
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00795-8
10.1016/j.psj.2024.104216
104216
IMMUNOLOGY, HEALTH AND DISEASE
LAMTOR1/mTORC1 promotes CD276 to induce immunosuppression via PI3K/Akt/MMP signaling pathway in Clostridium perfringens–induced necrotic enteritis of laying hens
Dong Qiaoli *†1
Sun Yamin *†1
Li Jingyang *†1
Tian Xinyue *†
Liu Siyu *†
Fu Yunjian *†
Luo Ronghui *†
Guo Ling *†
Zong Bingbing *†
Lu Qirong *†
Ye Chun *†
Fu Shulin shulinfu@whpu.edu.cn
⁎†2
Qiu Yinsheng ⁎1
⁎ School of Animal Science and Nutritional Engineering, Hubei Key Laboratory of Animal Nutrition and Feed Science, Wuhan Polytechnic University, Wuhan 430023, China
† Hubei Collaborative Innovation Center for Animal Nutrition and Feed Safety, Wuhan Polytechnic University, Wuhan 430023, China
2 Corresponding author. shulinfu@whpu.edu.cn
1 These authors contributed equally to the work.

02 9 2024
12 2024
02 9 2024
103 12 1042162 7 2024
9 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Clostridium perfringens (C. perfringens) causes avian necrotic enteritis, leading to huge economic losses to the poultry industry. This pathogen induces host immunosuppression; however, the molecular mechanism is still unclear. Thus, we established a laying hen infection model to explore this mechanism. We randomly divided 20 one-old-day laying hens into the control and infection groups. The infection group was infected intragastrically with 1 × 109 colony-forming units of C. perfringens in 1 mL of sterile phosphate-buffered saline (PBS) once a day from d 17 to 20; the control group received the same volume of PBS without the bacterium. Twenty-four hours after the last challenge, we sacrificed the laying hens and collected the jejunum for analysis. The infection group presented alterations in blood biochemical parameters and necrotic lesion scores as well as damage to the jejunum. Proteomics revealed 427 upregulated and 291 downregulated proteins in the infection group. In the infection group, CD3, CD4, and CD8 messenger RNA expression (mRNA) expression was decreased; LAMTOR1 and mTORC1 mRNA expression was increased; CD276 protein expression was enhanced; and the PI3K/Akt/MMP pathway was activated in jejunum of laying hens. This is the first study to report CD276 expression in the jejunum related to immunosuppression in a laying hen model of necrotic enteritis. It provides some new key targets to potentially control avian necrotic enteritis.

Key words

necrotic enteritis
Clostridium perfringens
CD276
immunosuppression
PI3K/Akt/MMP
==== Body
pmcINTRODUCTION

Avian necrotic enteritis, which is caused by Clostridium perfringens (C. perfringens), has a significant impact on the poultry industry (van der Klein et al., 2024). The acute symptoms and high mortality rate lead to substantial economic losses for farms (Buiatte et al., 2022). C. perfringens also poses a risk to public health (Yan et al., 2024). It can be transmitted to humans through contact with infected birds or contaminated meat products, potentially contributing to foodborne illnesses (Kakese Mukosa et al., 2023). Therefore, it is urgent to control C. perfringens infections.

C. perfringens, a gram-positive bacterium, can produce a wide range of toxins—alpha, beta, epsilon, and iota—that can cause severe diseases in humans and animals (Camargo et al., 2024; Ou et al., 2024). The alpha toxin is considered the primary virulence factor of and disrupts cell membranes by hydrolyzing phospholipids, leading to cell lysis and tissue damage (Takehara, 2021). The beta toxin (NetB), a pore-forming toxin, is responsible for the symptoms of necrotic enteritis in poultry (Loutet et al., 2024). NetB disrupts intestinal epithelial cells, causing fluid accumulation and tissue damage in the gut (Kadekar et al., 2024). The epsilon toxin is a potent neurotoxin that causes a fatal, neurological disorder in ruminant livestock (Mander and Finnie, 2018). It also targets the cardiovascular system and causes acute edema and respiratory failure (Hirschberg et al., 2009). The iota toxin, a binary toxin, alters intestinal permeability by triggering necrosis in the mucosal epithelium of the small intestine (Redondo et al., 2017). These toxins make C. perfringens capable of causing life-threatening infections in both humans and animals; however, the pathogenic mechanism remains unclear.

C. perfringens has been shown to induce host immunosuppression normally under sepsis (Uojima et al., 2019; Li and Li, 2021), but the molecular mechanism is still unclear. T cells play an important role in regulating host adaptive and innate immune responses (O'Brien et al., 2024). CD3, CD4, and CD8 are widely recognized as the T cell markers (Makhlouf et al., 2024). Abnormal proliferation of T cells is an important factor contributing to host immunosuppression (Kelly et al., 2024). B7-H3 (CD276) is a transmembrane glycoprotein and belongs to the B7 superfamily; it has been considered a promising therapeutic target (Miller et al., 2024). CD276 is an immune checkpoint molecule that is involved in T cell suppression (Joshi et al., 2024). It regulates the immune escape of esophageal squamous cell carcinoma through CXCL1–CXCR2-induced neutrophil extracellular trap networks (Xiong et al., 2024a). Moreover, it suppresses CD8+ T cell immunologic function through reprogramming glycolytic metabolism (Wu et al., 2024b). However, the exact role of CD276 during host immunosuppression induced by C. perfringens in necrotic enteritis of laying hens remains to be elucidated.

In this study, we used proteomics to explore the protein changes in the jejunum of laying hens challenged by C. perfringens and examined some key molecules and signaling pathways which might be related to host immunosuppression. Our results help to clarify the molecular mechanism of host immunosuppression triggered by C. perfringens and reveal key molecular targets that could serve to control necrotic enteritis caused by this pathogen in laying hens.

MATERIALS AND METHODS

Ethics Statement

The animal studies were approved by the Animal Care and Use Committee of Wuhan Polytechnic University, Hubei Province, China (WPU202307005). At the end of the experiment, the laying hens were euthanized via an injection in the pectoralis major muscle of 5 mg/kg body weight Zoletil 50 (Virbac, France).

Bacterial and Growth Condition

C. perfringens DK2 used in this study is a type G strain and secretes NetB (Tian et al., 2024). The strain was isolated from the small intestine of a commercially produced chicken. When cultured on Brucella agar (Hopebio, Qingdao, China) or in tryptone glucose yeast (TGY) extract broth (BD, USA) at 37°C under anaerobic conditions, C. perfringens DK2 shows the typical necrotic enteritis characteristics of this bacterium.

Experimental Design

Twenty healthy laying hens (White Leghorns, 1 day old) were purchased from Beijing Boehringer Ingelheim Vital Biotechnology Co., Ltd. (Beijing, China). They were randomly and equally divided into a control group and an infection group. The laying hens had free access to food and water. The infection group was used to establish the necrotic enteritis model (Gharib-Naseri et al., 2024). Briefly, at 17 d of age, the laying hens in the infection group were infected intragastrically with 1 × 109 colony-forming units of C. perfringens in 1 mL of sterile phosphate-buffered saline (PBS) once a day for 4 d. The laying hens in the control group received 1 mL of sterile PBS intragastrically. The laying hens were observed during the 4-d experiment and euthanized 24 h after the last C. perfringens challenge.

Assessment Blood Biochemical Parameters

Fifteen hours after C. perfringens challenge, blood was collected and blood biochemical parameters were assessed using commercial reagent kits (Shanghai Kehua Bio-engineering Co., Ltd., Shanghai, China) on an automatic blood analyzer (Hitachi HITEC 7100, Japan) (Abd El-Hack et al., 2024). The blood biochemical parameters included total bilirubin (T-Bil), total protein (TP), albumin (ALB), aspartate aminotransferase (AST), total cholesterol (TC), triglycerides (TG), glucose (GLU), inorganic phosphate (IP), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), blood urea nitrogen (BUN), γ-glutamyl transpeptidase (γ-GT), creatine kinase (CK), and direct bilirubin (D-Bil).

Measurement of the Immune Organ Index and Lesion Scores, and Assessment of Intestinal Histopathological Damage Induced by C. Perfringens

Twenty-four hours after the last C. perfringens challenge, the immune organs (spleen, thymus, and bursa of Fabricius) were removed and weighed. The immune organ index was calculated by dividing the total weight of these immune organs by the total body weight and multiplied by 100% (Li et al., 2023a). The jejunum was also removed 24 h after the last C. perfringens challenge. Lesion scores were determined by utilizing a lesion scoring system (Abdel Haleem et al., 2024). The severity of the lesions was evaluated on a scale ranging from 0 (no lesions) to 4 (severe lesions). The jejunum was also fixed in 10% neutral-buffered formalin, embedded in paraffin, sectioned at 4 μm, and stained with hematoxylin and eosin (HE) according to a standard method (Fu et al., 2020). The sections were evaluated using a light microscope (Olympus BX43, Tokyo, Japan).

Proteomics Analysis of the Jejunum With Nano-HPLC-MS/MS Method

Proteomics analysis of the jejunum with nano-HPLC-MS/MS followed our previous published protocol (Li et al., 2024). Briefly, the jejunum was removed and lysed in lysis buffer (1% SDS, 8 M urea, and 1 mg/mL protease inhibitor cocktail) to isolate protein. The protein concentration was determined by using the BCA protein assay kit (Beyotime Biotechnology, Shanghai). The protein was dissolved in 0.1% formic acid and submitted to on-line nano-spray LC-MS/MS using a Orbitrap Fusion Lumos Tribrid apparatus coupled to an EASY-nLC 1200 system (Thermo Fisher Scientific, MA, USA).

Measurement of Cytokine Production and Protein Expression by Real-Time Quantitative Polymerase Chain Reaction

Twenty-four hours after the last C. perfringens challenge, the jejunum was collected and used to measure the messenger RNA (mRNA) expression of interleukin 1beta (IL-1β), IL-2, IL-8, IL-10, IL-18, tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), and transforming growth factor beta (TGF-β) with real-time quantitative polymerase chain reaction (RT-PCR) (Liu et al., 2024). Briefly, RNA was isolated using the TRIzol reagent and following the manufacturer's protocol (Invitrogen). RNA was reverse transcribed into complementary DNA (cDNA) by employing reverse transcriptase (TaKaRa, Dalian, China). RT-PCR used the SYBR Green PCR Kit (TaKaRa) in accordance with the manufacturer's protocol. Each sample was run in triplicate. GAPDH served as the endogenous control to assess mRNA expression. The primers used for RT-PCR are presented in Table 1.Table 1 Primer sequences for qRT-PCR analysis.

Table 1Gene		Nucleotide sequence (5′–3′)	Tm (°C)	
IL-1β	Forward	CGAGGAGCAGGGACTTTGC	59.4	
	Reverse	GAAGGTGACGGGCTCAAAAA	55.7	
IL-18	Forward	AACCACCGCACCTTCAGCA	61.9	
	Reverse	CTTCCCTAAATCGAACAACCA	57.2	
TNF-α	Forward	GTGTATGTGCAGCAACCCG	57.7	
	Reverse	CACGACAGCCAAGTCAACG	57.8	
IFN-γ	Forward	AAGGATCATACTGAGCCAGAT	53	
	Reverse	CACCTTCTTCACGCCATCA	57.2	
TGF-β	Forward	CTCGCCAAGACGGCCATTA	61.8	
	Reverse	CAGTGCGTCAGGTTGTTGCTC	61.4	
IL-2	Forward	AAAGGAAACCTCTTCAAAC	48.3	
	Reverse	CACTTCTCCCAGGTAACAC	49.3	
IL-8	Forward	GCTGCTCTGTCGCAAGGTA	57	
	Reverse	TTGAATGGATTTAGGGTGG	53	
IL-10	Forward	GCTCTGAACTGCTGGATGA	53.5	
	Reverse	TGATGACTGGTGCTGGTCT	53.3	
CD3	Forward	TTGTCGCCACTGTCTTGCT	57	
	Reverse	CTGTCCATCATTCCGCTCA	57	
CD4	Forward	TCCAATGCCCACTTGCTCT	58.5	
	Reverse	TCCACGAGGTGACAGTTCC	55.6	
CD8	Forward	CTGGTGGTGAAGAACTTTAGG	54.2	
	Reverse	GTGCTGCTGTTGTTGTGGC	57.7	
CD276	Forward	GCTCGCTGTCCTGGCTTAC	59.4	
	Reverse	TTCCGTGCTCTTCAGTGGC	58.3	
LAMTOR1	Forward	CCAAGACGGCCATTAACAT	55.7	
	Reverse	TTCTTCCAGTGCGTCAGGT	55.8	
PI3K	Forward	CGGATGTTGCCTTACGGTTGT	58.2	
	Reverse	GTTCTTGTCCTTGAGCCACTGAT	57.2	
Akt	Forward	GTGCTGGAGGATAATGACT	48.9	
	Reverse	CCTGATTGTAGAAAGGGAG	49.2	
mTORC1	Forward	TGGAAGAGTGCCCGTAAGA	56.2	
	Reverse	GAAACACCGTGCCATAAGC	56.2	
MMP2	Forward	CGCCACTGAGATTTAACCG	56.5	
	Reverse	GCGTGAGCCAGGAGACCAT	60.4	
MMP9	Forward	CCTGGACCGTGCCGTGATA	62.2	
	Reverse	CTGCCTCGCCGCTGTAAAT	61.2	
GAPDH	Forward	GGTGAAAGTCGGAGTCAACGG	56.2	
	Reverse	CGATGAAGGGATCATTGATGGC	58.7	

Western blotting

Twenty-four hours after the last C. perfringens challenge, the jejunum was collected and total protein was extracted using a kit (Beyotime Biotechnology, Shanghai), in accordance with the manufacturer's protocol. Then the concentration of isolated proteins was determined by using a BCA protein assay kit (Beyotime Biotechnology, Shanghai). The proteins were separated by performing 12% SDS-PAGE (Fu et al., 2016). The separated protein was transferred to a PVDF membrane, which was incubated with 5% nonfat milk at 28°C for 3 h to block nonspecific protein binding. Following 5 washes with TBST, the membrane was incubated with the appropriate primary antibody against LAMTOR1 (Cat. No.: A21557, Polyclonal, 1:2000, ABclonal), Mechanistic Target of Rapamycin Complex 1 (mTORC1) (Cat. No.: 66888-1, Monoclonal, 1:5000, Proteintech), phosphorylated mTORC1 (p-mTORC1) (Cat. No.: 67778-1, Monoclonal, 1:2000, Proteintech), CD276 (Cat. No.: A24668, Polyclonal, 1:5000, ABclonal), PI3K (Cat. No.: A4992, Monoclonal, 1:500, ABclonal), p-PI3K (Cat. No.: AP0427, Polyclonal, 1:1000, ABclonal), Akt (Cat. No.: 10176-2, Polyclonal, 1:2000, Proteintech), p-Akt (Cat. No.: 66444-1, Monoclonal, 1:2000, Proteintech), MMP2 (Cat. No.: A23496, Polyclonal, 1:1000, ABclonal), MMP9 (Cat. No.: A25299, Polyclonal, 1:1000, ABclonal), or GAPDH (Cat. No.: GB11002-100, Polyclonal, 1:5000, Servicebio) for 12 h at 4°C. After this incubation, the membrane was washed 5 time with TBST 5 and incubated with corresponding HRP Goat Anti-Rabbit IgG (LAMTOR1, CD276, PI3K, p-PI3K, Akt, MMP2, MMP9, GAPDH) or HRP Goat Anti-Mouse IgG (H+L) (mTORC1, p-mTORC1, p-Akt) at 37°C for 1 h. The ECL Enhanced Kit (ABclonal, Wuhan, China) was used to visualize the protein bands. The colored bands were measured by using the ImageJ software to determine the gray values on the FluorChem FC2 AIC system (Alpha Innotech, USA). The levels of protein expression were measured by comparing the gray values of the colored bands with the gray values of the internal controls.

Statistical Analyses

The data were analyzed with GraphPad Prism 8 (GraphPad Software, San Diego, CA, USA) and are expressed as the mean ± standard deviation. Two tails T test was used to examine differences in differentially expressed genes and protein. The Mann–Whitney U test was used for lesion score analysis. A P-value < 0.05 was considered to be significant. *P < 0.05; ⁎⁎P < 0.01; ⁎⁎⁎P < 0.001.

RESULTS

C. Perfringens Altered the Blood Biochemical Parameters, Increased the Necrotic Lesion Score of the Jejunum, and Induced Jejunum Tissue Damage

The levels of HDL-C and BUN were significantly increased and the levels of AST, GLU, and D-Bil were significantly decreased in the infection group compared with the control group (Table 2). As shown in Figure 1A, the immune organ index was significantly reduced in the infection group compared with the control group (P < 0.05). Moreover, the jejunum lesion score was significantly increased in the infection group compared with the control group (P < 0.001; Figure 1B). The control group jejunum showed an intact mucosal structure, with tightly arranged intestinal villi, an orderly arrangement of epithelial cells, and well-developed intestinal glands (Figure 1C). However, the infection group jejunum showed notable damage, including a disordered arrangement of epithelial cells, partial shedding of villi, and infiltration of inflammatory cells (Figure 1D). These results indicate that C. perfringens successfully induced necrotic enteritis in the jejunum of laying hens.Table 2 Detection of the blood biochemical parameters.

Table 2Item	Control	Infection	SEM	P-value	
	(A)	(B)		B vs. A	
T-Bil (μmol/L)	11.84	11.83	0.24	0.986	
TP (g/L)	27.13	27.89	0.45	0.461	
ALB (g/L)	10.57	11.52	0.30	0.109	
AST (U/L)	204.00	184.00	5.25	0.026	
TC (mmol/L)	3.61	3.69	0.14	0.829	
TG (mmol/L)	2.73	2.53	0.06	0.063	
GLU (mmol/L)	20.40	16.63	0.97	0.023	
IP (mmol/L)	2.97	3.06	0.09	0.684	
HDL-C (mmol/L)	2.17	2.59	0.12	0.048	
LDL-C (mmol/L)	0.93	0.96	0.09	0.879	
BUN (mmol/L)	1.07	1.97	0.21	0.001	
γ-GT (U/L)	14.00	15.67	0.70	0.279	
CK (U/L)	1461.00	1505.00	44.06	0.678	
D-Bil (μmol/L)	3.14	2.25	0.21	0.005	

Figure 1 Detection of the effect of C. perfringens on blood biochemical parameters, necrotic lesion scores, and jejunum tissue damage. Following challenged at last time by C. perfringens for 24 h, spleen, thymus, and bursa of fabricius from the control group and the infection group were collected and the immune organ index was assessed (A). The jejunum lesion score was carried out by utilizing the lesion score system (B). The jejunum tissue was fixed in 10% neutral-buffered formalin, and the 4 μm thick jejunum section was stained with HE and the sections were evaluated by using a light microscopy (C, D). (C) the control group; (D) the infection group; *P < 0.05; ⁎⁎P < 0.01; ⁎⁎⁎P < 0.001.

Figure 1

C. Perfringens Reduced CD3, CD4, and CD8 mRNA Expression in the Jejunum of Laying Hens

T cells are important for immune functions to maintain host health and to prevent disease and abnormal T cell immunity initiated and promoted by autoimmune diseases (Sun et al., 2023). As shown in Figure 2, CD3, CD4, and CD8 mRNA expressions in the jejunum of the infection group were significantly downregulated compared with the control group (P < 0.001). These results suggest that C. perfringens modifies T cell differentiation in the jejunum of laying hens.Figure 2 Measurement of the effect of C. perfringenson CD3, CD4, and CD8 expressions in jejunum of laying hens. After the laying hens were challenged at the last time for 24 h, the jejunums from the infection group and the control group were obtained and the RNAs were isolated and the cDNA was synthesized. The CD3, CD4, and CD8 expression levels in jejunum were determined by RT-PCR. A: CD3; B: CD4; C: CD8; ⁎⁎⁎P < 0.001.

Figure 2

C. Perfringens Upregulated IL-1β, IL-18, TNF-α, IFN-γ, and TGF-β, and Downregulated IL-2, IL-8, and IL-10 mRNA Expression in the Jejunum of Laying Hens

After laying hens challenged at last time by C. perfringens for 24 h, the jejunums from the infection group and the control group were collected for cytokine determination and the expression levels of cytokines were measured by RT-PCR method. The results showed that IL-1β, IL-18, TNF-α, IFN-γ and TGF-β mRNA expression was significantly increased and IL-2, IL-8, and IL-10 mRNA expression was significantly decreased in the infection group compared with the control group (P < 0.001; Figure 3).Figure 3 Determination of the effect of C. perfringens on IL-1β, IL-2, IL-8, IL-10, IL-18, TNF-α, IFN-γ, and TGF-β expressions in jejunum of laying hens. When the laying hens were challenged by C. perfringens at the last time for 24 h, the jejunums from the control group and the infection group were collected. The RNAs were extracted and the IL-1β (A), IL-18 (B), TNF-α (C), IFN-γ (D), TGF-β (E), IL-2 (F), IL-8 (G), and IL-10 (H) expression levels were measured by RT-PCR. ⁎⁎⁎P < 0.001.

Figure 3

C. Perfringens Infection Dysregulated Proteins in the Jejunum of Laying Hens

We used proteomics to explore the molecular mechanism of host immunosuppression induced by C. perfringens in the jejunum of laying hens. We obtained 94,836 peptides, corresponding to 7,450 protein groups (Figure 4A). More than 11 peptides corresponding to protein numbers were verified, is 2,993 (Figure 4B). As shown in Figures 4C and 4D, there were 718 differentially expressed proteins in the jejunum of the infection group compared with the control group, of which 427 were upregulated and 291 were downregulated based on a |fold change| > 1.5 and Q-value < 0.05.Figure 4 Proteomics analysis of the jejunum of laying hens induced by C. perfringens. When the laying hens were infected by C. perfringens at the last time for 24 h, the jejunum was collected for the proteomics analysis. (A) Identification of peptides and proteins from quantitative proteomics. (B) Peptide number distribution from the infection and the control groups. (C) Heat map of dysexpressed proteins of jejunum from the control group and the infection group. (D) Volcano plot of dysexpressed proteins of jejunum from the control group and the infection group. CTL: the control group (Con-1, Con-2, Con-3); INF: the infection group (Inf-1, Inf-2, Inf-3).

Figure 4

We performed gene ontology (GO) enrichment analysis of the differentially expressed proteins (Figure 5A). In the biological processes category, the differentially expressed proteins mainly participate in cellular process, biological regulation, and regulation of biological process. In the cellular components and molecular functions category, the differentially expressed proteins mainly participate in cellular anatomical entity, binding, and catalytic activity. Kyoto encyclopedia of genes and genomes (KEGG) analysis revealed that the differentially expressed proteins mainly participate in ECM-receptor interaction, the NOD-like receptor signaling pathway, the T cell receptor signaling pathway, the PI3K-Akt signaling pathway, and the TGF-β signaling pathway (Figure 5B).Figure 5 Go and KEGG analysis of the differentially expressed proteins. (A) GO enrichment analysis of the differentially expressed proteins in the different categories. (B) KEGG analysis of the differentially expressed proteins from the proteomics of the jejunum.

Figure 5

C. Perfringens Promoted LAMTOR1, Mechanistic Target of Rapamycin Complex 1, and CD276 Expression in the Jejunum of laying Hens

Our proteomics analysis revealed that LAMTOR1 was differentially expressed in the jejunum from the infection group. According to a previous report, LAMTOR1 can increase mTORC1 expression (Zhao et al., 2024). Thus, we evaluated LAMTOR1 and mTORC1 mRNA and protein expression using RT-PCR and western blotting, respectively. The results showed that LAMTOR1 and mTORC1 mRNA expression levels were upregulated in the infection group jejunum compared with the control group jejunum (P < 0.001; Figures 6A and 6B). The protein levels of LAMTOR1 and mTORC1 were also increased in the jejunum from the infection group compared with the control group jejunum (LAMTOR1, P < 0.001; p-mTORC1, P < 0.05) (Figures 6D-G).Figure 6 Determination of LAMTOR1, mTORC1 and CD276 expressions in jejunum of laying hens triggered by C. perfringens. The laying hens were challenged by C. perfringens at the last time for 24 h, the jejunum in the control group and the infection group were obtained. The mRNA expression levels of LAMTOR1 (A), mTORC1 (B) and CD276 (C) were determined by RT-PCR and the protein expression levels of LAMTOR1 (D, E), p-mTORC1 (F, G) and CD276 (H, I) were determined by western blotting method. Cp: C. perfringens; *P < 0.05; ⁎⁎P < 0.01; ⁎⁎⁎P < 0.001.

Figure 6

Based on our proteomics analysis, CD276 was also differentially expressed in the infection group jejunum. mTORC1 upregulates CD276 expression, and CD276 plays crucial roles in regulating the functions of immune cells within the tumor microenvironment, resulting in host immunosuppression (Guo et al., 2023). Thus, we examined CD276 mRNA and protein expression using RT-PCR and western blotting. CD276 mRNA and protein expression was increased in the infection group jejunum compared with the control group (P < 0.01; Figures 6C, 6H, 6I).

C. Perfringens Triggered PI3K/Akt/MMP Pathway Activation in the Jejunum of Laying Hens

We found that the PI3K/AKT signaling pathway was enriched in the jejunum. CD276 promotes tumor vasculogenic mimicry formation in hepatocellular carcinoma via the PI3K/AKT/MMP pathway, contributing to formation of tumor microenvironment (Cheng et al., 2020). PI3K, Akt, MMP2, and MMP9 mRNA expression was elevated in the infection group jejunum compared with the control group jejunum (P < 0.001; Figures 7A–D). At the protein level, the p-PI3K/PI3K and p-Akt/Akt ratios as well as MMP2 and MMP9 expression were increased in the infection group jejunum compared with the control group jejunum (P < 0.05; Figures 7E–L).Figure 7 Determination of PI3K/Akt/MMP signaling pathway activation in jejunum of laying hens induced by C. perfringens. After challenged by C. perfringens at the last time for 24 h, the jejunum of the laying hens in the control group and the infection group were obtained. The mRNA expression levels of PI3K (A), Akt (B), MMP2 (C) and MMP9 (D) were determined by RT-PCR and the protein expression levels of p-PI3K (E, F), p-Akt (G, H), MMP2 (I, J) and MMP9 (K, L) were measured by western blotting method. Cp: C. perfringens; *P < 0.05; ⁎⁎P < 0.01; ⁎⁎⁎P < 0.001.

Figure 7

DISCUSSION

Necrotic enteritis caused by C. perfringens is a common enteric disease of poultry and causes substantial economic losses to the livestock industry (Alizadeh et al., 2024). Necrotic enteritis is characterized by the sudden onset of diarrhea and mucosal necrosis resulting from the overgrowth of C. perfringens in the small intestine (Ledwoń et al., 2022). Necrotic enteritis induces intestinal injury, contributing to decreased growth performance and elevated mortality in poultry (Fathima, et al., 2024). Given the serious nature of this disease, we constructed a model of necrotic enteritis in laying hens to evaluate the mechanisms of host immunosuppression. Our results have enhanced our understanding of the host immune response induced by C. perfringens.

As noted previously, C. perfringens infection elicits host immunosuppression (Calefi, et al. 2016); however, the molecular mechanism remains unclear. The intestine is a complex organ that promotes digestion, extracts nutrients, and participates in the innate and adaptive immune responses, affecting overall health (Hickey et al., 2023). Indeed, the intestine represents the largest compartment of the immune system (Mowat and Agace, 2014). T cells play key roles in the immune response underlying intestinal disease pathogenesis (Gomez-Bris et al., 2023). Intestinal CD4+ T cells are considered to be an essential mediator involved in modulating intestinal immunity in health and diseases (Zhou et al., 2021). Abnormal differentiation of T cells is an important change resulting in host immunosuppression (Xu et al., 2020). Some pathogens result in generalized immunosuppression characterized by a reduction in the CD4+ and CD8+ T cell immune responses (Zhou, 2008). Consistently, we found the C. perfringens challenge in laying hens reduced CD3, CD4, and CD8 expression in the jejunum. These changes might be an important contributor to host immunosuppression.

LAMTOR1 is required for amino acid sensing and mTORC1 activation: Its ubiquitination promotes mTORC1 activation and autophagy induction (Hertel et al., 2022). mTORC1 plays key roles in controlling cell growth and metabolism by responding to nutrients and growth factors (Zhao et al., 2024). Abnormal mTORC1 activation has been implicated in several disorders (Sun et al., 2018); for example, LAMTOR1/mTORC1 signaling controls the development of mucin-producing goblet cells in the intestine (Ito et al., 2020). LAMTOR1 is critical for CD4+ T cell proliferation and the suppressive function of regulatory T cells (Hosokawa et al., 2017). mTORC1 upregulates CD276 to inhibit antitumor T cells and drives tumor immune evasion, contributing to host immunosuppression (Liu et al., 2023). CD276 is an immune checkpoint molecule from the B7 family, which acts as a co-inhibitory molecule to induce tumor progression; it is considered a novel target for immunotherapy for refractory blood cancers (Guo et al., 2023). CD276 also suppresses the immune response in triple-negative breast cancer (Huang et al., 2021), inhibits antitumor immunity via the CCL2–CCR2–M2 macrophage axis, and contributes to ovarian cancer progression (Miyamoto et al., 2022). We found significantly upregulated LAMTOR1, mTORC1 and CD276 expression in the infection group jejunum. Thus, we speculate that LAMTOR1/mTORC1 and CD276 activation suppresses the T cell immune response leading to host immunosuppression. However, the specific mechanism requires further investigation.

Cytokines are secreted signaling proteins that play essential roles in propagating and regulating immune responses (Xiong et al., 2024b). Cytokine dysregulation is believed to have a key effect in the remodeling of the immune system (Rea et al., 2018). TGF-β promotes tumor group through immunosuppression (Larson et al., 2020). TGF-β provides an immunosuppressive microenvironment and promotes the malignant phenotype of glioblastoma (Gong et al., 2021). TGF-β enhances immunosuppression of myeloid-derived suppressor cells to induce transplant immune tolerance by affecting Arg-1 expression (Cao et al., 2022). IL-2 dose-dependently promotes the expansion and differentiation of immune cells (Yuan et al., 2022). Low IL-2 level induces CD4+ T cell differentiation and function, which are essential for the maintenance of immunosuppression (Pol et al., 2020). IL-18 promotes non-small cell lung cancer immunosuppression by driving the NF-κB pathway (Xu et al., 2023). IL-18 induces PD-1-dependent immunosuppression in cancer (Terme et al., 2011). Dysregulated IL-18 is a key driver of immunosuppression and is thought to be a possible therapeutic target in the multiple myeloma microenvironment (Nakamura et al., 2018). In this study, TGF-β expression was upregulated and IL-2 and IL-18 expression was downregulated in the infection group jejunum. We speculate that those cytokines dampen the activation and proliferation of effector T cells, perhaps leading to immunosuppression.

CD276 promotes vasculogenic mimicry in hepatocellular carcinoma via the PI3K/AKT/MMP pathway (Cheng et al., 2020). CD276 induces the epithelial–mesenchymal transition of non-small cell lung cancer through the PI3K/AKT pathway (Liao et al., 2022), and promotes the proliferation and migration of lung cancer cells by modulating the PI3K/AKT pathway via ENO1 activity (Wu, et al., 2024a). In addition, PI3K/AKT pathway activation can trigger host immunosuppression (Li et al., 2023b). PI3K/AKT/mTOR pathway activation is involved in immunosuppression in septic mice (Fu and Wang, 2023). MMPs are highly related to tumor progression, and targeting these proteins can overcome the immunosuppression barrier (Peng et al., 2023). MMP2 modulates immune responses in the tumor microenvironment and plays an immunosuppressive role in melanoma (Muniz-Bongers et al., 2021). MMP9 participates in immunosuppression and has tumor-promoting activity in metastatic melanoma (Mallardo et al., 2023). We found that PI3K/AKT/MMP pathway activation might be involved in C. perfringens–induced host immunosuppression.

CONCLUSIONS

Taken together, C. perfringens challenge of laying hens modified the blood biochemical parameters and triggered jejunum tissue damage. Specifically, C. perfringens downregulated CD3, CD4, and CD8 expression; altered the expression of cytokines (upregulated IL-1β, IL-18, TNF-α, IFN-γ, and TGF-β, and downregulated IL-2, IL-8, and IL-10); promoted LAMTOR1, mTORC1, and CD276 expression; and induced PI3K/Akt/MMP pathway activation in jejunum of laying hens. This is the first study to report CD276 expression in the jejunum induced by C. perfringens in avian necrotic enteritis. Our comprehensive analysis deepens the significant roles of CD276 which might be involved in regulating immunosuppression mechanism in avian necrotic enteritis. And targeting CD276 molecule might represent as a potential therapeutic approach to treat avian necrotic enteritis.

DISCLOSURES

The authors declare no conflict of interest.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

This work was supported by the Key Research and Development Plan of Hubei Province, China (2023BBB069 ).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104216.
==== Refs
REFERENCES

Abd El-Hack M.E. Majrashi K.A. Fakiha K.G. Roshdy M. Kamal M. Saleh R.M. Khafaga A.F. Othman S.I. Rudayni H.A. Allam A.A. Moustafa M. Tellez-Isaias G. Alagawany M. Effects of varying dietary microalgae levels on performance, egg quality, fertility, and blood biochemical parameters of laying Japanese quails (Coturnix coturnix Japonica) Poult. Sci. 103 2024 103454
Abdel Haleem M.I. Khater H.F. Edris S.N. Taie H.A.A. Abdel Gawad S.M. Hassan N.A. El-Far A.H. Magdy Y. Elbasuni S.S. Bioefficacy of dietary inclusion of Nannochloropsis oculata on Eimeria spp. challenged chicks: Clinical approaches, meat quality, and molecular docking Avian. Pathol. 53 2024 199 217 38285881
Alizadeh M. Shojadoost B. Fletcher C. Wang A. Abdelaziz K. Sharif S. Treatment of chickens with lactobacilli prior to challenge with Clostridium perfringens modifies innate responses and gut morphology Res. Vet. Sci. 172 2024 105241
Buiatte V. Dominguez D. Lesko T. Jenkins M. Chopra S. Lorenzoni A.G. Inclusion of high-flavonoid corn in the diet of broiler chickens as a potential approach for the control of necrotic enteritis Poult. Sci. 101 2022 101796
Calefi A.S. de Siqueira A. Namazu L.B. Costola-de-Souza C. Honda B.B. Ferreira A.J. Quinteiro-Filho W.M. da Silva Fonseca J.G. Palermo-Neto J. Effects of heat stress on the formation of splenic germinal centres and immunoglobulins in broilers infected by clostridium perfringens type A Vet. Immunol. Immunopathol. 171 2016 38 46 26964716
Camargo A. Ramírez J.D. Kiu R. Hall L.J. Muñoz M. Unveiling the pathogenic mechanisms of clostridium perfringens toxins and virulence factors Emerg. Microbes. Infect. 13 2024 2341968
Cao P. Sun Z. Zhang F. Zhang J. Zheng X. Yu B. Zhao Y. Wang W. Wang W. TGF-β enhances immunosuppression of myeloid-derived suppressor cells to induce transplant immune tolerance through affecting Arg-1 expression Front. Immunol. 13 2022 919674
Cheng R. Wang B. Cai X.R. Chen Z.S. Du Q. Zhou L.Y. Ye J.M. Chen Y.L. CD276 promotes vasculogenic mimicry formation in hepatocellular carcinoma via the PI3K/AKT/MMPs pathway Onco. Targets. Ther. 13 2020 11485 11498 33204103
Fathima S. Hakeem W.G.A. Shanmugasundaram R. Selvaraj R.K. Effect of arginine supplementation on the growth performance, intestinal health, and immune responses of broilers during necrotic enteritis challenge Poult. Sci. 103 2024 103815
Fu X.Z. Wang Y. Interferon-γ regulates immunosuppression in septic mice by promoting the Warburg effect through the PI3K/AKT/mTOR pathway Mol. Med. 29 2023 95 37434129
Fu S. Xu L. Li S. Qiu Y. Liu Y. Wu Z. Ye C. Hou Y. Hu C.A. Baicalin suppresses NLRP3 inflammasome and nuclear factor-kappa B (NF-κB) signaling during Haemophilus parasuis infection Vet. Res. 47 2016 80 27502767
Fu S. Yin R. Zuo S. Liu J. Zhang Y. Guo L. Qiu Y. Ye C. Liu Y. Wu Z. Hou Y. Hu C.A. The effects of baicalin on piglets challenged with Glaesserella parasuis Vet. Res. 51 2020 102 32795339
Gharib-Naseri K. Kheravii S.K. Nguyen H.T. Wu S.B. Bromelain can reduce the negative effects of a subclinical necrotic enteritis in broiler chickens Poult. Sci. 103 2024 103560
Gomez-Bris R. Saez A. Herrero-Fernandez B. Rius C. Sanchez-Martinez H. Gonzalez-Granado J.M. CD4 T-Cell subsets and the pathophysiology of inflammatory bowel disease Int. J. Mol. Sci. 24 2023 2696 36769019
Gong L. Ji L. Xu D. Wang J. Zou J. TGF-β links glycolysis and immunosuppression in glioblastoma Histol. Histopathol. 36 2021 1111 1124 34323284
Guo X. Chang M. Wang Y. Xing B. Ma W. B7-H3 in brain malignancies: Immunology and immunotherapy Int. J. Biol. Sci. 19 2023 3762 3780 37564196
Hertel A. Alves L.M. Dutz H. Tascher G. Bonn F. Kaulich M. Dikic I. Eimer S. Steinberg F. Bremm A. USP32-regulated LAMTOR1 ubiquitination impacts mTORC1 activation and autophagy induction Cell. Rep. 41 2022 111653
Hickey J.W. Becker W.R. Nevins S.A. Horning A. Perez A.E. Zhu C. Zhu B. Wei B. Chiu R. Chen D.C. Cotter D.L. Esplin E.D. Weimer A.K. Caraccio C. Venkataraaman V. Schürch C.M. Black S. Brbić M. Cao K. Chen S. Zhang W. Monte E. Zhang N.R. Ma Z. Leskovec J. Zhang Z. Lin S. Longacre T. Plevritis S.K. Lin Y. Nolan G.P. Greenleaf W.J. Snyder M. Organization of the human intestine at single-cell resolution Nature 619 2023 572 584 37468586
Hirschberg H. Zhang M.J. Gach H.M. Uzal F.A. Peng Q. Sun C.H. Chighvinadze D. Madsen S.J. Targeted delivery of bleomycin to the brain using photo-chemical internalization of Clostridium perfringens epsilon prototoxin J. Neurooncol. 95 2009 317 329 19506813
Hosokawa T. Kimura T. Nada S. Okuno T. Ito D. Kang S. Nojima S. Yamashita K. Nakatani T. Hayama Y. Kato Y. Kinehara Y. Nishide M. Mikami N. Koyama S. Takamatsu H. Okuzaki D. Ohkura N. Sakaguchi S. Okada M. Kumanogoh A. Lamtor1 Is critically required for CD4(+) T cell proliferation and regulatory T cell suppressive function J. Immunol. 199 2017 2008 2019 28768723
Huang Y. Zhang H.L. Li Z.L. Du T. Chen Y.H. Wang Y. Ni H.H. Zhang K.M. Mai J. Hu B.X. Huang J.H. Zhou L.H. Yang D. Peng X.D. Feng G.K. Tang J. Zhu X.F. Deng R. FUT8-mediated aberrant N-glycosylation of B7H3 suppresses the immune response in triple-negative breast cancer Nat. Commun. 12 2021 2672 33976130
Ito S. Nada S. Yamazaki D. Kimura T. Kajiwara K. Miki H. Okada M. p18/Lamtor1-mTORC1 signaling controls development of mucin-producing goblet cells in the intestine Cell. Struct. Funct. 45 2020 93 105 32641600
Joshi V. Beecher K. Lim M. Stacey A. Feng Y. Jat P.S. Duijf P.H.G. Simpson P.T. Lakhani S.R. McCart Reed A.E. B7-H3 expression in breast cancer and brain metastasis Int. J. Mol. Sci. 25 2024 3976 38612786
Kadekar D. Udrea A.C. Bak S.Y. Christensen N. Gibbs K. Shen C. Bernardeau M. Cell-free culture supernatant of lactobacillus acidophilus AG01 and bifidobacterium animalis subsp. Lactis AG02 reduces the pathogenicity of NetB-positive clostridium perfringens in a chicken intestinal epithelial cell line Microorganisms 12 2024 839 38674783
Kakese Mukosa R. Thibodeau A. Fairbrother J.Morris Thériault W. Gaucher M.L. Addressing current challenges in poultry meat safety: Development of a cultivation and colony hybridization approach to recover enterotoxigenic clostridium perfringens from broiler chicken carcasses Pathogens 13 2023 30 38251337
Kelly P.A. McHugo G.P. Scaife C. Peters S. Stevenson M.L. McKay J.S. MacHugh D.E. Saez I.L. Breathnach R. Unveiling the role of endoplasmic reticulum stress pathways in canine demodicosis Parasite. Immunol. 46 2024 e13033 38607285
Larson C. Oronsky B. Carter C.A. Oronsky A. Knox S.J. Sher D. Reid T.R. TGF-beta: A master immune regulator Expert. Opin. Ther. Targets. 24 2020 427 438 32228232
Ledwoń A. Murawska M. Dolka I. Chmiel D.C. Szleszczuk P. Case of necrotic enteritis associated with campylobacteriosis and coccidiosis in an adult Indian peacock (Pavo cristatus) BMC. Vet. Res. 18 2022 160 35501900
Li M. Li N. Clostridium perfringens bloodstream infection secondary to acute pancreatitis: A case report World. J. Clin. Cases. 9 2021 4357 4364 34141801
Li J. Yin K. Hou L. Zhang Y. Lu H. Ma C. Xing M. Polystyrene microplastics mediate inflammatory responses in the chicken thymus by Nrf2/NF-κB pathway and trigger autophagy and apoptosis Environ. Toxicol. Pharmacol. 100 2023 104136
Li Z. Sun Q. Liu Q. Mu X. Wang H. Zhang H. Qin F. Wang Q. Nie D. Liu A. Li Q. Ji J. Jiang Y. Lu S. Wang Q. Lu Z. Compound 511 ameliorates MRSA-induced lung injury by attenuating morphine-induced immunosuppression in mice via PI3K/AKT/mTOR pathway Phytomedicine 108 2023 154475
Li J. Liu S. Dong Q. Fu Y. Sun Y. Luo R. Tian X. Guo L. Liu W. Qiu Y. Lu Q. Ye C. Zong B. Fu S. PD-1/PD-L1 axis induced host immunosuppression via PI3K/Akt/mTOR signalling pathway in piglets infected by Glaesserella Parasuis BMC. Vet. Res. 20 2024 141 38582846
Liao H. Ding M. Zhou N. Yang Y. Chen L. B7‑H3 promotes the epithelial‑mesenchymal transition of NSCLC by targeting SIRT1 through the PI3K/AKT pathway Mol. Med. Rep. 25 2022 79 35029291
Liu H.J. Du H. Khabibullin D. Zarei M. Wei K. Freeman G.J. Kwiatkowski D.J. Henske E.P. mTORC1 upregulates B7-H3/CD276 to inhibit antitumor T cells and drive tumor immune evasion Nat. Commun. 14 2023 1214 36869048
Liu H. Liu W. Ai M. Hao X. Zhang Q. Ren J. Zhang K. Effects of β-mannanase supplementation on productive performance, inflammation, energy metabolism, and cecum microbiota composition of laying hens fed with reduced-energy diets Poult. Sci. 103 2024 103521
Loutet S.A. Cheung S. Zaytsoff S. Hofacre C. Jones M.K. Van Petegem F. Abnousi H. Research note: Clostridium perfringens NetB and CnaA neutralizing nanobodies in feed reduce the incidence of poultry necrotic enteritis Poult. Sci. 103 2024 103578
Makhlouf Y. Singh V.K. Craig S. McArdle A. French D. Loughrey M.B. Oliver N. Acevedo J.B. O'Reilly P. James J.A. Maxwell P. Salto-Tellez M. True-T - Improving T-cell response quantification with holistic artificial intelligence based prediction in immunohistochemistry images Comput. Struct. Biotechnol. J. 23 2024 174 185 38146436
Mallardo D. Fordellone M. White A. Ottaviano M. Sparano F. Bailey M. Facchini A.B. Ong S. Maiolino P. Caracò C. Church S. Cavalcanti E. Warren S. Budillon A. Cesano A. Simeone E. Chiodini P. Ascierto P.A. CD39 and LDHA affects the prognostic role of NLR in metastatic melanoma patients treated with immunotherapy J. Transl. Med. 21 2023 610 37684649
Mander K.A. Finnie J.W. Loss of endothelial barrier antigen immunoreactivity in rat retinal microvessels is correlated with clostridium perfringens type D epsilon toxin-induced damage to the blood-retinal barrier J. Comp. Pathol. 158 2018 51 55 29422315
Miller C.D. Lozada J.R. Zorko N.A. Elliott A. Makovec A. Radovich M. Heath E.I. Agarwal N. McKay R.R. Garje R. Bastos B.R. Hoon D.S.B. Orme J.J. Sartor O. VanderWalde A. Nabhan C. Sledge G. Shenderov E. Dehm S.M. Lou E. Miller J.S. Hwang J.H. Antonarakis E.S. Pan-cancer interrogation of B7-H3 (CD276) as an actionable therapeutic target across human malignancies Cancer. Res. Commun. 4 2024 1369 1379 38709075
Miyamoto T. Murakami R. Hamanishi J. Tanigaki K. Hosoe Y. Mise N. Takamatsu S. Mise Y. Ukita M. Taki M. Yamanoi K. Horikawa N. Abiko K. Yamaguchi K. Baba T. Matsumura N. Mandai M. B7-H3 suppresses antitumor immunity via the CCL2-CCR2-M2 macrophage axis and contributes to ovarian cancer progression Cancer. Immunol. Res. 10 2022 56 69 34799346
Mowat A.M. Agace W.W. Regional specialization within the intestinal immune system Nat. Rev. Immunol. 14 2014 667 685 25234148
Muniz-Bongers L.R. McClain C.B. Saxena M. Bongers G. Merad M. Bhardwaj N. MMP2 and TLRs modulate immune responses in the tumor microenvironment JCI. Insight. 6 2021 e144913
Nakamura K. Kassem S. Cleynen A. Chrétien M.L. Guillerey C. Putz E.M. Bald T. Förster I. Vuckovic S. Hill G.R. Masters S.L. Chesi M. Bergsagel P.L. Avet-Loiseau H. Martinet L. Smyth M.J. Dysregulated IL-18 is a key driver of immunosuppression and a possible therapeutic target in the multiple myeloma microenvironment Cancer. Cell. 33 2018 634 648.e5 29551594
O’Brien J.W. Case A. Kemper C. Zhao T.X. Mallat Z. Therapeutic avenues to modulate B-cell function in patients with cardiovascular disease Arterioscler. Thromb. Vasc. Biol. 44 2024  1512  1522 38813699
Ou L. Ye B. Sun M. Qi N. Li J. Lv M. Lin X. Cai H. Hu J. Song Y. Chen X. Zhu Y. Yin L. Zhang J. Liao S. Zhang H. Mechanisms of intestinal epithelial cell damage by clostridiumperfringens Anaerobe 87 2024 102856
Peng K. Zhang Y. Liu D. Chen J. MMP2 is a immunotherapy related biomarker and correlated with cancer-associated fibroblasts infiltrate in melanoma Cancer. Cell. Int. 23 2023 26 36788565
Pol J.G. Caudana P. Paillet J. Piaggio E. Kroemer G. Effects of interleukin-2 in immunostimulation and immunosuppression J. Exp. Med. 217 2020 e20191247
Rea I.M. Gibson D.S. McGilligan V. McNerlan S.E. Alexander H.D. Ross O.A. Age and age-related diseases: Role of inflammation triggers and cytokines Front. Immunol. 9 2018 586 29686666
Redondo L.M. Redondo E.A. Dailoff G.C. Leiva C.L. Díaz-Carrasco J.M. Bruzzone O.A. Cangelosi A. Geoghegan P. Fernandez-Miyakawa M.E. Effects of clostridium perfringens iota toxin in the small intestine of mice Anaerobe 48 2017 83 88 28764997
Sun J. Liu Y. Jia Y. Hao X. Lin W.J. Tran J. Lynch G. Baudry M. Bi X. UBE3A-mediated p18/LAMTOR1 ubiquitination and degradation regulate mTORC1 activity and synaptic plasticity Elife 7 2018 e37993 30020076
Sun L. Su Y. Jiao A. Wang X. Zhang B. T cells in health and disease Signal. Transduct. Target. Ther. 8 2023 235 37332039
Takehara M. Study on the interaction between clostridium perfringens and the host Nihon. Saikingaku. Zasshi. 76 2021 149 160 34789601
Terme M. Ullrich E. Aymeric L. Meinhardt K. Desbois M. Delahaye N. Viaud S. Ryffel B. Yagita H. Kaplanski G. Prévost-Blondel A. Kato M. Schultze J.L. Tartour E. Kroemer G. Chaput N. Zitvogel L. IL-18 induces PD-1-dependent immunosuppression in cancer Cancer. Res. 71 2011 5393 5399 21724589
Tian X. Li J. Liu S. Dong Q. Fu Y. Luo R. Sun Y. Guo L. Lu Q. Ye C. Liu J. Fu S. Qiu Y. Anemoside B4 attenuates necrotic enteritis of laying hens induced by Clostridium perfringens via inhibiting NF-κB and PI3K/Akt/mTOR signalling pathways Heliyon 10 2024 e33161 39005924
Uojima H. Onoue M. Hidaka H. Wada N. Tanaka Y. Inoue T. Kubota K. Nakazawa T. Shibuya A. Koizumi W. A suspected case of Clostridium perfringens sepsis with intravascular hemolysis after transhepatic arterial chemoembolization: A case report J. Med. Case. Rep. 13 2019 125 31027514
van der Klein S.A.S. Evans C. Marchal J.L.M. Gibbs K. Elucidating the varying impact of necrotic enteritis using performance and health indicators in broiler infection models Avian. Dis. 67 4 2024 326 339 38300654
Wu X. Ding C. Liu Y. Dong K. Zhang H. B7-H3 promotes proliferation and migration of lung cancer cells by modulating PI3K/AKT pathway via ENO1 activity Transl. Cancer. Res. 13 2024 833 846 38482406
Wu Y. Han W. Tang X. Liu J. Guo Z. Li Z. Cai C. Que L. B7-H3 suppresses CD8(+) T cell immunologic function through reprogramming glycolytic metabolism J. Cancer. 15 2024 2505 2517 38577598
Xiong G. Chen Z. Liu Q. Peng F. Zhang C. Cheng M. Ling R. Chen S. Liang Y. Chen D. Zhou Q. CD276 regulates the immune escape of esophageal squamous cell carcinoma through CXCL1-CXCR2 induced NETs J. Immunother. Cancer. 12 2024 e008662
Xiong L. Liu Y. Wang Y. Zhao H. Song X. Fan W. Zhang L. Zhang Y. The protective effect of lonicera japonica thunb. Against lipopolysaccharide-induced acute lung injury in mice: Modulation of inflammation, oxidative stress, and ferroptosis J. Ethnopharmacol. 331 2024 118333
Xu J. Li J. Xiao K. Zou S. Yan P. Xie X. Xie L. Dynamic changes in human HLA-DRA gene expression and Th cell subsets in sepsis: Indications of immunosuppression and associated outcomes Scand. J. Immunol. 91 2020 e12813 31386235
Xu L. Li K. Li J. Xu F. Liang S. Kong Y. Chen B. IL-18 serves as a main effector of CAF-derived METTL3 against immunosuppression of NSCLC via driving NF-κB pathway Epigenetics 18 2023 2265625
Yan Z. Fu B. Zhu Y. Zhang Y. Wu Y. Xiong P. Zhou H. Wang Y. Wang S. Chen G. Zhang R. Sun C. High intestinal carriage of clostridium perfringens in healthy individuals and ICU patients in Hangzhou, China Microbiol. Spectr.  12 2024 e0338523
Yuan Y. Kolios A.G.A. Liu Y. Zhang B. Li H. Tsokos G.C. Zhang X. Therapeutic potential of interleukin-2 in autoimmune diseases Trends. Mol. Med. 28 2022 596 612 35624009
Zhao L. Gao N. Peng X. Chen L. Meng T. Jiang C. Jin J. Zhang J. Duan Q. Tian H. Weng L. Wang X. Tan X. Li Y. Qin H. Yuan J. Ge X. Deng L. Wang P. TRAF4-mediated LAMTOR1 ubiquitination promotes mTORC1 activation and inhibits the inflammation-induced colorectal cancer progression Adv. Sci. (Weinh) 11 2024 e2301164
Zhou Y. Regulatory T cells and viral infections Front. Biosci. 13 2008 1152 1170 17981620
Zhou H. Wang L. Liu F. Immunological impact of intestinal T cells on metabolic diseases Front. Immunol. 12 2021 639902
