quantified as described in Methods. All values are reported as percentage of the value obtained with 75 ng/μl of WT LT in that experiment. Results are an average of three independent experiments, error bars represent standard deviations. Ori mutant (square) is a negative control reaction using the highest amount of WT LT with the SV40 origin-mutant plasmid pSV011(–).

Phosphomimetic T518D LT interacts with host cellular replication factors and stimulates Pol-Prim polymerase activity like WT LT

To initiate SV40 DNA replication, LT must bind ATP, oligomerize into hexamers, and make crucial contacts with host RPA and TopoI, in addition to binding to, and stimulating the DNA polymerase activity of, host Pol-Prim (21,80–83). To address the ability of phosphomimetic LT to interact with cellular DNA replication factors, binding of WT and LT T518D to RPA, TopoI, and Pol-Prim was evaluated using enzyme-linked immunosorbent assays (ELISAs). Human TopoI (Figure 6A) or RPA (Figure 6B) were immobilized, incubated with increasing amounts of WT LT (open triangles) or LT T518D (open circles), and LT binding was detected with monoclonal antibody against LT as described in the Methods. WT and T518D interacted with human TopoI and RPA to similar degrees (Figures 6A & B). Controls show that binding of LT was clearly dependent on TopoI and RPA, respectively (Figures 6A, B, open squares). Pol-Prim ELISAs were carried out by immobilizing constant levels of either WT LT or LT T518D to the wells, incubating with increasing amounts of Pol-Prim, which was then detected using a Pol-Prim antibody as described in the Methods. No difference between WT and LT T518D binding to Pol-Prim was observed (Figure 6C, open triangle versus open circle, and binding of Pol-Prim was clearly dependent on immobilized LT (open square)). Since the interaction of LT with p53 also occurs within the LT helicase domain we evaluated whether the interaction with p53 was affected by T518 mutation. WT and the two T518 mutant LTs all showed comparable ability to co-IP cellular p53 (Supplemental Figure 4).

Figure 6. The SV40 LT T518D mutant protein is proficient for binding and stimulating host DNA replication proteins. (A) TopoI or (B) RPA were immobilized in 96 well plates followed by addition of increasing amounts (3.125, 6.25, 12.5, 25, 50 or 100 ng) of WT (open triangles) or T518D (open circles) LT as a secondary protein as indicated by the X axes. ELISAs were completed with a primary pAB101 LT antibody followed by a secondary HrP antibody. Block control (open square) represents non-specific binding of WT LT to blocking protein mixture (5% milk and 2% FBS in TBST). All values are reported as a percentage of values obtained from the interaction of 100ng WT LT with immobilized TopoI (A) or RPA (B). (C) For Pol-Prim ELISAs: WT or LT T518D were immobilized in 96 well plates followed by addition of increasing amounts (6.25, 12.5, 25, 50, 100 or 200 ng) of human Pol-Prim as a secondary protein as indicated by the X axis. ELISAs were completed with a primary mAB1645 Pol-Prim antibody followed by a secondary HrP antibody. Block (open square) represents non-specific binding of Pol-Prim to blocking protein mixture. For panel C, all values are reported as a percentage of values obtained from the interaction of 200ng Pol-Prim with immobilized WT LT. For panels A-C, each ELISA shown is a representative experiment with each binding reaction run in triplicate. (D) For Pol-Prim stimulation assays: reactions were assembled with increasing amounts (62.5, 125, 250, 500 or 1000ng) of WT LT (lanes 4–8) or LT T518D (lanes 9–13) as indicated by triangles, a constant amount of Pol-Prim, poly[dA]/oligo[dT] substrate, and αP32dTTP. Reaction products were resolved by denaturing agarose gel electrophoresis and visualized by phosphor-image analysis. Lane 1 is a control lacking LT but containing 50ng Pol-Prim, showing the heavy reliance of the assay on the presence of LT at these low levels of Pol-Prim. Lane 2 is a control lacking Pol-Prim but containing 1000 ng of WT LT, showing the reliance of the assay on Pol-Prim. Lane 3 is a control lacking both LT and Pol-Prim. (E) Stimulation of Pol-Prim by LT was quantified by scintillation counting of reactions spotted on DE-81 filter paper as described in Methods. All values are reported as percentage of the value obtained with 1000 ng WT LT in that experiment. Results are an average of three separate experiments, the error bars represent standard deviation.

Because the DNA polymerase activity of Pol-Prim is stimulated by the interaction with LT, a DNA polymerase assay was used to determine whether T518D mutant LT could stimulate Pol-Prim (21,23). Pol-Prim was combined with increasing amounts of WT LT (lanes 4–8) or LT T518D (lanes 9–13) with a poly dA/oligo dT template were carried out as described in the Methods (Figure 6D). Controls (Lanes 1–3) show that appreciable DNA synthesis is reliant on the presence of both SV40 LT and minimal levels of human Pol-Prim (extremely low levels of Pol-Prim were used in these assay conditions to maximize sensitivity of the LT stimulation). LT T518D was capable of stimulating DNA polymerase activity of human Pol-Prim equally as well as WT LT shown by equivalent increases in ssDNA products (Figure 6D). Quantification of three separate Pol-Prim stimulation assays is shown (Figure 6E). As SV40 LT is only known to interact with human DNA replication factors, TopoI, RPA, and Pol-Prim, the results in Figure 6 suggest that the compromised ability of LT T518D to support SV40 DNA replication does not appear to be due to an inability to interact functionally with human DNA replication proteins.

LT T518D is a functional ATPase, but is unable to efficiently unwind long dsDNA

The ATP-dependent DNA helicase activity of hexameric LT is essential for SV40 LT viral genome replication, and since T518 is within the ATPase/helicase domain, both ATPase and DNA helicase functions of LT T518D were investigated. Native polyacrylamide gels of both WT and T518D purified LT showed both preparations to be present predominantly in hexameric and dihexameric forms (data not shown), suggesting both would show ATPase function as the ATPase catalytic site is formed by sequences from two adjacent LT monomers in LT hexamers. Hence, ATPase assays provided a highly quantitative functional analysis of WT and T518D hexamers. Hydrolysis of γP32ATP by purified LT (WT (open triangles) or T518D (open circles)) was evaluated as described in the Methods over time (Figure 7A), in the presence of increasing amounts of ssDNA (Figure 7B), and over a range of ATP concentrations (Figure 7C). We observed that WT LT and LT T518D are both able to hydrolyze γP32ATP at the same rate over a 90 min time course (Figure 7A, representative TLC plate phosphorimage shown in inset). The ATPase function of LT is known to be stimulated by ssDNA, so the ability of WT and LT T518D to hydrolyze ATP was examined in the presence of increasing amounts of polydT (80). WT and T518D ATPase function were stimulated to equivalent degrees by addition of varying amounts of polydT (Figure 7B), suggesting both LTs interact similarly with ssDNA. To evaluate ATPase activities of WT and LT T518D at varying levels of ATP, ATP hydrolysis was evaluated in the presence of increasing concentrations of unlabeled ATP. As levels of unlabeled ATP were increased in these reactions, we observed an apparent decrease in the amount of γP32ATP hydrolyzed (Figure 7C) (recognize that the overall levels of ATP hydrolyzed actually increased with increased ATP because more hydrolysis of unlabeled ATP is occurring). In these reactions we observed equivalent decreases in the proportion of γP32ATP hydrolyzed in both WT and LT T518D reactions, demonstrating that WT and LT T518D showed equivalent ATPase activity over a range of ATP concentrations, indicating that the two LTs have comparable affinities for ATP. Figure 7 demonstrates that despite mutant LT T518D’s inability to support efficient SV40 DNA replication, LT T518D retains WT ATPase activity over a range of conditions.

Figure 7. LT mutant T518D is proficient for ATPase function in vitro. (A) WT or LT T518D was incubated with γP32-ATP at different times (5, 10, 15, 30, 45, 60 and 90 min) as indicated by increasing triangles. Reactions were subjected to TLC and plates were exposed to phospho-imaging screens, followed by autoradiographic analysis. Representative ATPase time course TLC plate image is shown in inset. Lane 1 is a control without LT. Lanes 2–7 show WT LT ATPase reactions terminated at increasing time points over the course of 90 min, and lanes 8–13 show LT T518D ATPase reactions over the same time course. TLC images from three separate experiments were quantified using Image J software, averaged, and plotted as above. Values are reported as a percentage of the density values of hydrolyzed γ-phosphate spots on TLC plates obtained with WT LT at the 90 min time point. (B) WT (open triangles) or LT T518D (open circles) were incubated with γP32-ATP and increasing concentrations (0, 6.25, 12.5, 25 and 50ng/μl) of 221 bp polydT single stranded DNA as indicated. All values are reported as a percentage of the density values of hydrolyzed γ-PO43- spots on TLC plates obtained with WT LT at the highest poly dT concentration. (C) WT or LT T518D was incubated with γP32-ATP with increasing concentrations (1, 0.6, 0.35, 0.225, 0.1625 or 0.1 mM) of unlabeled ATP as indicated. All values are reported as a percentage of the density values of hydrolyzed γ-phosphate spots on TLC plates obtained with WT LT at 0.1 mM ATP. For all panels results are an average of three separate experiments, with error bars representing standard deviations.

Hydrolysis of ATP leads to conformational changes within DNA-bound hexamers of LT, leading to translocation of LT along the leading strand template and separation of dsDNA during DNA replication (84). Therefore, we assessed the helicase DNA strand displacement activities of WT and LT T518D over time using two substrates with differing lengths of dsDNA: one composed of a short (17 bp) duplex region (Figure 8A) and another with a longer (100 bp) duplex region (Figure 8B, C). dsDNA substrates separated in helicase reactions were resolved on native TBE polyacrylamide gels and subjected to phosphorimage analysis as described in the Methods. In each gel image, control lane 1 (no LT) shows migration of the fully duplex DNA substrate while lane 2 (boiled substrate) shows the ssDNA radiolabeled strand. Over time, both WT (lanes 3–8, Figure 8A) and LT T518D (lanes 9–14, Figure 8A) unwind a short 17nt duplex region of DNA with equal efficiencies as seen by equivalent accumulation of released 17nt oligo. However, LT T518D is much less efficient than WT LT when the region of duplex DNA is increased to 100 bp. Figure 8B is a representative gel showing that over time less 100 bp helicase substrate is unwound by T518D than by WT LT. Figure 8C is a quantification of three separate experiments showing that LT T518D unwinds the 100mer substrate with only ∼35% of the efficiency of WT LT over time. This difference appears to be more dependent on the difference in length of the dsDNA being unwound rather than the structure of the template or flanking ssDNA, as studies with a forked substrate, like the 100 bp substrate, but with only 50 paired bases, showed an intermediate decrease in helicase activity as compared to the 17 bp and the 100 bp substrates (Supplementary Figure S5, rather than varying time these results show varying levels of LT). LT T518D was more efficient at unwinding the shorter 50bp substrate than the 100 bp substrate albeit less effective than WT LT on both substrates. These data indicate that LT T518D is less efficient than WT LT at separating longer stretches of duplex DNA, while it is proficient at removing short segments of DNA.

Figure 8. LT mutant T518D is deficient for progressive DNA helicase function. WT or LT T518D were incubated with a dsDNA helicase substrate with (A) 17bp or (B) 100bp of duplex DNA, each having a single P32 end-labelled strand, at different time points (5, 10, 15, 30, 45, 60 or 90 min) over a time course as indicated by increasing triangles. Reactions were resolved on native TBE gels, exposed to phosphor imaging-screens, and analyzed by autoradiography. Values were obtained by setting the density of the released, radiolabelled band of a boiled reaction to 100% helicase activity and comparing densities of released bands in reactions to the boiled control. (A) and (B) are representative images for 17mer and 100mer time course helicase assays. ‘No LT’ controls (lanes 1) show migration of intact, duplex DNA helicase substrates compared to ‘No LT (Boiled)’ controls (lanes 2) showing migration of the single, radio-labelled strand of the helicase substrate following separation of DNA strands (note substrate cartoons highlighting the difference in direction of migration of the boiled 17mer and 100mer substrates). (C) represents quantification of three separate 100mer helicase time course assays. Error bars represent standard deviations.

Phosphomimetic mutation of JCPyV LT is also compromised for viral DNA Replication

Our decision to evaluate the potential function of phosphorylation at the T518 residue of SV40 LT was based in part on the conservation of this site amongst PyV LTs (Figure 2F); if DDR regulation of PyV DNA replication by phosphorylation at this site is important then phosphomimetic mutations at this site in other PyV LTs should also show the phenotype of decreased viral DNA replication. A vector for the expression of LT from the clinically relevant human PyV, JCPyV, is available and was obtained and mutagenized to a phosphomimetic residue at this highly conserved site, JCV LT T519D. A dual luciferase human cell-based JCPyV DNA replication system was used to evaluate the relative ability of WT and T519D JCPyV LT proteins to support JC PyV DNA replication (63). Just as with SV40, mutation of JC PyV LT to a phosphomimetic residue resulted in levels of JC PyV DNA replication far lower than levels support by WT JC LT (Figure 9).

Figure 9. Phosphomimetic mutation of JC polyomavirus LT, T519D, is deficient for JCPyV DNA Replication in human cells. Increasing amounts (2.5, 5 or 10 ng as indicated by X axis) of pCMV-jWT, or pCMV-jT519D JCPyV LT expression plasmids were utilized in the JCPyV dual-luciferase viral DNA replication assay, analogous to the SV40 assay (Figure 3), as described in the Methods. All values are reported as a percentage of the Fluc/Rluc ratios obtained with 10 ng pCMV-jWT LT. Results are from a single experiment, run in triplicate, representative of data from three separate experiments. Western blots confirm equal expression of each JCPyV LT construct in the same C33a cells used for the JCPyV experiments (inset). Error bars represent standard deviations.

Discussion

The SV40 DNA replication system is an important tool for studying the effects of DNA damage on both viral and eukaryotic DNA replication (13,14,36–40,42–45,85). Although strong activation of DDR may inhibit, pause or slow DNA replication, faithful duplication of both SV40 and human DNA is dependent on functional ATM and ATR kinases. ATM acts to prevent unidirectional replication and to alleviate concatemerization (34), while ATR acts to prevent origin firing in the presence of DDR, and as a surveyor to slow and/or stabilize moving DNA replication forks that have encountered a lesion, preventing fork collisions and resultant DNA breaks (1,2,4,33,86). SV40 LT and human MCM helicase proteins are both phosphorylated by ATM/ATR following DNA damage, although the effect of most of these phosphorylation events remain unclear (13,40,55–58). Since these helicases are the central motor proteins of DNA replication forks, it is likely that DDR-dependent phosphorylation of helicases contributes to DDR-dependent inhibition of DNA replication by slowing or transient pausing of DNA replication forks to allow time to correct potentially lethal (or mutagenic) damage to DNA. Our aim was to study the DDR-dependent phosphorylation of a replicative DNA helicase and the impact of these phosphorylation events on DNA replication, using SV40 LT as a model helicase. MS2 was used to identify DDR-dependent SQ/TQ phosphorylation sites on SV40 LT. We show here for the first time that the T518 aa residue on SV40 LT is indeed phosphorylated in living cells (Figure 2). The conservation of this aa residue on a variety of PyV LT proteins, and its presence within LT DNA helicase domain (Figure 2), suggested an important role for this residue in DDR.

We investigated the likely effect of phosphorylation of the T518 residue of SV40 LT using a phosphomimetic mutation of LT, T518D. This mutation resulted in stable expression in human cells, did not show signs of any apparent increase in degradation, and retained wild-type function in cell-based LT-dependent transcriptional activation (Figures 3&4), all indicating that LT T518D is stably expressed and properly folded when expressed in human cells; but LT T518D was severely compromised for viral DNA replication. LT T518D expressed in insect cells and purified also showed compromised viral DNA replication in cell-free DNA replication assays, but retained WT levels of binding to: TopoI (reported to contact LT at aa 83–160 and 602–708), Pol-Prim (reported to contact LT between aa 260–627), and RPA (reported to contact the LT OBD), further supporting the notion that LT T518D is being properly folded in both settings (Figure 6) (87,88). The p68 ‘regulatory subunit’ of Pol-Prim is known to interact with LT within its ATPase/helicase domain. Hence, one possibility was that phosphorylation of LT T518 might disrupt the ability of LT to bind to and stimulate the DNA synthesis activity of Pol-Prim (89). However, LT T518D was able to bind and stimulate the activity of human Pol-Prim as well as WT LT in our ELISA and Pol-Prim DNA synthesis stimulation assay analyses (Figure 6). The surface exposure and location of T518 near the interface of adjacent monomers in the SV40 LT hexamer structure but distal to the LT ATPase site (∼20 Å), led us to speculate that phosphorylation at T518 might disrupt the ability of LT to oligomerize into functional hexamers, required for helicase function. However, native PAGE gels showed both WT and T518D to be predominantly in the hexameric and di-hexameric forms (data not shown). Each ATP binding pocket consists of cis and trans elements belonging to adjacent LT subunits, a cis Walker A P-loop ATP-binding element from one monomer and the Walker B, arginine/lysine finger ATP hydrolysis elements from the adjacent monomer (84,90). Although indirect, ATPase activity provides the most quantitative measure for hexamerization as well as another essential DNA replication function of LT. Our data on LT ATPase activity showed that LT T518D is as active as WT LT in ATPase function throughout a time course and over a wide range of ATP concentrations (Figure 7), indicating that LT T518D must be proficient for hexamerization and for the ATPase function required for helicase function and DNA replication. Since SV40 LT hexamerization is primarily dependent on contacts upstream of T518, in the LT origin-binding (OBD) (aa 125–250) and oligomerization domains, and is dependent on CDK2 phosphorylation of T124, perhaps in retrospect this result should not have been surprising (49,91).

The one function of LT that was compromised by mutation T518D consistent with its loss of DNA replication function was its loss of DNA helicase activity on longer DNA templates (Figure 7 and Supplementary Figure S5), where the ∼70% decrease in helicase function on longer DNA templates was strikingly similar to the ∼80–90% decrease in DNA replication function in vitro and in cultured cells (Figures 3 and 5). During DNA replication fork progression, it is proposed that SV40 LT hexamers surround the leading strand template bound to six ATP molecules in a ‘ready’ state. In an ATP bound state, each LT subunit makes a unique base interaction with DNA through β-hairpins (aa 508–517 from each monomer) inside the hexamer's central channel (92). Upon hydrolysis of ATP, conformational changes in LT near the β-hairpins cause translocation of the hexamer in the 3′ to 5′ direction along the leading strand template ssDNA. Further conformational changes occur between the ADP-bound and the second round of ATP-bound state of LT hexamers, causing further translocation of the hexamer and physical exclusion of the lagging strand template, which results in ‘helicase’ displacement of the lagging strand template (84,90,92). T518 is at the base of the β-hairpin. This could explain how mutation or phosphorylation at this residue could compromise DNA helicase function without affecting ATPase function. Loss of proper β-hairpin function would not affect the ATPase-dependent conformational changes in the LT monomers but could compromise the mechanical connection between the ATP hydrolysis/LT conformational changes and the mechanical action required to track along the ssDNA. Since LT T518D is still capable of hexamerizing and hydrolyzing ATP (as well as binding to ssDNA, as evidenced by its wt levels of ssDNA stimulation of ATPase function), it should still be able to displace short stretches of ssDNA even without its motive force. Indeed, LT T518D was fully capable of removing a short (17 base) oligonucleotide annealed to a longer ssDNA template (Figure 8A). However, lack of wild-type β-hairpin function/motive force of the helicase would not allow for efficient displacement of longer stretches of ssDNA from a longer dsDNA template. This is what was seen with oligonucleotides of 50 and 100 bases (Figure 8B, C, Supplementary Figure S5). Hence, it appears that mutation/phosphorylation at T518 may affect the ability of LT to coordinate ATP hydrolysis with the mechanical motion required of the DNA-interacting β-hairpin for helicase function. This conserved site is either a serine or a threonine in many PyV LTs, suggesting the length of the aa side change is not as critical as the change in charge caused by mutation/phosphorylation. The similarity in charge/general size is consistent with phosphorylated T518 displaying a similar mechanical defect in helicase progression as mutation to an acidic residue.

The mechanism of how phosphorylation of LT at T518 (or mutation to an aspartic acid) might result in compromising β-hairpin function or helicase slowing/pausing remain to be determined. However, since replication in the presence of 100% modified (T518D) LT results in a dramatic decrease, but not a complete prevention of helicase function and DNA replication (Figures 3, 5 and 7), this indicates that the modified form of LT retains a low level of activity. This implies that LT hexamers will exhibit slowed processivity, as once helicases are displaced from a replication fork reassembly is not favored in the absence of dsDNA without an origin sequence. It can be easily envisioned that addition of a negative charge to the base of the β-hairpin could have a repulsive effect on the transient interaction between the β-hairpin and the phosphate of the DNA nucleotide being escorted through the LT hexamer by that β-hairpin, potentially causing the β-hairpin to ‘slip off’ of the nucleotide. This would not mean that a subsequent DNA nucleotide could not ‘catch’ properly on the β-hairpin, allowing the helicase to subsequently continue at the replication fork. We envision this as the β-hairpins being analogous to the sprockets on the rear wheel of a multi-speed bicycle and the strand of DNA passing through the pore of the helicase analogous to a bicycle chain. Phosphorylation of the β-hairpin ‘sprocket’ would be analogous to a shorter or ‘worn’ sprocket that lets the chain slip on occasion, but catches on the chain often enough to propel the bicycle, albeit at a much slower rate. Whether this ‘slippage’ followed by subsequent ‘catching’ of another nucleotide occurs very frequently resulting in a consistent helicase slowing, or whether it occurs intermittently resulting in tracks of hexamer progression occurring at WT speed interspersed with times of no helicase progression, will require single-molecule analyses comparing WT and T518D LT helicase function. One could imagine that as one or more LT monomers become modified that replication fork slowing could occur to variable degrees, with maximal phosphorylation ultimately resulting in maximal slowing of replication forks, likely comparable to what we observe with the phosphomimetic LT experiments.

It is possible that the conserved ATR/ATM phosphorylation sites on MCMs causes slowing of MCM helicase function, similar to what we have seen with SV40 LT T518D, which could be responsible for the well-established ∼10-fold decrease in replication fork rate seen when eukaryotic cells are subjected to DDR (7,93). Although this SV40 T518 site has no directly analogous SQ/TQ residue adjacent to the β-hairpins in the human MCM2-7 replicative helicase proteins, alignments of all six individual MCM’s, 2–7, from humans, several vertebrates, and through fission and budding yeast, reveal a highly conserved and uncharacterized SQ site located immediately downstream of the Walker A ATP-binding motifs of each MCM. This SQ site is highly conserved at the base of the Walker ATPase P-loops. While a phosphorylation at this site would not provide a similar mechanism for slowing of the helicase by β-hairpin ‘slippage’, phosphorylation at the base of the P-loop could also lend itself to a mechanism for helicase slowing. Addition of a negative charge to the base of the ATPase P-loop could potentially suppress the efficiency of ATP hydrolysis, thereby suppressing helicase function. Rather than acting at the site providing motive force along the DNA, this would act at the part of the enzyme where the energy for enzyme function is utilized – so at the bicycle ‘pedal/crank’ rather than at the ‘sprockets’. This would predict that phosphomimetic mutations at these sites in an MCM helicase would inhibit helicase function as well as ATPase function. It will be interesting to investigate the effect of mutations at these SQ phosphorylation sites on the MCMs.

Human RPA is also phosphorylated following DNA damage, and it has been shown that RPA purified from cells subjected to DNA damage is deficient in its ability to support SV40 DNA replication in vitro when using naïve LT (37,42,85,94,95). Hence, we would not expect the LT T518A mutation to render SV40 DNA replication resistant to DDR-dependent slowing, as the DDR effect on RPA function would be sufficient to inhibit SV40 replication. It is not surprising that there would be multiple redundant pathways to slow DNA replication forks in response to DDR as redundancy is common in the cellular DDR response. Currently little is known about how DDR-dependent phosphorylation of RPA renders it deficient for SV40 DNA replication. Since RPA interacts with SV40 LT and cooperates with LT during helicase function (96), it is possible that phosphorylation of RPA acts through LT helicase function. Conversely, RPA is critical for priming and DNA synthesis through its interactions with LT and Pol-prim (21–23), so it is possible that this is the function modulated by RPA phosphorylation. It is attractive to propose that inhibition of the elongating DNA replication fork occurs through two independent mechanisms, one on the leading strand (through helicase inhibition) and one on the lagging strand (by prevention of primer synthesis through phosphorylation of RPA inhibiting required protein-protein interactions). Having redundant pathways for DDR targets is not unusual (1,2,4,86), and having pathways that that work on both leading and lagging strand processes would likely lead to more stably paused replication forks. Based on these results as well as previous studies it is likely that phosphorylation of LT or host DNA replication factors (such as RPA) may be capable of suppressing SV40 DNA replication individually, and that two or more redundant pathways have evolved to slow or pause DNA replication following activation of DDR.

Whether triggering the cellular DDR pathway could be a potential antiviral approach for treatment of BK or JC viral proliferation in immunocompromised patients is an intriguing possibility. Due to PyVs’ complete reliance on cellular DNA polymerase function for genome replication, and with the only PyV enzyme being viral helicases – which have so far proven refractory to antiviral development, antivirals against PyVs have proven elusive. A direct-acting antiviral that could impede BK viral proliferation in kidney transplant patients, or JC viral proliferation in PML-AIDS patients, could prove extremely helpful for treating immunocompromised patients. However, the most obvious way to induce DDR in patients would be to treat patients with genotoxic chemotherapeutics, such as etoposide or other topoisomerase poisons. This carries with it substantial toxicity. Whether the benefit of inhibiting viral proliferation would be worth the side effects would take substantial investigation. If a small molecule inducer of cellular DDR were developed this could provide an alternative approach for triggering DDR and inhibiting viral (and cellular) DNA replication. If this could be done without inducing DNA damage it might show less toxicity than current chemotherapeutic agents.

Supplementary Material

gkae663_Supplemental_File

Acknowledgements

We thank the following for their generous gifts: Amelie Fradet-Turcotte and Jacques Archambault (for pCMV-sWT, pRL), Peter Bullock and J. Archambault (for pFLORIjc and pCMV-jWT), and a very special thank you to Daniel T. Simmons (for p941-WT and numerous other reagents, and his extensive advice and laboratory protocols). We also thank J. Archambault and Mark Sutton for valuable advice and suggestions throughout this study, Jeffrey C. Martin for assistance in editing of the manuscript. Dr Wei Yang (NIH/NIDDK) for helpful discussion and advice regarding SV40 LT structure and function and the predicted effects of LT phosphorylation and the mutations evaluated in this manuscript.

Data availability

The data that support the findings of this study are available on Mendeley: https://data.mendeley.com/datasets/7xcgbfkbz5/1.

Supplementary data

Supplementary Data are available at NAR Online.

Funding

National Institutes of Health [AI16408101 and AI095632 to T.M.]; National Institutes of Health Training Grant in Microbial Pathogenesis [T32 AI007614 to C.H.]. Funding for open access charge: NIH.

Conflict of interest statement. None declared.
==== Refs
References

1. Aguilera A. , Garcia-MuseT. Causes of genome instability. Annu. Rev. Genet. 2013; 47 :1–32.23909437
2. Kumar S. , HubermanJ.A. On the slowing of S phase in response to DNA damage in fission yeast. J. Biol. Chem. 2004; 279 :43574–43580.15297457
3. Santocanale C. , DiffleyJ.F. A Mec1- and Rad53-dependent checkpoint controls late-firing origins of DNA replication. Nature. 1998; 395 :615–618.9783589
4. Zegerman P. , DiffleyJ.F. DNA replication as a target of the DNA damage checkpoint. DNA Repair (Amst.). 2009; 8 :1077–1088.19505853
5. Bacal J. , Moriel-CarreteroM., PardoB., BartheA., SharmaS., ChabesA., LengronneA., PaseroP. Mrc1 and Rad9 cooperate to regulate initiation and elongation of DNA replication in response to DNA damage. EMBO J. 2018; 37 :e99319.30158111
6. Chastain P.D 2nd , BrylawskiB.P., ZhouY.C., RaoS., ChuH., IbrahimJ.G., KaufmannW.K., Cordeiro-StoneM. DNA damage checkpoint responses in the S phase of synchronized diploid human fibroblasts. Photochem. Photobiol. 2015; 91 :109–116.25316620
7. Seiler J.A. , ContiC., SyedA., AladjemM.I., PommierY. The intra-S-phase checkpoint affects both DNA replication initiation and elongation: single-cell and -DNA fiber analyses. Mol. Cell. Biol. 2007; 27 :5806–5818.17515603
8. Zellweger R. , DalcherD., MutrejaK., BertiM., SchmidJ.A., HerradorR., VindigniA., LopesM. Rad51-mediated replication fork reversal is a global response to genotoxic treatments in human cells. J. Cell Biol. 2015; 208 :563–579.25733714
9. Dibitetto D. , MarshallS., SanchiA., LiptayM., BadarJ., LopesM., RottenbergS., SmolkaM.B. DNA-PKcs promotes fork reversal and chemoresistance. Mol. Cell. 2022; 82 :3932–3942.36130596
10. Kaufman D.G. , Cordeiro-StoneM., BrylawskiB.P., CohenS.M., ChastainP.D. Early S phase DNA replication: A search for targets of carcinogenesis. Adv. Enzyme. Regul. 2007; 47 :127–138.17337290
11. Lossaint G. , LarroqueM., RibeyreC., BecN., LarroqueC., DecailletC., GariK., ConstantinouA. FANCD2 binds MCM proteins and controls replisome function upon activation of s phase checkpoint signaling. Mol. Cell. 2013; 51 :678–690.23993743
12. Mutreja K. , KrietschJ., HessJ., UrsichS., BertiM., RoesslerF.K., ZellwegerR., PatraM., GasserG., LopesM. ATR-mediated global fork slowing and reversal assist fork traverse and prevent chromosomal breakage at DNA interstrand cross-links. Cell Rep. 2018; 24 :2629–2642.30184498
13. King L.E. , FiskJ.C., DornanE.S., DonaldsonM.M., MelendyT., MorganI.M. Human papillomavirus E1 and E2 mediated DNA replication is not arrested by DNA damage signalling. Virology. 2010; 406 :95–102.20673941
14. Liu J.S. , KuoS.R., McHughM.M., BeermanT.A., MelendyT. Adozelesin triggers DNA damage response pathways and arrests SV40 DNA replication through replication protein A inactivation. J. Biol. Chem. 2000; 275 :1391–1397.10625690
15. Liu Y. , WangL., XuX., YuanY., ZhangB., LiZ., XieY., YanR., ZhengZ., JiJ.et al . The intra-S phase checkpoint directly regulates replication elongation to preserve the integrity of stalled replisomes. Proc. Natl. Acad. Sci. U.S.A. 2021; 118 :e2019183118.34108240
16. McClure A.W. , DiffleyJ.F. Rad53 checkpoint kinase regulation of DNA replication fork rate via Mrc1 phosphorylation. eLife. 2021; 10 :e69726.34387546
17. McClure A.W. , CanalB., DiffleyJ.F.X. A DNA replication fork-centric view of the budding yeast DNA damage response. DNA Repair (Amst.). 2022; 119 :103393.36108423
18. Hurwitz J. , DeanF.B., KwongA.D., LeeS.H. The in vitro replication of DNA containing the SV40 origin. J. Biol. Chem. 1990; 265 :18043–18046.1976634
19. Kelly T.J. SV40 DNA replication. J. Biol. Chem. 1988; 263 :17889–17892.2848017
20. Tsurimoto T. , MelendyT., StillmanB. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 DNA replication origin. Nature. 1990; 346 :534–539.2165567
21. Collins K.L. , KellyT.J. Effects of T antigen and replication protein A on the initiation of DNA synthesis by DNA polymerase alpha-primase. Mol. Cell. Biol. 1991; 11 :2108–2115.1848671
22. Dornreiter I. , ErdileL.F., GilbertI.U., von WinklerD., KellyT.J., FanningE. Interaction of DNA polymerase alpha-primase with cellular replication protein A and SV40 T antigen. EMBO J. 1992; 11 :769–776.1311258
23. Melendy T. , StillmanB. An interaction between replication protein A and SV40 T antigen appears essential for primosome assembly during SV40 DNA replication. J. Biol. Chem. 1993; 268 :3389–3395.8381428
24. Fairman M.P. , PrelichG., StillmanB. Identification of multiple cellular factors required for SV40 replication in vitro. Philos. Trans. Roy. Soc. Lond. B, Biol. Sci. 1987; 317 :495–505.2894684
25. Dornreiter I. , HossA., ArthurA.K., FanningE. SV40 T antigen binds directly to the large subunit of purified DNA polymerase alpha. EMBO J. 1990; 9 :3329–3336.1698613
26. Simmons D.T. , MelendyT., UsherD., StillmanB. Simian virus 40 large T antigen binds to topoisomerase I. Virology. 1996; 222 :365–374.8806520
27. Waga S. , BauerG., StillmanB. Reconstitution of complete SV40 DNA replication with purified replication factors. J. Biol. Chem. 1994; 269 :10923–10934.8144677
28. Sullivan C.S. , PipasJ.M. T antigens of simian virus 40: molecular chaperones for viral replication and tumorigenesis. Microbiol. Mol. Biol. Rev. 2002; 66 :179–202.12040123
29. Boichuk S. , HuL., HeinJ., GjoerupO.V. Multiple DNA damage signaling and repair pathways deregulated by simian virus 40 large T antigen. J. Virol. 2010; 84 :8007–8020.20519379
30. Dey-Rao R. , ShenS., QuJ., MelendyT. Proteomics analysis of the polyomavirus DNA replication initiation complex reveals novel functional phosphorylated residues and associated proteins. Int. J. Mol. Sci. 2024; 25 :4540.38674125
31. Gordon-Shaag A. , YosefY., Abd El-LatifM., OppenheimA The abundant nuclear enzyme PARP participates in the life cycle of simian virus 40 and is stimulated by minor capsid protein VP3. J. Virol. 2003; 77 :4273–4282.12634384
32. Masih P.J. , KunnevD., MelendyT. Mismatch Repair proteins are recruited to replicating DNA through interaction with Proliferating Cell Nuclear Antigen (PCNA). Nucleic Acids Res. 2008; 36 :67–75.17984070
33. Sowd G.A. , LiN.Y., FanningE. ATM and ATR activities maintain replication fork integrity during SV40 chromatin replication. PLoS Pathog. 2013; 9 :e1003283.23592994
34. Sowd G.A. , ModyD., EggoldJ., CortezD., FriedmanK.L., FanningE. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products. PLoS Pathog. 2014; 10 :e1004536.25474690
35. Williams J.I. , CleaverJ.E. Perturbations in simian virus 40 DNA synthesis by ultraviolet light. Mutat. Res. 1978; 52 :301–311.214706
36. Dziegielewska B. , KowalskiD., BeermanT.A. SV40 DNA replication inhibition by the monofunctional DNA alkylator Et743. Biochemistry. 2004; 43 :14228–14237.15518573
37. Liu J.S. , KuoS.R., YinX., BeermanT.A., MelendyT. DNA damage by the enediyne C-1027 results in the inhibition of DNA replication by loss of replication protein A function and activation of DNA-dependent protein kinase. Biochemistry. 2001; 40 :14661–14668.11724580
38. McHugh M.M. , KuoS.R., Walsh-O’BeirneM.H., LiuJ.S., MelendyT., BeermanT.A. Bizelesin, a bifunctional cyclopropylpyrroloindole alkylating agent, inhibits simian virus 40 replication in trans by induction of an inhibitor. Biochemistry. 1999; 38 :11508–11515.10471303
39. Miao H. , SeilerJ.A., BurhansW.C. Regulation of cellular and SV40 virus origins of replication by Chk1-dependent intrinsic and UVC radiation-induced checkpoints. J. Biol. Chem. 2003; 278 :4295–4304.12424256
40. Shi Y. , DodsonG.E., ShaikhS., RundellK., TibbettsR.S. Ataxia-telangiectasia-mutated (ATM) is a T-antigen kinase that controls SV40 viral replication in vivo. J. Biol. Chem. 2005; 280 :40195–40200.16221684
41. Sullivan C.S. , GrundhoffA.T., TevethiaS., PipasJ.M., GanemD. SV40-encoded microRNAs regulate viral gene expression and reduce susceptibility to cytotoxic T cells. Nature. 2005; 435 :682–686.15931223
42. Wang Y. , HuqM.S., IliakisG. Evidence for activities inhibiting in trans initiation of DNA replication in extract prepared from irradiated cells. Radiat. Res. 1996; 145 :408–418.8600501
43. Wang Y. , PerraultA.R., IliakisG. Down-regulation of DNA replication in extracts of camptothecin-treated cells: activation of an S-phase checkpoint?. Cancer Res. 1997; 57 :1654–1659.9135002
44. Wang Y. , ZhouX.Y., WangH., HuqM.S., IliakisG. Roles of replication protein A and DNA-dependent protein kinase in the regulation of DNA replication following DNA damage. J. Biol. Chem. 1999; 274 :22060–22064.10419533
45. Woynarowski J.M. , BeermanT.A. Effects of bizelesin (U-77,779), a bifunctional alkylating minor groove binder, on replication of genomic and simian virus 40 DNA in BSC-1 cells. Biochim. Biophys. Acta. 1997; 1353 :50–60.9256064
46. Gough G. , WoodR.D. Inhibition of in vitro SV40 DNA replication by ultraviolet light. Mutat. Res. 1989; 227 :193–197.2478885
47. Muller F. , SeoY.S., HurwitzJ. Replication of bovine papillomavirus type 1 origin-containing DNA in crude extracts and with purified proteins. J. Biol. Chem. 1994; 269 :17086–17094.8006013
48. Melendy T. , SedmanJ., StenlundA. Cellular factors required for papillomavirus DNA replication. J. Virol. 1995; 69 :7857–7867.7494298
49. Barbaro B.A. , SreekumarK.R., WintersD.R., PrackA.E., BullockP.A. Phosphorylation of simian virus 40 T antigen on Thr 124 selectively promotes double-hexamer formation on subfragments of the viral core origin. J. Virol. 2000; 74 :8601–8613.10954562
50. McVey D. , BrizuelaL., MohrI., MarshakD.R., GluzmanY., BeachD. Phosphorylation of large tumour antigen by cdc2 stimulates SV40 DNA replication. Nature. 1989; 341 :503–507.2552322
51. Montenarh M. , MullerD. The phosphorylation at Thr 124 of simian virus 40 large T antigen is crucial for its oligomerization. FEBS Lett. 1987; 221 :199–204.3040470
52. Prives C. The replication functions of SV40 T antigen are regulated by phosphorylation. Cell. 1990; 61 :735–738.2160857
53. Houtgraaf J.H. , VersmissenJ., van der GiessenW.J. A concise review of DNA damage checkpoints and repair in mammalian cells. Cardiovasc. Revasc. Med. 2006; 7 :165–172.16945824
54. Maréchal A. , ZouL. DNA Damage Sensing by the ATM and ATR Kinases. Cold Spring Harb. Perspect. Biol. 2013; 5 :a012716.24003211
55. Cortez D. , GlickG., ElledgeS.J. Minichromosome maintenance proteins are direct targets of the ATM and ATR checkpoint kinases. Proc. Natl. Acad. Sci. U.S.A. 2004; 101 :10078–10083.15210935
56. Ishimi Y. , Komamura-KohnoY., KwonH.J., YamadaK., NakanishiM. Identification of MCM4 as a target of the DNA replication block checkpoint system. J. Biol. Chem. 2003; 278 :24644–24650.12714602
57. Shechter D. , CostanzoV., GautierJ. ATR and ATM regulate the timing of DNA replication origin firing. Nat. Cell Biol. 2004; 6 :648–655.15220931
58. Tsao C.C. , GeisenC., AbrahamR.T. Interaction between human MCM7 and Rad17 proteins is required for replication checkpoint signaling. EMBO J. 2004; 23 :4660–4669.15538388
59. Devbhandari S. , RemusD. Rad53 limits CMG helicase uncoupling from DNA synthesis at replication forks. Nat. Struct. Mol. Biol. 2020; 27 :461–471.32341532
60. Prelich G. , StillmanB. Coordinated leading and lagging strand synthesis during SV40 DNA replication in vitro requires PCNA. Cell. (1988); 53 :117–126.2894900
61. Gluzman Y. , FrisqueR.J., SambrookJ. Origin-defective mutants of SV40. Cold Spring Harb. Symp. Quant. Biol. 1980; 44 :293–300.Pt 1.6253143
62. Fradet-Turcotte A. , MorinG., LehouxM., BullockP.A., ArchambaultJ. Development of quantitative and high-throughput assays of polyomavirus and papillomavirus DNA replication. Virology. 2010; 399 :65–76.20079917
63. Shin J. , PhelanP.J., ChhumP., BashkenovaN., YimS., ParkerR., GagnonD., GjoerupO., ArchambaultJ., BullockP.A. Analysis of JC virus DNA replication using a quantitative and high-throughput assay. Virology. 2014; 468-470 :113–125.25155200
64. Kamakaka R.T. , KaufmanP.D., StillmanB., MitsisP.G., KadonagaJ.T. Simian virus 40 origin- and T-antigen-dependent DNA replication with Drosophila factors in vitro. Mol. Cell. Biol. 1994; 14 :5114–5122.8035793
65. Blom N. , Sicheritz-PontenT., GuptaR., GammeltoftS., BrunakS. Prediction of post-translational glycosylation and phosphorylation of proteins from the amino acid sequence. Proteomics. 2004; 4 :1633–1649.15174133
66. Gai D. , RoyR., WuC., SimmonsD.T. Topoisomerase I associates specifically with simian virus 40 large-T-antigen double hexamer-origin complexes. J. Virol. 2000; 74 :5224–5232.10799598
67. Stewart L. , IretonG.C., ParkerL.H., MaddenK.R., ChampouxJ.J. Biochemical and biophysical analyses of recombinant forms of human topoisomerase I. J. Biol. Chem. 1996; 271 :7593–7601.8631793
68. Henricksen L.A. , UmbrichtC.B., WoldM.S. Recombinant replication protein A: expression, complex formation, and functional characterization. J. Biol. Chem. 1994; 269 :11121–11132.8157639
69. Murakami Y. , WobbeC.R., WeissbachL., DeanF.B., HurwitzJ. Role of DNA polymerase alpha and DNA primase in simian virus 40 DNA replication in vitro. Proc. Natl. Acad. Sci. U.S.A. 1986; 83 :2869–2873.3010320
70. Zegerman P. , DiffleyJ.F. Checkpoint-dependent inhibition of DNA replication initiation by Sld3 and Dbf4 phosphorylation. Nature. 2010; 467 :474–478.20835227
71. Hubner S. , XiaoC.Y., JansD.A. The protein kinase CK2 site (Ser111/112) enhances recognition of the simian virus 40 large T-antigen nuclear localization sequence by importin. J. Biol. Chem. 1997; 272 :17191–17195.9202041
72. Shi Y. , DodsonG.E., MukhopadhyayP.S., ShanwareN.P., TrinhA.T., TibbettsR.S. Identification of carboxyl-terminal MCM3 phosphorylation sites using polyreactive phosphospecific antibodies. J. Biol. Chem. 2007; 282 :9236–9243.17244605
73. Xiao C.Y. , HubnerS., JansD.A. SV40 large tumor antigen nuclear import is regulated by the double-stranded DNA-dependent protein kinase site (serine 120) flanking the nuclear localization sequence. J. Biol. Chem. 1997; 272 :22191–22198.9268364
74. Olsen J.V. , MacekB. High accuracy mass spectrometry in large-scale analysis of protein phosphorylation. Methods Mol. Biol. 2009; 492 :131–142.19241030
75. Olsen J.V. , VermeulenM., SantamariaA., KumarC., MillerM.L., JensenL.J., GnadF., CoxJ., JensenT.S., NiggE.A.et al . Quantitative phosphoproteomics reveals widespread full phosphorylation site occupancy during mitosis. Sci. Signal. 2010; 3 :ra3.20068231
76. Landry C.R. , LevyE.D., MichnickS.W. Weak functional constraints on phosphoproteomes. Trends Genet. 2009; 25 :193–197.19349092
77. Niu S. , WangZ., GeD., ZhangG., LiY. Prediction of functional phosphorylation sites by incorporating evolutionary information. Protein Cell. 2012; 3 :675–690.22802047
78. Madeira F. , PearceM., TiveyA.R.N., BasutkarP., LeeJ., EdbaliO., MadhusoodananN., KolesnikovA., LopezR. Search and sequence analysis tools services from EMBL-EBI in 2022. Nucleic Acids Res. 2022; 50 :W276–W279.35412617
79. Pipas J.M. Mutations near the carboxyl terminus of the simian virus 40 large tumor antigen alter viral host range. J. Virol. 1985; 54 :569–575.2985819
80. Simmons D.T. SV40 large T antigen functions in DNA replication and transformation. Adv. Virus Res. 2000; 55 :75–134.11050941
81. Fanning E. , ZhaoK. SV40 DNA replication: from the A gene to a nanomachine. Virology. 2009; 384 :352–359.19101707
82. Simmons D.T. Modeling of the SV40 DNA Replication Machine. Genes (Basel). 2012; 3 :742–758.24705083
83. Simmons D.T. , GaiD., ParsonsR., DebesA., RoyR. Assembly of the replication initiation complex on SV40 origin DNA. Nucleic Acids Res. 2004; 32 :1103–1112.14960720
84. Yardimci H. , WangX., LovelandA.B., TappinI., RudnerD.Z., HurwitzJ., van OijenA.M., WalterJ.C. Bypass of a protein roadblock by a replicative DNA helicase. Nature. 2012; 492 :205–209.23201686
85. Wang H. , GuanJ., WangH., PerraultA.R., WangY., IliakisG. Replication protein A2 phosphorylation after DNA damage by the coordinated action of ataxia telangiectasia-mutated and DNA-dependent protein kinase. Cancer Res. 2001; 61 :8554–8563.11731442
86. Bartek J. , LukasJ. DNA damage checkpoints: from initiation to recovery or adaptation. Curr. Opin. Cell Biol. 2007; 19 :238–245.17303408
87. Roy R. , TrowbridgeP., YangZ., ChampouxJ.J., SimmonsD.T. The Cap region of topoisomerase I binds to sites near both ends of simian virus 40 T antigen. J. Virol. 2003; 77 :9809–9816.12941889
88. Wang M. , ParkJ.S., IshiaiM., HurwitzJ., LeeS.H. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis. Nucleic Acids Res. 2000; 28 :4742–4749.11095685
89. Zhou B. , ArnettD.R., YuX., BrewsterA., SowdG.A., XieC.L., VilaS., GaiD., FanningE., ChenX.S. Structural basis for the interaction of a hexameric replicative helicase with the regulatory subunit of human DNA polymerase α-primase. J. Biol. Chem. 2012; 287 :26854–26866.22700977
90. Gai D. , ZhaoR., LiD., FinkielsteinC.V., ChenX.S. Mechanisms of conformational change for a replicative hexameric helicase of SV40 large tumor antigen. Cell. (2004); 119 :47–60.15454080
91. McVey D. , WoelkerB., TegtmeyerP. Mechanisms of simian virus 40 T-antigen activation by phosphorylation of threonine 124. J. Virol. 1996; 70 :3887–3893.8648725
92. Gai D. , WangD., LiS.-X., ChenX.S. The structure of SV40 large T hexameric helicase in complex with AT-rich origin DNA. eLife. 2016; 5 :e18129.27921994
93. Kim S.M. , HubermanJ.A. Regulation of replication timing in fission yeast. EMBO J. 2001; 20 :6115–6126.11689451
94. Liu S. , OpiyoS.O., MantheyK., GlanzerJ.G., AshleyA.K., AmerinC., TroksaK., ShrivastavM., NickoloffJ.A., OakleyG.G. Distinct roles for DNA-PK, ATM and ATR in RPA phosphorylation and checkpoint activation in response to replication stress. Nucleic Acids Res. 2012; 40 :10780–10794.22977173
95. Fisk J.C. 2006; University at Buffalo, The State University of New York.
96. Jiang X. , KlimovichV., ArunkumarA.I., HysingerE.B., WangY., OttR.D., GulerG.D., WeinerB., ChazinW.J., FanningE. Structural mechanism of RPA loading on DNA during activation of a simple pre-replication complex. EMBO J. 2006; 25 :5516–5526.17110927
