
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00853-8
10.1016/j.psj.2024.104274
104274
IMMUNOLOGY, HEALTH AND DISEASE
The effect of salidroside on the bone and cartilage properties in broilers
Zhang Yanyan
Fan Xiaoli
Ge Hongfan
Yu Yaling
Li Jianzeng
Zhou Zhenlei zhouzl@njau.edu.cn
1
College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
1 Corresponding author: zhouzl@njau.edu.cn
02 9 2024
12 2024
02 9 2024
103 12 1042749 5 2024
24 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Leg disorders frequently occur in fast-growing broiler chickens, constituting severe health and welfare problems. Although salidroside (SAL) promotes osteogenesis and inhibits apoptosis of chondrocytes in rats, it remains to be determined whether SAL can effectively improve bone growth in broilers. The present study was designed to investigate the effects of dietary SAL supplementation on bone and cartilage characteristics in broiler chickens. Ninety-six Arbor Acres broiler chickens were randomly divided into 4 groups: control, low-dose SAL, medium-dose SAL, and high-dose SAL groups. The broiler chickens were raised until 42 d of age, with samples of bone and cartilage collected for biomechanical testing and bone metabolism index detection. The results showed that SAL significantly increased the vertical external diameter, cross-sectional moment of inertia, and cross-sectional area of the femur and tibia. Additionally, SAL enhanced bone mineral density and strength, as evidenced by significant increases in stiffness, Young's modulus, ultimate load, and fracture work of the femur and tibia. Furthermore, SAL influenced the relative content of phosphate, carbonate, and amide I in cortical bone. Moreover, SAL upregulated the expression of osteogenic genes (Collagen-1, RUNX2, BMP2, and ALP) in a dose-dependent manner and maintained the homeostasis of the extracellular matrix (ECM) of chondrocytes. These results indicated that SAL promoted leg health in broilers by improving bone and cartilage quality and enhancing chondrocyte activity.

Key words

Rhodiola rosea extract
chicken
bone strength
bone metabolism
femoral head
==== Body
pmcINTRODUCTION

The intensive farming system significantly increases the growth rate and feed efficiency in broilers (Zuidhof et al., 2014; Dinev et al., 2019; Zhao et al., 2023). However, the skeletal growth in broilers tends to be relatively slow, unable to bear rapid weight gain, leading to a high incidence of leg diseases (Julian, 1998; Guo et al., 2019), such as tibial dyschondroplasia (TD), femoral head necrosis (FHN), rickets, and skeletal deformities (Guo et al., 2019). Broilers affected with leg disorders face challenges in movement and feeding, ultimately resulting in diminished carcass weight, elevated mortality rates, and poor meat quality (Williams et al., 2004; Xu et al., 2022).

The dense cortical bone primaryily supports stress and load-bearing functions. Excessive loading can lead to bone loss, increase cortical porosity, and diminish bone quality (Pathria et al., 2016). Mechanical properties, including bone mineral density and bone strength, as well as the relationship between cancellous and compact bones, serve as critical indicators for assessing bone quality (Mino-Oka et al., 2017). Broilers with leg disease often exhibit decreased bone mineral density and weakened bone strength (Pang et al., 2021). Cartilage, a highly specialized connective tissue, lacks nerves, lymphatics, and blood vessels. Comprising a sparse population of chondrocytes and extracellular matrix, its intricate interplay preserves the cartilage structure's integrity and imparts biomechanical functionality to the tissue (Pathria et al., 2016). Disruption of cartilage homeostasis, chondrocyte apoptosis, and inadequate cartilage matrix synthesis contribute to the degradation of cartilage quality and increased the incidence of leg diseases (Yu et al., 2022).

In recent years, supplementation of low-cost and highly effective additives in diets to improve bone quality has been addressed fully (Tarlton et al., 2013; Zhao et al., 2023). Salidroside (SAL), a bioactive substance extracted from Rhodiola roots, is a promising additive due to its low toxicity and diverse biological activities, including anti-inflammatory, antioxidant, and anticancer activities (Recio et al., 2016). Recent reports demonstrate that SAL promotes chondrocyte proliferation and inhibits chondrocyte apoptosis (Wu et al., 2019; Sun et al., 2020), accelerates osteogenic differentiation, and bone molding (Chen et al., 2013; Zheng et al., 2018; Xie et al., 2023). However, to our best knowledge, the effect of SAL on cartilage and bone performance in broilers have rarely been reported.

This study aims to assess the effects of dietary supplementation with SAL on FHN incidence, physiological parameters, chemical composition, biomechanical properties, and metabolism indicators of bone as well as cartilage morphology in broilers. The objective of this work was to evaluate SAL's potential as a functional feed additive for enhancing bone development.

MATERIALS AND METHODS

Extraction of SAL

SAL was obtained from Daosifu Biotechnology Co., Ltd. (Nanjing, China). In brief, Rhodiola roots were pulverized and extracted with 50% ethanol under reflux for 3 times, each time for one and a half hours. After filtration, the supernatant was concentrated under reduced pressure to obtain the crude Rhodiola extract (0.25 g/mL). Subsequently, a macroporous resin purification process was used to prepare the dried Rhodiola extract. The column diameter-to-height ratio was 10:1, with a flow rate of 1 BV/h. Finally, SAL was purified using a silica gel chromatography column. The structural formula of SAL is shown in Figure 1A.Figure 1 Schematic diagram of the study design and bone measurement methods. (A) Chemical structure of salidroside (SAL). (B) Schematic diagram showing the study design in broilers. (C) Measurement indicators and locations of femur and tibia. HID: horizontal internal diameter; HED: horizontal external diameter; VID: vertical internal diameter; VED: vertical external diameter.

Figure 1

Animals and Study Design

The Nanjing Agricultural University Institutional Animal Care and Use Committee authorized the methods and broilers used in this study (Permit No: PAT2023050). Hai'an Shuangli Poultry Hatchery provided 96 Arbour Acres broilers (1 d). As depicted in Figure 1B, these broilers (1 day old) were randomly assigned to 4 dietary groups: the control (CON), low-dose SAL (LSAL), medium-dose SAL (MSAL), and high-dose SAL groups (HSAL). These groups were supplemented with different concentrations of SAL (0, 200, 400, and 600 mg/kg of feed). The broilers had unrestricted access to adequate feed and water throughout the experiment. The feed components and nutrient concentrations of the basal diets are detailed in Table 1.Table 1 Feed ingredients and nutrient levels of the basal diets.

Table 1Items	1–21 d	22–42 d	
Ingredients (%)			
Corn	56	63	
Soybean meal	30.5	23	
Corn gluten meal	5	7	
Soybean oil	3.5	3	
Limestone	1.2	0.86	
Dicalcium phosphate	2.05	1.46	
L-Lysine	0.24	0.2	
DL-Methionine	0.21	0.18	
Sodium chloride	0.3	0.3	
Premix1	1	1	
Nutrient levels (%)			
Apparent metabolizable energy (kcal/kg)	3,020	3,090	
Crude protein	21.15	19.56	
Calcium	1	0.92	
Total phosphorus	0.73	0.62	
Available phosphorus	0.45	0.36	
Lysine	1.18	1.08	
Methionine	0.55	0.44	
Methionine + cystine	0.9	0.77	
1 Premix provided per kilogram of diet: vitamin A, 10 000 IU; vitamin D3, 2200 IU; vitamin E, 30 IU; vitamin K3, 1.3 mg; thiamin, 2.2 mg; riboflavin, 8 mg; nicotinamide, 40 mg; choline chloride, 600 mg; calcium pantothenate, 10 mg; pyridoxine. HCl, 4 mg; biotin, 0.04 mg; folic acid, 1 mg; vitamin B12, 0.013 mg; Fe (from ferrous sulfate), 80 mg; Cu (from copper sulfate), 8.0 mg; Mn (from manganese sulfate), 110 mg; Zn (from zinc oxide),60 mg; I (from calcium iodate), 1.1 mg; Se (from sodium selenite), 0.3 mg. LSAL, MSAL and HSAL groups added 200 mg, 400 mg, and 600 mg of SAL per 1 kg of daily feed, respectively.

After the 42-d feeding trial, 8 birds with weights approximately equal to the average weight of each group were chosen for gait assessment and weighing. Blood samples were collected from the wing veins before the broilers were slaughtered by cervical dislocation. The bilateral femoral heads were separated to evaluate FHN and cartilage damage. The femoral heads were either fixed in paraformaldehyde or frozen at −80 °C. The left femurs and tibias were collected for bone mineral density and strength measurements, while the right femur and tibias were weighed and used for bone geometric parameter measurements.

Leg Health Assessment

According to previous descriptions, gait scoring was performed in broilers before slaughter (Kestin et al., 1992). FHN scoring was carried out according to the severity of the disease (Yu et al., 2022). Briefly, the normal femoral head score is 0 points; The separation of the femoral head joint cartilage and the growth plate is scored as 1 point; Rupture of the femoral head and fracture of the epiphysis are recorded as 2 points. Consider femoral heads with scores of 1 and 2 as having necrosis and calculate the incidence of FHN. In accordance with the scoring criteria established by the International Cartilage Repair Society (ICRS), the extent of cartilage damage in the femoral head was assessed (Yu et al., 2022).

Osteometric and Geometric Parameters

As shown in Figure 1C, the length, proximal epiphysis width, distal epiphysis width, vertical external diameter, vertical internal diameter, horizontal external diameter, and horizontal internal diameter of the femur and tibia were measured using a precision vernier caliper (Shanghai Hengliang Measurement Tools Co., Ltd., Shanghai, China). Following previously described methods, the mean relative wall thickness, cortical cross-sectional area, cortical index, moment of inertia, and radius of gyration were calculated (Wojciechowska-Puchałka et al., 2023).

Measurement of Cartilage Parameters

The cartilage on the surface of the femoral head was separated, removed surface moisture, and weighed (W1). The diameter and central thickness of the cartilage were measured. Subsequently, the cartilage was placed in a vacuum freeze dryer (LGJ-12D, Beijing, China) for 24 h, then weighed again (W2). The water content of the cartilage was calculated using the formula: [(W1-W2) ÷ W1] × 100%.

Measurement of Bone mineral Density and Bone Strength

The frozen femur and tibia samples were thawed and carefully stripped of soft tissues adhering to the bone samples. Bone mineral content (BMC) and bone mineral (BMD) density were measured using a dual-energy X-ray absorptiometer (Medikors, Inc., Gyeonggi-do, Korea). We performed a self-check of the instrument using the manufacturer's calibration items before scanning the samples, then selected the quick detection mode, with the low and high X-ray energy levels set to 40 and 80 kV, respectively. The InAlyzer 1.0 image processing system was used to analyze the BMC and BMD of the overall, proximal, mid, and distal regions of the bone samples. Subsequently, the bones underwent 3-point bending tests using a universal materials testing machine (LR10K PLUS, Lloyd Instruments Ltd., Hampshire, UK) to determine skeletal mechanical parameters. Throughout the testing procedure, the vertical load was consistently applied at a rate of 15 mm/min until the occurrence of bone fracture. Bone strength data were processed using NEXYGEN Plus software.

Histological Analysis

After fixation in paraformaldehyde for 48 h, the femoral heads underwent decalcification, alcohol gradient dehydration, xylene transparency, and paraffin embedding (Pinuofei Biotechnology Co., Ltd., Wuhan, China). The sections were sliced to a thickness of 5 μm and subsequently stained with safranin O-fast green, hematoxylin-eosin (HE), toluidine blue, and alcian blue.

Alkaline Phosphatase Detection

The femoral bone was ground into powder in liquid nitrogen, followed by treatment with tissue lysis buffer (G2002, Servicebio Biotechnology Co., Ltd, Wuhan, China), and then centrifuged to collect the supernatant. The alkaline phosphatase (ALP) content in serum and bone tissue was determined according to the manufacturer's instructions (P0321S, Beyotime Biotechnology Co., Ltd, Shanghai, China). The absorbance values of the samples were measured at a wavelength of 405 nm using a microplate reader (Tecan Co., Ltd., Männedorf, Switzerland).

Real-time PCR

The sequences of the target genes were acquired from the National Center for Biotechnology Information, and primer design was conducted using Primer 5.0 software. The primer sequences are listed in Table 2. Femoral head samples were retrieved from the -80°C freezer, and the cartilage and subchondral bone were separated and ground into fine powder in liquid nitrogen. Total RNA was extracted from the tissues using trizol (RG-51001A, Angle Gene Scientific Co., Ltd., Nanjing China). RNA was reverse transcribed into cDNA following the manufacturer's instructions (TransGen Biotechnology Co., Ltd., Beijing, China). The relative expression levels of the target gene in cartilage and bone tissues were determined using a qPCR assay kit (TransGen Biotechnology Co., Ltd., Beijing, China) following the manufacturer's instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference, and the relative expression levels of the target gene were analyzed using the 2−ΔΔCt method.Table 2 Primer sequences.

Table 2Gene	Primer sequences (5′– 3′)	
Collagen-1	Forward: GTCATTCCACCCCACGTCAT	
	Reverse: GTCATTCCACCCCACGTCAT	
RUNX2	Forward: TTCACAAGCATTTCATCCCTC	
	Reverse: TTGCGGACATACCCAGTGACA	
Collagen-2	Forward: ACCTACAGCGTCTTGGAGGA	
	Reverse: ATATCCACGCCAAACTCCTG	
Collagen-10	Forward: GCCTTCCAGGTCAGCCAGGTAT	
	Reverse: TTGCCGATGCCAACTTCTCCAG	
Aggrecan		
	Forward: TGCAAGGCAAAGTCTTCTACG	
	Reverse: GGCAGGGTTCAGGTAAACG	
BMP2		
	Forward: TGGTGGAGGTGGTTCACTTGGA	
	Reverse: TCCCTTGCCATCATGCCCAAAC	
BMP3		
	Forward: CTGACATTGGCTGGAGCGAGTG	
	Reverse: TCTGGATGGTGGCATGGTTGGA	
MMP-9		
	Forward: GCCATCACTGAGATCAATGGAG	
	Reverse: GATAGAGAAGGCGCCCTGAGT	
MMP-13		
	Forward: AGAGACCCTGGAGCACTGATGT	
	Reverse: GGGATCTCTGTCTCCAGCACCA	
GAPDH		
	Forward: GAACATCATCCCAGCGTCCA	
	Reverse: CGGCAGGTCAGGTCAACAAC	

Western Blot

Total protein from femoral cartilage and cortical bone was extracted using RIPA lysis buffer (G2002, Servicebio Biotechnology Co., Ltd, Wuhan, China). The protein concentration in the tissue was determined using a BCA assay kit (P0012, Beyotime Biotechnology Co., Ltd, Shanghai, China). Tissues were denatured using protein loading buffer (G2075, Servicebio Biotechnology Co., Ltd, Wuhan, China), followed by electrophoresis on SDS-PAGE gel (Yazyme Bio Co., Ltd., Shanghai, China), and then transferred onto PVDF membranes (Millipore Biotechnology Co., Ltd, MA). The protein bands were blocked using the rapid blocking solution (G2052, Servicebio Biotechnology Co., Ltd, Wuhan, China), and then incubated with specific primary antibodies overnight at 4°C, followed by treatment with secondary antibodies at 37°C for 1 h. Between each treatment, the protein bands were washed with TBST (0.1 mL Tween 20 in 100 mL Tris-HCl buffer) for 10 min, 3 times. The intensity of the bands was relatively quantified using Image J software. Details of the antibodies are provided in Supplementary Table S1.

Fourier Transform Infrared Spectrometry

The mid-diaphysis cortical bone of the femur and tibia was ground into powder and examined using Fourier transform infrared spectroscopy (FTIR, Thermo Fisher Co., Ltd., MA). The scanning range was set from 400 to 4,000 cm−1 with a spectral resolution of 4 cm−1. The OMNIC software was utilized to identify and annotate characteristic peaks. The Peak Fit software was employed to separate overlapping peaks for the measurement of peak areas: primary phosphate (v1, v3, PO4; 900–1,200 cm−1), amide I (1,590–1,710 cm−1), and primary carbonate (v2 CO3, 850-890 cm−1; v3 CO3, 1390-1440 cm−1). Following previously described methods (Rodriguez-Navarro et al., 2018; Sanchez-Rodriguez et al., 2019), the relative amounts of minerals to organic matter (PO4/Amide I), carbonate substitution in minerals (v2 CO3/PO4), the ratio of total carbonate to mineral (v3 CO3/PO4), the ratio of carbonate to organic matter (v3 CO3/Amide I), mineral crystallinity index (1030 cm−1/1020 cm−1), and collagen cross-linking content (1,660 cm−1/1,690 cm−1) were calculated.

Statistical Analysis

Statistical analysis of the data was conducted using SPSS version 26.0 software. The incidence of FHN among different groups was assessed using the chi-square test, while other data were analyzed using 1-way analysis of variance (ANOVA) followed by Duncan's post hoc test. Data are presented as mean ± standard error of the mean (SEM). A significance level of P < 0.05 indicated statistical significance for intergroup differences.

RESULTS

Health of Broiler Legs

The gait scores of broilers in different groups were shown in Table 3. Compared to the CON group, broilers supplemented with SAL exhibited reduced gait scores and lower grades of cartilage damage. The evaluation results of FHN in broilers revealed that the incidence of FHN gradually decreased with increasing doses of SAL supplementation. The incidence of FHN was 31.25% in the CON group, while in the HSAL group, it decreased to 6.25% (Table 5). These findings indicated that dietary supplementation of SAL was beneficial for the broilers' leg health. Table 4Table 3 The numbers of broilers with gait score.

Table 3Gait Score	CON	LSAL	MSAL	HSAL	
0	4	5	5	6	
1	3	2	3	2	
2	1	0	0	0	
3	0	1	0	0	
4	0	0	0	0	
5	0	0	0	0	
Note: Gait score 0: The bird walked normally with no detectable abnormality; Gait score 1: The bird had a slight defect which was difficult to define precisely; Gait score 2: The bird had a definite and identifiable defect in its gait; Gait score 3: The bird had an obvious gait defect which affected its ability to move about; Gait score 4: The bird had a severe gait defect; Gait score 5: The bird was incapable of sustained walking on its feet.

Table 4 The numbers of broilers’ legs with cartilage damage grade.

Table 4ICRS Score	CON	LSAL	MSAL	HSAL	
Grade 0	8	9	11	13	
Grade 1	6	6	5	3	
Grade 2	2	1	0	0	
Grade 3	0	0	0	0	
Grade 4	0	0	0	0	
Note: There are 5 levels of cartilage damage, as follows: Grade 0, normal cartilage; Grade 1, nearly normal, with superficial lesions, soft indentation, and/or superficial fissures and cracks; grade 2, abnormal, with lesions extending down to <50% of cartilage depth; Grade 3, severely abnormal, with cartilage defects extending down >50% of cartilage depth as well as down to the calcified layer and down to but not through the subchondral bone; Grade 4, severely abnormal, with cartilage defects extending down to the subchondral bone.

Table 5 Femoral head necrosis (FHN) evaluation and morbidity.

Table 5Group (n = 8)	FHN evaluation score	Total score	Amount	Total morbidity (%)	
	0	1	2				
CON	11	4	1	6	16	31.25	
LSAL	13	3	0	3	16	18.75	
MSAL	14	1	1	3	16	12.50	
HSAL	15	1	0	1	16	6.25	
The morbidity rate was calculated by the number of legs of broilers.

Bone measurements and Geometric Parameters

As depicted in Figures 2A–C, SAL exhibited no significant effect on the relative bone weight, bone length, and distal epiphysis width of the broilers' femur and tibia (P > 0.05). Compared to the CON group, the HASL group showed a significant increase in the proximal epiphysis width of both the femur and tibia in broilers (P < 0.05). Similarly, the MSAL group displayed a significant increase in the proximal epiphysis width of the tibia (P < 0.05, Figure 2D). The low dose of SAL had no significant effect on the distal epiphysis width of the femur in broilers (P > 0.05). The addition of a high dose of SAL significantly increased the horizontal external diameter, the vertical external diameter of the femur, and the vertical external diameter of the tibia (P < 0.05). There were no significant differences in the horizontal and vertical internal diameters between different groups (P > 0.05, Figures 2 E–H).Figure 2 The influence of SAL on osteometric and geometric parameters of the femur and tibia. n = 8 per group. (A) The ratio of bone weight to broiler weight. (B) The length of femur and tibia. (C) Distal epiphysis width of femur and tibia. (D) Proximal epiphysis width of femur and tibia. (E) 3(H) Vertical internal diameter of femur and tibia. (I) Mean relative wall thickness of femur and tibia. (J) Cortical cross-sectional area of femur and tibia. (K) Cortical index of femur and tibia. (L) Moment of inertia of femur and tibia. (M) Radius of gyration of femur and tibia. Various letters indicate statistically significant differences (P < 0.05).

Figure 2

SAL showed no significant effect on the average relative cortical thickness and cortical index of the femur and tibia (P > 0.05, Figures 2I and 2K). Compared to the CON group, the cortical cross-sectional area of the femur significantly increased in the MSAL and HSAL groups (P < 0.05, Figure 2J). Additionally, SAL supplementation significantly increased the moment of inertia and radius of gyration of the femur and tibia (P < 0.05, Figures 2L and 2M).

Bone Biomechanical Properties

As shown in Table 6, Table 7, SAL exhibited a trend of increasing BMC and BMD in the femur and tibia. Compared to the CON group,high-dose SAL significantly increased BMC at the midshaft femur and BMD at both the proximal and distal tibia (P < 0.05, Table 6). Additionally, high-dose SAL significantly increased the midshaft femur's BMC, distal tibia's BMD, and proximal tibia's BMD (P < 0.05, Table 7). In the HSAL group, the stiffness and Young's modulus of the femur and tibia in broilers significantly increased compared to the CON group (P < 0.05). Moreover, Young's modulus of the tibia in the MSAL group also showed a significant increase compared to the CON group (P < 0.05, Figures 3A and 3B). Medium and high doses of SAL increased the ultimate load in the femur and tibia (P < 0.05), while low-dose SAL only improved the tibia's ultimate load (P < 0.05, Figure 3C). SAL had no significant effect on the ultimate stress of the femur (P > 0.05), while medium and high doses of SAL significantly increased the ultimate stress of the tibia (P < 0.05, Figure 3D). Additionally, compared to the CON group, high-dose SAL significantly increased the fracture work in the femur and tibia, while significantly decreasing the ultimate strain of the tibia (P < 0.05, Figures 3E and 3F).Table 6 Bone mineral density of femur.

Table 6Index	CON	LSAL	MSAL	HSAL	P-value	
BMC (g)	Total	1.764 ± 0.043	1.676 ± 0.080	1.864 ± 0.053	1.909 ± 0.059	0.048	
Proximal femur	0.396 ± 0.012	0.385 ± 0.011	0.396 ± 0.011	0.441 ± 0.026	0.090	
Middle part of femur	0.839 ± 0.021b	0.847 ± 0.034b	0.979 ± 0.034a	1.050 ± 0.029a	0.000	
Distal femur	0.349 ± 0.019	0.357 ± 0.020	0.401 ± 0.021	0.414 ± 0.013	0.048	
BMD (g/cm2)	Total	0.187 ± 0.002	0.185 ± 0.004	0.190 ± 0.004	0.190 ± 0.004	0.705	
Proximal femur	0.155 ± 0.005b	0.151 ± 0.004b	0.165 ± 0.004ab	0.178 ± 0.007a	0.006	
Middle part of femur	0.288 ± 0.006	0.279 ± 0.006	0.297 ± 0.008	0.299 ± 0.007	0.161	
Distal femur	0.112 ± 0.004b	0.120 ± 0.002ab	0.117 ± 0.002ab	0.126 ± 0.003a	0.008	
Abbreviations: BMC, bone mineral content; BMD, bone mineral density.

Different lowercase letters indicate a significant difference in the morbidity rate (P < 0.05).

Table 7 Bone mineral density of tibia.

Table 7index	CON	LSAL	MSAL	HSAL	P-value	
BMC (g)	Total	2.697 ± 0.094	2.607 ± 0.083	2.833 ± 0.089	2.863 ± 0.106	0.202	
Proximal tibia	0.585 ± 0.019	0.571 ± 0.018	0.605 ± 0.026	0.629 ± 0.023	0.275	
Middle part of tibia	1.413 ± 0.030b	1.463 ± 0.046ab	1.545 ± 0.046ab	1.602 ± 0.027a	0.008	
Distal tibia	0.602 ± 0.026	0.614 ± 0.031	0.647 ± 0.037	0.710 ± 0.033	0.096	
BMD (g/cm2)	Total	0.197 ± 0.005	0.205 ± 0.006	0.198 ± 0.004	0.209 ± 0.005	0.325	
Proximal tibia	0.153 ± 0.003b	0.151 ± 0.004b	0.159 ± 0.003ab	0.173 ± 0.005a	0.001	
Middle part of tibia	0.296 ± 0.008	0.283 ± 0.009	0.307 ± 0.010	0.322 ± 0.012	0.071	
Distal tibia	0.144 ± 0.005b	0.137 ± 0.003b	0.150 ± 0.003ab	0.162 ± 0.003a	0.000	
Abbreviations: BMC, bone mineral content; BMD, bone mineral density.

Different lowercase letters indicate a significant difference in the morbidity rate (P < 0.05).

Figure 3 The influence of SAL on bone strength of the femur and tibia. n = 8 per group. (A) Stiffness of the femur and tibia. (B) Young modulus of the femur and tibia. (C) Ultimate load of the femur and tibia. (D) Ultimate stress of the femur and tibia. (E) Fracture energy of the femur and tibia. (F) Ultimate strain of the femur and tibia. Various letters indicate statistically significant differences (P < 0.05).

Figure 3

Bone Metabolism Markers

SAL up-regulated the mRNA levels of collagen-1, runt-related transcription factor-2 (RUNX2), and bone morphogenetic protein 2 (BMP2) in a dose-dependent manner (Figure 4A). Dietary supplementation of SAL did not significantly affect the activity of ALP in serum (P > 0.05, Figure 4B), but significantly increased ALP activity in the femoral head tissue (P < 0.05, Figure 4C). Additionally, compared to the CON group, the protein expression abundance of collagen-1, ALP, RUNX2, and BMP2 was significantly increased in the HSAL and MSAL groups (P < 0.05, Figures 4D–E).Figure 4 The impact of SAL on key indicators of bone metabolism. (A) Relative mRNA levels of collagen-1, runt-related transcription factor-2 (RUNX2), and bone morphogenetic protein 2 (BMP2). n = 8 per group. (B) The activity of serum alkaline phosphatase (ALP). n = 8 per group. (C) The activity of ALP in the femoral head. n = 8 per group. (D-E) Western blot analysis of collagen-1, ALP, RUNX2, and BMP2 in the femoral head. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as loading control. n = 3 per group. Various letters indicate statistically significant differences (P < 0.05).

Figure 4

Bone Chemical Composition

The FTIR spectra of the midshaft cortical bone of the femur are illustrated in Figure 5A. Compared to the CON group, a significant increase in the ratio of phosphate to amide I was observed in the femur and tibia of broilers in the HSAL group (P < 0.05, Figure 5B). Medium and high doses of SAL significantly increased the carbonate substitution degree in the bone minerals of the femur (P < 0.05, Figure 5C). SAL reduced the total carbonate content in the bone minerals of the femur and tibia in a dose-dependent manner (Figure 5D). Compared to the CON group, the ratio of total carbonate to amide I significantly decreased in the femur of the HSAL group (P < 0.05, Figure 5E). Furthermore, high-dose SAL significantly increased the mineral crystallinity index and collagen cross-linking content in both the femur and tibia (P < 0.05, Figures 5F and 5G).Figure 5 The effect of SAL on the chemical composition of cortical bone in the femur and tibia. n = 5 per group. (A) Representative fourier transform infrared spectroscopy spectra of cortical bone of femur in different groups of broilers. (B) Mineralization degree of femur and tibia (PO4/Amide Ⅰ). (C) Carbonate substitution degree in bone minerals (MinCO3-870) of the femur and tibia. (D) Total carbonate content in bone minerals (MinCO3-1415) of the femur and tibia. (E) The ratio of total carbonate to amide Ⅰ in the femur and tibia. (F) Crystallization index (CI) of femur and tibia. (G) The amount of collagen cross-linking in the femur and tibia. Various letters indicate statistically significant differences (P < 0.05).

Figure 5

Cartilage Morphology

Dietary supplementation of SAL had no significant effect on the weight and water content of the femoral head cartilage (P > 0.05, Figures 6A and 6B). Compared to the CON group, the diameter and thickness of the cartilage in the femoral head of broilers were significantly increased in the HSAL group (P < 0.05, Figures 6C and 6D). Safranin O-fast green and HE staining revealed that after SAL supplementation, the surface of the femoral head cartilage in chickens appeared smoother. Compared to the CON group, the intensity of toluidine blue and alcian blue staining was deeper in the SAL-treated groups, indicating an increase in the cartilage matrix.Figure 6 The effect of SAL on the morphology of femoral head cartilage. (A) Fresh cartilage weight in chickens. n = 8 per group. (B) The moisture content of cartilage in chickens. n = 8 per group. (C) The diameter of cartilage in chickens. n = 8 per group. (D) The thickness of cartilage in chickens. n = 8 per group. (E) Representative images of safranin O-solid green staining, hematoxylin-eosin staining, toluidine blue staining, and alishin blue staining of cartilage sections. n = 3 per group. Scale bar, 200 μm. Various letters indicate statistically significant differences (P < 0.05).

Figure 6

Cartilage Metabolism Markers

Compared to the CON group, high-dose SAL significantly increased collagen-2 and aggrecan mRNA levels (P < 0.05), while medium-dose SAL significantly increased aggrecan mRNA levels (P < 0.05, Figure 7A). Western blot results showed that SAL increased collagen-2 and aggrecan expression and decreased collagen-10 expression with dose-dependent (Figures 7C and 7D). Additionally, high-dose SAL significantly upregulated the expression of matrix synthesis genes, including BMP2 and bone morphogenetic protein 3 (BMP3), and downregulated the expression of matrix degradation genes including matrix metalloproteinase-9 (MMP9) and matrix metalloproteinase-13 (MMP13) (P < 0.05,Figures 7B, 7E, and 7F). The regulation of cartilage matrix homeostasis by SAL is dose-dependent.Figure 7 The impact of SAL on key indicators of cartilage metabolism. (A) Relative mRNA levels of collagen-10, collagen-2, and aggrecan. n = 8 per group. (B) Relative mRNA levels of BMP2, bone morphogenetic protein 3 (BMP3), matrix metalloproteinase 13 (MMP13), and matrix metalloproteinase 9 (MMP9). n = 8 per group. (C-D) Western blot analysis of collagen-2, aggrecan, and collagen-10 in the femoral head cartilage. n = 3 per group. (E-F) Western blot analysis of MMP9, MMP13, and BMP2 in the femoral head cartilage. n = 3 per group. The GAPDH served as loading control. Various letters indicate statistically significant differences (P < 0.05).

Figure 7

DISCUSSION

The leg diseases in fast-growing broilers are a significant concern within the poultry farming industry and cannot be overlooked (Julian, 1998). The femoral head and lengthy bones of the legs bear the rapidly growing body weight, making it unsurprising that diseases such as FHN are prevalent in fast-growing broiler strains (Liu et al., 2021). Previous research has highlighted the positive effect of dietary supplementation with essential fatty acids or vitamin D on bone health (Abraham et al., 2023). Additionally, the inclusion of glucosamine and vitamin C in feed has been shown to benefit the development of bones and cartilage in broilers (Santos et al., 2019). Despite improvements in nutrition and husbandry management, there remains ample opportunity to improve leg health in broilers. Growing evidence indicates SAL exhibits beneficial effects on bone mineralization and cartilage integrity (Wu et al., 2019; Wang et al., 2022). A study illustrated that SAL exerts a preventive capacity against osteoporosis in ovariectomized rats by activating Nrf2 (Wang et al., 2022). Moreover, SAL increases osteoblast differentiation and promotes bone formation through the BMP signaling pathway (Chen et al., 2013). Furthermore, SAL has been shown to alleviate inflammation and apoptosis in chondrocytes, indicating a potential therapeutic efficacy against bone and joint disorders (Wu et al., 2019; Zhang and Zhao, 2019). However, investigations into the beneficial impacts of SAL on bone and cartilage have primarily focused on cellular and rodent models (Chen et al., 2013; Wang et al., 2022), with no reports elucidating its effects on skeletal quality in broilers. This study constitutes the inaugural exploration into the effects of SAL on the characteristics of the femur, tibia, and femoral head in broilers.

FHN commonly occurs in broilers around 6 wk of age (Dinev, 2009). The etiology and pathogenesis of FHN are complex, involving factors such as mechanical pressure, impaired femoral head microcirculation, disrupted lipid metabolism, and disturbances in cartilage homeostasis, all of which can contribute to the development of FHN in broilers (Mino-Oka et al., 2017; Miyaki and Lotz, 2018). Broilers affected with FHN frequently manifest symptoms like reduced mobility and limping (Liu et al., 2021). Gait scoring is used to assess leg health in broilers based on their walking posture. Broilers with FHN tend to demonstrate higher gait scores (Yu et al., 2020). The severity grading of the femoral head correlates with the extent of necrosis, with higher scores indicating greater severity (Yu et al., 2020). In this study, SAL supplementation decreased FHN incidence in broilers, thereby promoting leg health.

The femur and tibia are the primary weight-bearing bones in broilers. The rapid growth in broilers, from 40g at hatching to 2000g at 6 wk of age, places a considerable strain on their skeletal system (Yair et al., 2012). Studies have indicated that appropriately augmenting mechanical load can improve bone mineral density and strength, thereby positively influencing skeletal adaptation (Ren et al., 2015; Uto et al., 2017). However, excessive loading negatively impacts bone growth and development, leading to a deterioration in skeletal structure and mechanical properties (Reich et al., 2008). Strength, the maximum load-bearing capacity of a material, appears to be closely related to bone mineral density (Hernandez and van der Meulen, 2017). Three-point bending tests, widely employed for evaluating bone mechanical properties, effectively simulate bone behavior under bending conditions (Yu et al., 2020). We found that SAL positively influenced bone mineral density and mechanical properties. Therefore, SAL may address the issue of declining bone quality resulting from excessive loading in fast-growing broilers.

Alterations in bone geometric parameters can influence the biological function and mechanical properties of bones (Wojciechowska-Puchałka et al., 2023). Our findings indicate that dietary supplementation with SAL enhances the mechanical properties of bones by increasing the external diameter and metaphyseal width of the femur and tibia, rather than the length and internal diameter. Furthermore, the increased cortical cross-sectional area, cross-sectional moment of inertia, and radius of gyration of bones may also contribute to the improvement of bone mechanical properties. Bone quality typically encompasses bone mineral density, morphology, and mechanical properties (Hernandez and van der Meulen, 2017). Our preliminary investigation shows that SAL supplementation improves bone morphology, mineral density, and mechanical properties in broilers, thereby enhancing the quality of their leg bones.

Bone tissue primarily consists of an extracellular matrix and inorganic components, with bone cells constituting approximately 5% of the tissue (Schlesinger et al., 2020). Collagen-1, mainly synthesized by osteoblasts, acts as the scaffold for mineral deposition within the bone matrix (Schlesinger et al., 2020). In the present study, SAL significantly increased the expression of collagen-1, suggesting a positive role in facilitating phosphate deposition and enhancing bone quality. Bone morphogenetic proteins (BMP), members of the transforming growth factor-β superfamily, are crucial in bone formation during embryonic and postnatal development (Chen et al., 2012). Among them, BMP2 is essential for osteoinduction and osteoblastic differentiation (Chen et al., 2012). It has demonstrated BMP2′s significant involvement in fracture induction, with no compensatory effect from other osteogenic stimuli in cases of BMP2 deficiency (Tsuji et al., 2006). RUNX2 is involved in osteoblast development, acting synergistically with SMAD to induce osteogenic phenotypes (Afzal et al., 2005). Our study revealed that SAL upregulated the expression of BMP2 and RUNX2, suggesting a potential mechanism underlying the osteogenic effects of SAL. ALP serves as a widely acknowledged biochemical marker of osteoblast activity with its high expression in mineralized tissues playing a crucial role in bone formation. This expression is regulated by various signaling pathways, including Wnt, BMP2, and insulin-like growth factor (Ling et al., 2010; An et al., 2016). Our data revealed that SAL administration significantly upregulated ALP expression in the femoral head. Interestingly, this effect was not mirrored in serum ALP levels. One plausible explanation for this discrepancy could be the substantial expression of ALP in other organs, such as the intestines, liver, and kidneys, from where it may enter the bloodstream (Siller and Whyte, 2018).

The main mineral component of bone is calcium phosphate, which provides compressive strength, whereas collagen protein constitutes the primary constituent of the bone matrix, offering tensile strength (Wegst et al., 2015). The relative proportions of minerals to organic matter (phosphate/amide I) reflect the degree of mineralization of cortical bone (Sanchez-Rodriguez et al., 2019). The amount of substituted carbonate in the minerals (Min CO3 870) increases with the maturation of bone mineralization (Rey et al., 1989), while the ratio of total carbonate to mineral content (Min CO3 1415) decreases with bone mineral maturation (Ou-Yang et al., 2001). The mineral crystallinity index is associated with mineral crystal size and integrity, and the amount of collagen cross-linking increases with collagen maturation (Donnelly et al., 2010). Our data revealed that SAL administration led to elevated levels of phosphate and collagen within the femur and tibia, potentially contributing to improve bone strength.

Cartilage constitutes an avascular tissue comprising chondrocytes and the extracellular matrix, pivotal for load-bearing and lubrication (Krishnan and Grodzinsky, 2018). The primary component of the extracellular matrix of cartilage is proteoglycan, which is unsheathed within a highly hydrated network of collagen fibers (Krishnan and Grodzinsky, 2018). We found no significant alterations in the weight and water content of femoral head cartilage. However, SAL supplementation led to an increase in cartilage diameter and thickness, indicating potential modifications in the cartilage extracellular matrix. Toluidine blue and alcian blue, with affinity to proteoglycans in the cartilage matrix, exhibited a more intense staining in the SAL group, suggesting that SAL may promote the synthesis of the cartilage matrix. When broilers bear weight, cartilage injury may accelerate the occurrence and progression of FHN (Yu et al., 2020). We found SAL smoothed the surface of the cartilage, which may reduce damage caused by joint friction. Collagen-2 is the primary collagen in the cartilage matrix, synthesized by chondrocytes, while collagen-10 expression increases in hypertrophic chondrocytes (Shen, 2005). In our study, SAL upregulates the expression of collagen-2 while reducing the expression of collagen-10, indicating that SAL improves the functionality of chondrocytes and reduces chondrocyte aging. The homeostasis of the matrix is maintained by the synthesis and degradation of the cartilage matrix. FHN in broilers is accompanied by disruption of the cartilage matrix. The results of this study indicated that SAL upregulated the expression of matrix synthesis metabolic genes (BMP2 and BMP3) and downregulated the expression of matrix degradation genes (MMP13 and MMP9). This is crucial for maintaining cartilage homeostasis and may contribute to the maintenance of normal structure and function of cartilage. During cartilage development, BMP2 promotes the proliferation and maturation of chondrocytes (Shu et al., 2011). The upregulation of BMP2 expression induced by SAL not only benefits the synthesis of cartilage matrix but also exerts a positive influence on the proliferation and maturation of chondrocytes.

In summary, our findings suggest that dietary supplementation with SAL improves the morphology and biomechanical properties of the femur and tibia, exerting positive effects on bone formation and cartilage protection. Additionally, the effects of salidroside on the skeletal development of broilers are dose-dependent manner. SAL holds promise as a feed additive to enhance the leg health in fast-growing broilers.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have influenced the work reported in this paper.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (No. 32273080 ) and the Jiangsu Province Graduate Practice Innovation Program Project (SJCX24_0241 ). The authors would like to thank all the reviewers who participated in the review.

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104274.
==== Refs
REFERENCES

Abraham M.E. Robison C.I. Kim W.K. Regmi P. Karcher D.M. N-3 essential fatty acid and vitamin d supplementation improve skeletal health in laying hens Poult. Sci. 102 2023 103089
Afzal F. Pratap J. Ito K. Ito Y. Stein J.L. van Wijnen A.J. Stein G.S. Lian J.B. Javed A. Smad function and intranuclear targeting share a runx2 motif required for osteogenic lineage induction and bmp2 responsive transcription J. Cell Physiol. 204 2005 63 72 15573378
An J. Yang H. Zhang Q. Liu C. Zhao J. Zhang L. Chen B. Natural products for treatment of osteoporosis: The effects and mechanisms on promoting osteoblast-mediated bone formation Life Sci. 147 2016 46 58 26796578
Chen G. Deng C. Li Y.P. Tgf-β and bmp signaling in osteoblast differentiation and bone formation Int. J. Biol. Sci. 8 2012 272 288 22298955
Chen J.J. Zhang N.F. Mao G.X. He X.B. Zhan Y.C. Deng H.B. Song D.Q. Li D.D. Li Z.R. Si S.Y. Qiu Q. Wang Z. Salidroside stimulates osteoblast differentiation through bmp signaling pathway Food Chem. Toxicol. 62 2013 499 505 24055767
Dinev I. Clinical and morphological investigations on the prevalence of lameness associated with femoral head necrosis in broilers Br. Poult. Sci. 50 2009 284 290 19637027
Dinev I. Kanakov D. Kalkanov I. Nikolov S. Denev S. Comparative pathomorphologic studies on the incidence of fractures associated with leg skeletal pathology in commercial broiler chickens Avian Dis. 63 2019 641 650 31865679
Donnelly E. Boskey A.L. Baker S.P. van der Meulen M.C. Effects of tissue age on bone tissue material composition and nanomechanical properties in the rat cortex J. Biomed. Mater. Res. A 92 2010 1048 1056 19301272
Guo Y. Tang H. Wang X. Li W. Wang Y. Yan F. Kang X. Li Z. Han R. Clinical assessment of growth performance, bone morphometry, bone quality, and serum indicators in broilers affected by valgus-varus deformity Poult. Sci. 98 2019 4433 4440 31065716
Hernandez C.J. van der Meulen M.C. Understanding bone strength is not enough J. Bone Miner. Res. 32 2017 1157 1162 28067411
Julian R.J. Rapid growth problems: Ascites and skeletal deformities in broilers Poult. Sci. 77 1998 1773 1780 9872578
Kestin S.C. Knowles T.G. Tinch A.E. Gregory N.G. Prevalence of leg weakness in broiler chickens and its relationship with genotype Vet. Rec. 131 1992 190 194 1441174
Krishnan Y. Grodzinsky A.J. Cartilage diseases Matrix Biol. 71-72 2018 51 69 29803938
Ling L. Dombrowski C. Foong K.M. Haupt L.M. Stein G.S. Nurcombe V. van Wijnen A.J. Cool S.M. Synergism between wnt3a and heparin enhances osteogenesis via a phosphoinositide 3-kinase/akt/runx2 pathway J Bio.l Chem. 285 2010 26233 26244
Liu K. Wang K. Wang L. Zhou Z. Changes of lipid and bone metabolism in broilers with spontaneous femoral head necrosis Poult. Sci. 100 2021 100808
Mino-Oka A. Izawa T. Shinohara T. Mori H. Yasue A. Tomita S. Tanaka E. Roles of hypoxia inducible factor-1α in the temporomandibular joint Arch. Oral. Biol. 73 2017 274 281 27816790
Miyaki S. Lotz M.K. Extracellular vesicles in cartilage homeostasis and osteoarthritis Curr. Opin. Rheumatol. 30 2018 129 135 29035932
Ou-Yang H. Paschalis E.P. Mayo W.E. Boskey A.L. Mendelsohn R. Infrared microscopic imaging of bone: Spatial distribution of co3(2-) J. Bone Miner. Res. 16 2001 893 900 11341334
Pang K. Wang S. Li M. Zhou Z. Autophagy in femoral head necrosis of broilers bone metabolism parameters and autophagy-related gene expression in femoral head necrosis induced by glucocorticoid in broilers Front. Vet. Sci. 8 2021 746087
Pathria M.N. Chung C.B. Resnick D.L. Acute and stress-related injuries of bone and cartilage: Pertinent anatomy, basic biomechanics, and imaging perspective Radiology 280 2016 21 38 27322971
Recio M.C. Giner R.M. Máñez S. Immunmodulatory and antiproliferative properties of Rhodiola species Planta. Medica. 82 2016 952 960 27224273
Reich A. Sharir A. Zelzer E. Hacker L. Monsonego-Ornan E. Shahar R. The effect of weight loading and subsequent release from loading on the postnatal skeleton Bone 43 2008 766 774 18619566
Ren L. Yang P. Wang Z. Zhang J. Ding C. Shang P. Biomechanical and biophysical environment of bone from the macroscopic to the pericellular and molecular level J. Mech. Behav. Biomed. Mater. 50 2015 104 122 26119589
Rey C. Collins B. Goehl T. Dickson I.R. Glimcher M.J. The carbonate environment in bone mineral: A resolution-enhanced Fourier transform infrared spectroscopy study Calcif. Tissue Int. 45 1989 157 164 2505907
Rodriguez-Navarro A.B. McCormack H.M. Fleming R.H. Alvarez-Lloret P. Romero-Pastor J. Dominguez-Gasca N. Prozorov T. Dunn I.C. Influence of physical activity on tibial bone material properties in laying hens J. Struct. Biol. 201 2018 36 45 29109023
Sanchez-Rodriguez E. Benavides-Reyes C. Torres C. Dominguez-Gasca N. Garcia-Ruiz A.I. Gonzalez-Lopez S. Rodriguez-Navarro A.B. Changes with age (from 0 to 37 d) in tibiae bone mineralization, chemical composition and structural organization in broiler chickens Poult. Sci. 98 2019 5215 5225 31265108
Santos E.T. Sgavioli S. Castiblanco D.M.C. Borges L.L. de Quadros T.C.O. de Laurentiz A.C. Shimano A.C. Amoroso L. Baraldi-Artoni S.M. Glycosaminoglycans and vitamin c affect broiler bone parameters Poultry science 98 2019 4694 4704
Schlesinger P.H. Blair H.C. Beer Stolz D. Riazanski V. Ray E.C. Tourkova I.L. Nelson D.J. Cellular and extracellular matrix of bone, with principles of synthesis and dependency of mineral deposition on cell membrane transport Am. J. Physiol. Cell Physiol. 318 2020 C111 c124 31532718
Shen G. The role of type x collagen in facilitating and regulating endochondral ossification of articular cartilage Orthod. Craniofac. Res. 8 2005 11 17 15667640
Shu B. Zhang M. Xie R. Wang M. Jin H. Hou W. Tang D. Harris S.E. Mishina Y. O'Keefe R.J. Hilton M.J. Wang Y. Chen D. Bmp2, but not bmp4, is crucial for chondrocyte proliferation and maturation during endochondral bone development J. Cell Sci. 124 2011 3428 3440 21984813
Siller A.F. Whyte M.P. Alkaline phosphatase: Discovery and naming of our favorite enzyme J. Bone Miner. Res. 33 2018 362 364 28727174
Sun M. Lu Z. Cai P. Zheng L. Zhao J. Salidroside enhances proliferation and maintains phenotype of articular chondrocytes for autologous chondrocyte implantation (aci) via tgf-β/smad3 signal Biomed. Pharmacother. 122 2020 109388
Tarlton J.F. Wilkins L.J. Toscano M.J. Avery N.C. Knott L. Reduced bone breakage and increased bone strength in free range laying hens fed omega-3 polyunsaturated fatty acid supplemented diets Bone 52 2013 578 586 23142806
Tsuji K. Bandyopadhyay A. Harfe B.D. Cox K. Kakar S. Gerstenfeld L. Einhorn T. Tabin C.J. Rosen V. Bmp2 activity, although dispensable for bone formation, is required for the initiation of fracture healing Nat. Genet. 38 2006 1424 1429 17099713
Uto Y. Kuroshima S. Nakano T. Ishimoto T. Inaba N. Uchida Y. Sawase T. Effects of mechanical repetitive load on bone quality around implants in rat maxillae PLoS One 12 2017 e0189893
Wang Y.F. Chang Y.Y. Zhang X.M. Gao M.T. Zhang Q.L. Li X. Zhang L. Yao W.F. Salidroside protects against osteoporosis in ovariectomized rats by inhibiting oxidative stress and promoting osteogenesis via nrf2 activation Phytomedicine 99 2022 154020
Wegst U.G. Bai H. Saiz E. Tomsia A.P. Ritchie R.O. Bioinspired structural materials Nat. Mater. 14 2015 23 36 25344782
Williams B. Waddington D. Murray D.H. Farquharson C. Bone strength during growth: Influence of growth rate on cortical porosity and mineralization Calcif. Tissue Int. 74 2004 236 245 14517713
Wojciechowska-Puchałka J. Calik J. Krawczyk J. Obrzut J. Tomaszewska E. Muszyński S. Wojtysiak D. The effect of caponization on bone homeostasis of crossbred roosters. I. Analysis of tibia bone mineralization, densitometric, osteometric, geometric and biomechanical properties Sci. Rep. 13 2023 14512 37667027
Wu M. Hu R. Wang J. An Y. Lu L. Long C. Yan L. Salidroside suppresses il-1β-induced apoptosis in chondrocytes via phosphatidylinositol 3-kinases (pi3k)/akt signaling inhibition Med. Sci. Mon. 25 2019 5833 5840
Xie B. Zhou H. Liu H. Liao S. Zhou C. Xu D. Salidroside alleviates dexamethasone-induced inhibition of bone formation via transforming growth factor-beta/smad2/3 signaling pathway Phytother. Res. 37 2023 1938 1950 36567454
Xu T. Yue K. Zhang C. Tong X. Lin L. Cao Q. Huang S. Probiotics treatment of leg diseases in broiler chickens: A review Probiot. Antimicrob. Prot. 14 2022 415 425
Yair R. Uni Z. Shahar R. Bone characteristics of late-term embryonic and hatchling broilers: Bone development under extreme growth rate Poult. Sci. 91 2012 2614 2620 22991548
Yu Y. Wang S. Zhou Z. Cartilage homeostasis affects femoral head necrosis induced by methylprednisolone in broilers Int. J. Mol. Sci. 21 2020 4841
Yu Y. Lin L. Liu K. Jiang Y. Zhou Z. Effects of simvastatin on cartilage homeostasis in steroid-induced osteonecrosis of femoral head by inhibiting glucocorticoid receptor Cells 11 2022 3945
Zhang Y. Zhao Q. Salidroside attenuates interleukin-1β-induced inflammation in human osteoarthritis chondrocytes J. Cell. Biochem. 120 2019 1203 1209 30270563
Zhao J. Duan X. Yan S. Liu Y. Wang K. Hu M. Chai Q. Liu L. Ge C. Jia J. Dou T. Transcriptomics reveals the molecular regulation of Chinese medicine formula on improving bone quality in broiler Poult. Sci. 102 2023 103044
Zheng H. Qi S. Chen C. Salidroside improves bone histomorphology and prevents bone loss in ovariectomized diabetic rats by upregulating the OPG/RANKL ratio Molecules (Basel, Switzerland) 23 2018 2398
Zuidhof M.J. Schneider B.L. Carney V.L. Korver D.R. Robinson F.E. Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 2005 Poult. Sci. 93 2014 2970 2982 25260522
