
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00807-1
10.1016/j.psj.2024.104228
104228
GENETICS AND MOLECULAR BIOLOGY
The first emergence of paramyxovirus type 12 in wild birds in mainland, China
Ge Ye geye_perfect@126.com
⁎
Zhou Yan *
Peng Peng ‡
Li Yuanguo †
Huo Miaotong *
Liu Jing *
Yu Jiantao *
Shao Peipei *
Xu Hualin §
Liang Xiaodong ║
Yao Qiucheng yqc198292@163.com
⁎1
Gao Yuwei yuwei0901@outlook.com
†
⁎ College of Coastal Agricultural Sciences, Guangdong Ocean University, Zhanjiang, 524088, China
† State Key Laboratory of Pathogen and Biosecurity, Key Laboratory of Jilin Province for Zoonosis Prevention and Control, Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Changchun, 130122, China
‡ Center for Biological Disaster Prevention and Control, National Forestry and Grassland, 110034, China
§ Guangdong Neilingding Futian National Nature Reserve Administration Bureau, Shenzhen, Guangdong Province, 518040, China
║ Wildlife and Plant Conservation Office, Forestry Administration of Guangdong Province, Guangzhou, 510173, China
1 Corresponding author: yqc198292@163.com
23 8 2024
11 2024
23 8 2024
103 11 10422814 5 2024
13 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Avian paramyxoviruses (APMV) belong to the subfamily Avulavirinae of the family Paramyxoviridae and include 22 distinct subtypes or serotypes (1–22). Avian paramyxovirus serotype 12 (APMV-12) is found sporadically in wild birds worldwide, and reports from only Italy and Taiwan have been published to date; information on its genetic variation and biological characteristics is still limited. In this study, 3 APMV-12 strains, designated WB19, LY9, and LY11, were isolated from 8643 wild bird faecal samples during the annual influenza virus surveillance of wild birds in Guangdong, China between 2018 and 2024, which is first reported in mainland China. The complete genomes of the 3 viruses with 6 gene segments, 3′-N-P-M-F-HN-L-5′, were 15,231 nt in length. Phylogenetic analysis based on the whole genome showed that the 3 APMV-12 strains had the highest homology with an APMV-12 strain isolated from Taiwan in 2015, followed by the prototype APMV-12 strains isolated from mallard ducks in Italy in 2005. Genetic analysis of the whole gene of each of them indicated that they were derived from a Eurasian lineage. This study provides additional evidence that wild birds transmit viruses between countries, and this should be monitored to understand APMV transmission, evolution and epidemiology.

Key words

Avian paramyxovirus
APMV-12
phylogenetic analysis
epidemiological
molecular characteristic
==== Body
pmcINTRODUCTION

Avian paramyxovirus (APMV) belongs to the Avulavirinae subfamily of Paramyxoviridae and carries a nonsegmented, negative-sense, single-stranded RNA genome ranging from 14,904 to 17,412 nucleotides (nt) in length (Aziz Ul et al., 2018). Previously, APMV were mainly genetically classified by serological identification and amino acid sequences of large (L) polymerase proteins, and genetic diversity is now reflected by phylogenetic analyses of complete genomes (Karamendin et al., 2016, Liu et al., 2020, Reeves et al., 2016). The genomes of most APMVs encode at least 6 proteins, namely, nucleocapsid protein (NP), phosphoprotein (P), matrix protein (M), fusion protein (F), haemagglutinin-neuraminidase (HN), and large polymerase (L), and the sequence of the genes for these proteins in the genome is 3′-N-P-M-F-HN-L-5′ (Subbiah et al., 2008). Whilst a full understanding of virulence determinants remains undefined, virulence is at least partly influenced by cleavage of the viral F protein which in turn is driven by the composition of amino acids present within a defined cleavage site (CS) (Ross et al., 2023)

APMVs include 22 distinctive subtypes or serotypes (1–22) that cause different degrees of clinical symptoms in birds (Liu et al., 2022). Among these serotypes, APMV-1, APMV-2, APMV-4 and APMV-6 have high rates of virus isolation and wide bird distribution. APMV-1 is commonly referred to as Newcastle disease virus, which is a highly contagious avian infectious disease that is reportable to the World Health Organization (WHO). This disease has a broad host range, and more than 240 species of birds can be infected worldwide (Liu et al., 2019). APMV-2 was first isolated from a chicken coinfected with infectious laryngotracheitis virus in 1956. It has subsequently been identified in chickens, turkeys, and wild birds worldwide (Bankowski et al., 1960). APMV-2 mainly affects hatchability and broiler production in turkeys. Since the 1960s, many APMV-3 strains have been isolated from Turkey (Yoshida and Samal, 2017). APMV-3 is usually considered an asymptomatic infection in chickens but has a high mortality rate in caged birds because of encephalitis (Nayak et al., 2013). APMV-4 is frequently isolated from waterfowl worldwide, and experimental infection of chickens can result in mild interstitial pneumonitis and catarrhal bronchitis. APMV-6 was isolated from domestic ducks in Hong Kong in 1977 and causes mild respiratory symptoms and decreased reproductive function in poultry and turkeys (Klink et al., 2023). Other subtypes of APMV have relatively low infection rates and are found mainly in ducks, geese, gulls, and penguins. Infection causes a range of symptoms that vary depending on the host. However, little is known about their impact due to the limited amount of data available. APMV-5 was first isolated from a budgerigar in Japan in 1975; APMV-7 was first isolated from a pigeon in the United States in 1975; APMV-8 was first isolated from a goose in Canada in 1976; APMV-9 was first isolated from a mallard in Japan in 2009; APMV-10 was first isolated from a penguin in the United Kingdom in 2007; APMV-11 was first isolated from a wild bird in France in 2010; and a few isolates of APMV-13-22 have been isolated in the last 10 years. APMV-12 was first found in wigeons in Italy in 2005 (APMV/wigeon/Italy/3920-1/2005 [APMV-12]). In 2015 and 2019, 2 APMV-12 strains were isolated from migratory birds in Taiwan. Intracerebral pathogenicity index tests in 1-day-old chicks showed that APMV-12 was less toxic or nontoxic to chickens, similar to lentogenic NDV (Yamamoto et al., 2015).

In this study, we isolated 3 strains of pelican-derived APMV-12. For the first time, we conducted evolutionary assessments of the genetic diversity of globally circulating APMV strains, which will promote a better understanding of global epidemiology and ecology and future prevention and control of these viruses. This study provides a second piece of evidence for the transmission of APMV among wild birds.

MATERIALS AND METHODS

Sample Collection

The samples used were fresh faeces collected within the nature reserve of Guangdong, China. The faecal samples were collected aseptically and quickly loaded into 5 ml tubes containing virus protection solution (PBS containing 1,000 U/ml penicillin and 2,000 mg/ml streptomycin). The EP tubes were placed in a portable refrigerator at 4°C, transported to the laboratory within 24 h, and frozen immediately at −80°C.

Virus Isolation and Identification

Virus isolation from faecal samples was performed according to OIE procedures. The SPF chicken embryos used for virus proliferation were purchased from Boehringer Ingelheim Viton Biotechnology. Faecal samples were inoculated into the allantoic cavity of 9 to 10-day-old SPF chicken embryos and incubated at 37°C for 72 h. Allantoic fluid was collected from each inoculated embryo and checked for haemagglutination activity (HA). If no HA activity was detected, a second pass was performed. HA-positive allantoic fluid was further analysed. The erythrocytes of the SPF chickens used for the haemagglutinin inhibition (HI) test, M-MLV reverse transcriptase and r-Taq enzyme were purchased from Takara Bio (Takara, Japan). RT‒PCR product purification was performed with an Ultra-thin Agarose Gel DNA Recovery Kit (DP208) from Tengen Biochemical Technology (Beijing).

RNA Extraction and Sequence Analysis

Viral RNA was extracted from infected allantoic fluid according to the instructions of a Baypure Universal Magnetic Bead Method Viral DNA/RNA Rapid Extraction Kit. Reverse transcription of the viral genome was performed according to the instructions. The RT‒PCR method for identifying the virus genome was as follows. The cycling parameters were heating at 98°C for 10 s, denaturation at 98°C for 10 s, annealing at 54°C for 30 s, extension at 72°C for 1 min, and storage at 4°C. PCR products were separated by 1% agarose gel electrophoresis, stained with ethidium bromide, and visualized by UV fluoroscopy. Based on the nucleotide sequences of the corresponding gene fragments found in GenBank, primers were designed with Prime5 software and then synthesised by Sangon Bioengineering (Shanghai), and the primers were kept in our laboratory. The RT‒PCR primers used are shown in Table 1.Table 1 List of RT-PCR primers.

Table 1Designation	Primer sequence (5′–3′)	Position in reference sequence	Fragment size (bp)	
APMV1-F	TGTGAGTTGTTGACATAGGGAG	2,793–2,814	588	
APMV1-R	CAAAGCCGCAATGAAGGA	2,227–2,244	
APMV2-F	ACTATTGCGGATGACAGGGA	750–769	515	
APMV2-R	CGGAGACGAGGTGGAACTTTAT	255–276	
APMV3-F	GGTATCGGTAAATGTTGCCA	1,833–1,852	1,727	
APMV3-R	CGTCTGTTTTCGCTGAGTATG	126–146	
APMV4-F	ATTTGATGGCTGCGACTG	3,731–3748	1,917	
APMV4-R	ATGGCAACATTTACCGATACC	1,832–1,852	
APMV6-F	AAACCACCATAAACAGCAAAC	7,399–7,419	1,865	
APMV6-R	TTACGGTAGGCACTCTGATTG	5,555–5,575		
APMV7-F	AGTGGCATCAGATTTGGAA	9,249–9,267	1,868	
APMV7-R	TTTGCTGTTTATGGTGGTTT	7,400–7,419		
APMV8-F	TCTCCCTTAGTTTCAAATTGTG	10,868–10,889	1,910	
APMV8-R	GTTCCATACTGATTGGTCCC	8,980–8,999		
APMV9-F	TGCCCTGAAGACAGTCACAT	12,666–12,685	1,930	
APMV9-R	ATCCACGAAAGAGGTCCACT	10,756–10,775		
APMV10-F	CAGGGCAGTATCAATGTTATG	14,564–14,584	1,814	
APMV10-R	TTGTCAGTTACGACGAGGAG	12,771–12,790		
APMV11-F	AAAGATTTGGTGAATGACGC	15,202–15,221	806	
APMV11-R	ACAGGCAGCAAAGCAACA	14,416–14,433		
APMV12-F	ACGACATCTTGAGACTTTTGAG	11,746–11,767	1,392	
APMV12-R	AGAAGGACTTGGCTTGACAG	13,118–13,137		
APMV13-F	CCTCCAAGTTCATAGAGCATC	6,918–6,938	1,322	
APMV13-R	GAAGGGGCTTTCTACAACTG	8,220–8,239		
APMV14-F	GCATCTTCCCGATTTTCC	4,477–4,494	1,355	
APMV14-R	AGTGCTTCCCCATAGTTCTG	5,812–5,831		
APMV15-F	CCACCAATGTCTAAGAGCAA	3,185–32–4	1,478	
APMV15-R	ACTCCAGGTGCGTTACTA	4,645–4,662		
APMV16-F	GAATCTGTAAGGTACGTTATCAGG	11–34	751	
APMV16-R	GGATGACAGGGAATAGTAGGAA	740–761		
APMV17-F	AGTTCCTACTATTCCCTGTCATC	738–760	1,517	
APMV17-R	CTTGGTTGGGTCCTTCATT	2,236–2,254		

Molecular Characterization and Phylogenetic Analysis

Sequence editing was performed using the Lasergene 6.0 software package (DNASTAR, Madison, WI). The whole-genome sequences of the APMV-12 strains isolates were blast in GenBank. Potential glycosylation sites of F proteins were predicted using the online bioinformatics tool NetNGlyc server. The entropy values of each amino acid site of the F proteins were calculated using BioEdit v7.2.3 (IbisBiosciences, Carlsbad, CA). The amino acid mutation sites of F proteins were searched using MEGA 6.0. Selective pressure analysis of the F genes of various subtypes of APMV strains and strains isolated in this study was performed using Launch DnaSP6 software. The typical sequences of APMV were downloaded from the GenBank database. The nucleotide sequences were edited using the SeqMan module of the DNAstar package, and phylogenetic analyses were performed with MEGA 7.0 maximum likelihood trees. Bootstrap values of 1000 were used. Multiple sequence alignments were compiled using ClustalW in MegAlign of DNAstar.

RESULTS

Sampling, Virus Isolation of APMV-12

In 2018 to 2024, Three APMV-12 strains across 8643 wild bird faeces were isolated from Nansha Bird Park of Guangzhou, and Neilingding Island, Futian Nature Reserve, Guangdong Province, China. Two of the viruses were isolated from pelicans, Nansha Bird Park, and the other one was from wild duck, Neilingding Island, Futian Nature Reserve. The abbreviations used for the 3 APMVs were APMV-12/pelican/China/LY9/2019 (abbreviated LY9), APMV-12/pelican/China/LY11/2019 (abbreviated LY11), and APMV-12/wild duck/China/WB19/2019 (abbreviated WB19). The genome lengths of the three strains LY9, LY11, and WB19 were all 15231kb. A total of 493 amino acids were encoded by the NP gene, the P gene encoded 403 amino acids, the M gene encoded 364 amino acids, the HN gene encoded 616 amino acids, and the L gene encoded 2199 amino acids. The F genes of the 3 strains encoded 543 amino acids, which is consistent with that of the Taiwanese isolates APMV-12/Anseriformes/Taiwan/AHRI101/2015.

Genetic Characterization of APMV-12

The F genes of the 3 APMV-12 strains isolated in this study contained 6 potential glycosylation sites, namely, 76NET, 96NAT, 182NKT, 357NLT, 438NLT, and 462NQS, as determined by the online bioinformatics tool NetNGlyc server. The F protein has a single basic residue, arginine (R) at position -1 in the F cleavage site sequence and was unusual in that it has an alanine at position +2 (LPSSR↓FA), which indicates that these 3 APMV-12 strains have low pathogenicity to avians. A comparison of the 3 APMV-12 strains isolated in this study and the 2 APMV-12 strains isolated in Taiwan in 2005 revealed that in the F gene (fusion protein) region of the sequence, many sites were mutated, namely, F5L, I62V, R183K, A343S, V500I, and V534A. The entropy value of each amino acid site of the F gene was calculated using BioEdit v7.2.3 (IbisBiosciences, Carlsbad, CA) to find the relatively conserved regions of amino acids and mutation-prone sites. The entropy values ranged from 0 to 4.392, and the entropy values of the 3 strains were 0.56234 (<0.600), which was a conservative size and therefore not easily mutated. The relatively conserved amino acid regions were 6 to 61, 63 to 182, 184 to 342, 344 to 499, and 501 to 533. Launch DnaSP6 software revealed that the F gene of APMV had dN = 0.47068, dS = 0.46403, and dN/dS = 1.014 > 1, which indicates that positive selection pressure was experienced.

Phylogenetic Analysis of APMV-12

According to the phylogenetic tree of APMV, APMV can be divided into different branches according to subtype. Phylogenetic analysis of the whole gene sequences of the 3 APMV-12 strains isolated in this study and other subtypes of APMV strains was performed. Phylogenetic tree analysis revealed that 3 strains of APMV-12 strains had the highest homology with APMV-12 viruses isolated from the Taiwan Anseriformes in 2015 and 2019, followed by that with the APMV-12 strainsisolated from mallard ducks in Italian (Table 2). The phylogenetic distance with the closest genetic distance to other subtypes was APMV-13, and that with the furthest was APMV-4 (Figure 1).Table 2 the identity of the 6 APMV-12 viruses.

Table 2Virus name/identity (%)	LY11/2020	LY9/2020	WB19/2019	AHRI101/2015	Taiwan/AHRI143/2019	Wigeon/Italy/3920_1/2005	
LY11/2020	-	99.9	99.9	96.8	90.6	64.6	
LY9/2020		-	99.9	96.9	90.6	64.6	
WB19/2019			-	96.8	90.5	64.6	
Taiwan/AHRI101/2015				-	91.6	64.6	
Taiwan/AHRI143/2019					-	64.6	
Wigeon/Italy/3920_1/2005						-	

Figure 1 Phylogenetic analysis of the surface genes of APMV using the maximum likelihood method. The red color strains isolated in this study were APMV-12. The evolutionary history was inferred by using the Maximum Likelihood method based on the Tamura-Nei model. The tree with the highest log likelihood (-411219.17) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the maximum composite likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. The analysis involved 70 nucleotide sequences. All positions containing gaps and missing data were eliminated. There was a total of 12300 positions in the final dataset. Evolutionary analyses were conducted in MEGA7.

Figure 1

Epidemiologic Characteristics and Distribution of Avian Paramyxovirus

From 1948 to 2023, APMV, also known as avian Newcastle disease virus (NDV), was distributed in 52 countries and regions (China, Japan, the United States, Russia, etc.), with a total of 16,684 cases. More than half of the top ten countries for APMV incidence were Asian countries, accounting for approximately 58% of the total number of cases, including 125 cases (19.5%) in Japan, which had the highest number of reported APMV cases, followed by Russia (55 cases, 8.5%) (Figure 2).Figure 2 Geographic distribution of APMV.

Figure 2

The number of APMV cases increased gradually from 1997 to 2012 and then decreased. From 2010 to 2012, the number of AMPV isolates peaked. In 2016, the highest number of cases (67) was reported. During the decade 2010–2019, the global number of APMV reports accounted for 57.8% (370 cases) of the overall number of cases (Figure 3). As of 2023, a total of 11306 APMV-1 strains have been reported in the National Center for Biotechnology Information (NCBI) GenBank, which is the largest among all APMV subtypes. In addition, the second and third largest reported numbers were of 165 APMV-4 viruses and 82 APMV-2 viruses. To date, 3 APMV-12 strains have been isolated from Italy and Taiwan, China.Figure 3 Chronological distribution of APMV-12 isolates.

Figure 3

Between 1948 and 2022, the number of APMV cases in ducks accounted for 19.5% (125 cases) of the total number of host infections, followed by chickens, accounting for 9.5% (61 cases). The infection rates of some domesticated waterfowl and wild waterfowl were both high. The number of infections in wild birds accounted for 27.6% (179) of the total number of cases. Cases in some birds, such as slender-billed gulls, black-headed gulls and golden eagles, have also been reported (Figure 4).Figure 4 Host distribution of APMV.

Figure 4

DISCUSSION

APMV was first discovered in 1926, and since then, this disease has been reported in many countries worldwide (Dimitrov et al., 2016; Ganar et al., 2014). APMV was the most devastating disease agent in the animal kingdom, with mortality rates approaching 100% for Newcastle disease caused by strong strains of APMV-1, and these viruses may also cause clinical symptoms that can lead to conjunctivitis in humans (Ross et al., 2022; Hussain et al., 2020; Hicks et al., 2019). In China, APMV was first isolated from pigeons in Hong Kong in 1985 (Zhang et al., 2022). Both dispersal and expansion of the distribution of wild birds and poultry occur through the migration of wild birds. The highest number of APMV reports was from 2010 to 2019, with a gradual downwards trend from 2019 to the present, indicating signs of APMV containment (Figure 3). APMV host species are very diverse. According to the sequence database, the viruses mainly originated from poultry, accounting for 59.7% of the total number of reported cases (648). Additionally, APMV is prevalent in various types of game birds, such as Pacific black crows, green-winged ducks, penguins, and white-fronted geese.

There are 9 migratory routes around the world. There are 3 routes across China: the "East Africa-West Asia Migratory Route," the "Central Asia Migratory Route," and the "East Asia/Australia Migratory Route." Wild birds spread APMV from 1 country to another or from 1 continent to another, which allows the virus to spread and recombine. Nearly half of the migratory routes cross China, which is likely the reason for the highest number of APMV reports in China (Chai et al., 2022). Wild birds stop to rest and feed during their migration to reserve energy for subsequent migrations, which causes many birds to congregate. Additionally, wild birds often mingle around poultry farms, creating the conditions for APMV surveillance among wild birds and poultry and other populations, thereby promoting and sustaining the spread of APMV (Gaidet, 2016; Verhagen et al., 2021). In this study, the whole-genome sequences of 3 wild bird-originating APMV strains were determined and identified as the APMV-12 subtype, which represents the first report of APMV-12 in mainland China. Based on phylogenetic tree analysis, all 3 APMV-12 strains isolates obtained in this study were closely related to those obtained from migratory birds in Taiwan.

Two of 3 strains of the APMV-12 strains were isolated from pelicans living in Nansha Bird Park in Guangdong Province, where birds do not migrate for an entire year. the other 1 was isolated from wild duck overwintering in Guangdong Neilingding Futian National Nature Reserve. After investigation and discussion, it was determined that the cause of APMV-12 infection in the 2 pelicans might be related to frequent foraging in the nearby Nansha wetland. The Nansha Wetland Reserve has more migratory birds in winter and spring. APMV-12 in pelicans may have been spread by water and food sharing with migrating birds in the same area. The distance between Guangdong Neilingding Futian National Nature Reserve and Nansha Bird Park was only 100 kilograms. The wild birds could fly freely among Nansha Bird Park, Nansha wetland and Guangdong Neilingding Futian National Nature Reserve, which suggested the disease could spread by birds fly action.

The fusion gene (F) is one of the most variable genes of the APMV genome and is responsible for virus‒cell fusion and syncytium formation and plays a key role in viral virulence and pathogenicity (Ross et al., 2023; Subbiah et al., 2011). It has also been suggested that selection and recombination both influence the evolution of APMVs. Previous studies performed using the APMV 1–20 database and the NDV database have shown that the F gene is relatively highly positively selected. The entropy values of the amino acid sites corresponding to the F gene sequences of the APMV-12 strains isolated in this study showed that the frequency of amino acid variations at these sites was greater (Figure 5). The peaks of the regions and loci in the entropy plots reflect the mutation status of the F gene of the APMV-12 strain at 3 different amino acid positions in this study. Most of the entropy values of the APMV-12 strains were relatively dispersed, none of them were prone to mutation, so the mutation frequency was much lower. The F gene of APMV-12 contains glycosylation sites, which play important roles in viral invasion into the host cell and in the process of viral replication. Selection pressure on avian paramyxoviruses is considered a positive selection pressure, under which the virus selects for mutations suitable for its own survival and accumulates such mutations suitable for its own development, resulting in the production of new types of viruses better suited to the survival of the population. Since APMV identification and isolation have largely been based on AIV surveillance efforts, it is difficult to determine the exact location and emergence of the virus. Further studies are needed to assess the host specificity, prevalence, and pathogenicity of the virus to detect novel paramyxoviruses in outbreaks and diseases of unknown aetiology.Figure 5 Amino acid mutations in avian paramyxovirus type 12. The axis indicates the sequence of amino acid sites of the APMV-12 strain, and the vertical axis indicates the size of the entropy value of a site; the larger the peak of the site is, the higher the entropy value.

Figure 5

DISCLOSURES

The authors in this manuscript declare that they have no conflicts of interest.

ACKNOWLEDGMENTS

We thank the researchers and laboratories who submitted the sequences to the NCBI databases. This work was supported by the Natural Resource Affairs (Ecological Forestry Construction) Project of the Guangdong Forestry Department (grant number K23051 ).
==== Refs
REFERENCES

Aziz Ul R. Munir M. Shabbir M.Z. Comparative evolutionary and phylogenomic analysis of Avian avulaviruses 1-20 Mol. Phylogenet. Evol. 127 2018 931 951 29958982
Bankowski RA. Corstvet R.E. Clark G.T. Isolation of an unidentified agent from the respiratory tract of chickens Science 132 1960 292 293 13796452
Chai H. Li X. Li M. Lv X. Yu W. LI Y. Sun J. Li Y. Sun H. Tian J. Xu Y. Bai X. Peng P. Xie L. Qin S. An Q. Zhang F. Zhang H. Du J. Yang S. Hou Z. Zeng X. Wang Y. Richt JA. Wang Y. LI Y. Ma J. Emergence, Evolution, and Pathogenicity of Influenza A(H7N4) Virus in Shorebirds in China J. Virol. 96 2022 e0171721
Dimitrov K.M. Ramey A.M. Qiu X. Bahl J. Afonso C.L. Temporal, geographic, and host distribution of avian paramyxovirus 1 (Newcastle disease virus) Infect. Genet. Evol. 39 2016 22 34 26792710
Gaidet N. Ecology of avian influenza virus in wild birds in Tropical Africa Avian Dis 60 2016 296 301 27309070
Ganar K. Das M. Sinha S. Kumar S. Newcastle disease virus: Current status and our understanding Virus Res. 184 2014 71 81 24589707
Hicks J.T. Dimitrov K.M. Afonso C.L. Ramey A.M. BAHL J. Global phylodynamic analysis of avian paramyxovirus-1 provides evidence of inter-host transmission and intercontinental spatial diffusion BMC Evol. Biol. 19 2019 108 31126244
Hussain A. Wajid A. Ather S. Alyas K. Awais M. Khan MR. Hussain T. Babar ME. Isolation and genetic characterization of virulent strains of avian paramyxovirus-1 from multiple avian species in Azad Jammu and Kashmir 2017-2018 Braz. J. Microbiol. 51 2020 385 394 31768926
Karamendin K. Kydyrmanov A. Seidalina A. Asanova S. Daulbayeva K. Kasymbekov Y. Khan E. Fereidouni S. Starick E. Zhumatov K. Sayatov M. Circulation of avian paramyxoviruses in wild birds of Kazakhstan in 2002–2013 Virol. J. 13 2016 23 26846092
Klink A.C. Rula O. Sushko M. Bezymennyi M. Mezinov O. Gaidash O. Bai X. Stegniy A. Sapachova M. Datsenko R. Skorokhod S. Nedosekov V. Hill N.J. Ninua L. Kovalenko G. Ducluzeau A.L. Mezhenskyi A. Buttler J. Drown D.M. Causey D. Stegniy B. Gerilovych A. Bortz E. Muzyka D. Discovery of avian paramyxoviruses APMV-1 and APMV-6 in shorebirds and waterfowl in Southern Ukraine Viruses. 15 2023 699 36992408
Liu Y.P. Kuo S.T. Chiou C.J. Terregino C. Tsai H.J. Novel avian metaavulavirus isolated from birds of the family Columbidae in Taiwan Vet. Microbiol. 236 2019 108377
Liu Y.P. Chang C.Y. Lee F. Chiou C.J. Tsai HJ. Phylogenetic analysis of avian paramyxoviruses 1 isolated in Taiwan from 2010 to 2018 and evidence for their intercontinental dispersal by migratory birds J. Vet. Med. Sci. 82 2020 1366 1375 32655100
Liu Y.P. Lee F. Cheng M.C. Chang C.Y. Chiou C.J. Tsai H.J. Genetic diversity of avian paramyxoviruses isolated from wild birds and domestic poultry in Taiwan between 2009 and 2020 J. Vet. Med. Sci. 84 2022 378 389 35082196
Nayak B. Nayak S. Paldurai A. Kumar S. De Nardi R. Terregino C. Collins PL. Samal S.K. Evaluation of the genetic diversity of avian paramyxovirus type 4 Virus Res. 171 2013 103 110 23178589
Reeves A.B. Poulson R.L. Muzyka D. Ogawa H. Imai K. Bui V.N. Hall J.S. Pantin-jackwood M. Stallknecht D.E. Ramey A.M. Limited evidence of intercontinental dispersal of avian paramyxovirus serotype 4 by migratory birds Infect Genet. Evol. 40 2016 104 108 26925702
Ross C.S. Mahmood S. Skinner P. Mayers J. Reid S.M. Hansen R.D.E. Banyard A.C. JMM profile: Avian paramyxovirus type-1 and Newcastle disease: a highly infectious vaccine-preventable viral disease of poultry with low zoonotic potential J. Med. Microbiol. 71 2022
Ross C.S. Sutton D. Skinner P. Mahmood S. Wynne F. Londt B. Fuller C.M. Mayers J. Nunez A. Hicks D.J. Brookes S.M. Banyard A.C. Brown I.H. Comparative pathogenesis of two genotype VI.2 avian paramyxovirus type-1 viruses (APMV-1) in pheasants, partridges and chickens Avian Pathol. 52 2023 36 50 36205531
Subbiah M. Xiao S. Collins P.L. Samal S.K. Complete sequence of the genome of avian paramyxovirus type 2 (strain Yucaipa) and comparison with other paramyxoviruses Virus Res. 137 2008 40 48 18603323
Subbiah M. Khattar S.K. Collins P.L. Samal S.K. Mutations in the fusion protein cleavage site of avian paramyxovirus serotype 2 increase cleavability and syncytium formation but do not increase viral virulence in chickens J. Virol. 85 2011 5394 5405 21450835
Verhagen J.H. Fouchier R.A.M. Lewis N. Highly pathogenic avian influenza viruses at the wild-domestic bird interface in Europe: Future directions for research and surveillance Viruses 13 2021 212 33573231
Yamamoto E. Ito H. Tomioka Y. Ito T. Characterization of novel avian paramyxovirus strain APMV/Shimane67 isolated from migratory wild geese in Japan J. Vet. Med. Sci. 77 2015 1079 1085 25866408
Yoshida A. Samal S.K. Avian paramyxovirus Type-3 as a vaccine vector: Identification of a genome location for high level expression of a foreign gene Front. Microbiol. 8 2017 693 28473820
Zhang Y. Wang W. Li Y. Liu J. Wang W. Bai J. Yang Z. Liu H. Xiao S. A pigeon paramyxovirus type 1 isolated from racing pigeon as an inactivated vaccine candidate provides effective protection Poult. Sci. 101 2022 102097
